Name: detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr
Uploaded: 2018-02-05T15:00:00
Description: Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

De auteurs bedank Gráinne Tierney voor redactionele ondersteuning.

Het protocol volgt de richtsnoeren van de ethische commissie voor het eerste menselijke onderzoek.
Opmerking: Deze procedure is speciaal ontworpen voor de detectie van een laag aantal cDNA moleculen in vers bevroren weefsels. De weefselsecties zijn gesneden op droog ijs, terwijl nog steeds bevroren, uit eerder gevalideerde patiënt afkomstige maag tumor of normale weefselmonsters.
1. RNA isolatie en zuivering
<ol><li>
RNA extractie Opmerking: R...

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

dPCR werd oorspronkelijk ontwikkeld voor DNA moleculaire metingen10,11,12,13 en op tijd die werd deze technologie aangepast voor de kwantificering van microRNAs en RNA afschriften5, 14,,15. In dit protocol hebben we de lijst van toepassingen tot opsporing van zeldzame afschriften afgeleid van vers bev...

Het CDH1 -gen codeert voor E-cadherine, een belangrijke factor die betrokken zijn bij het onderhoud van de normale maag epitheel via de regulering van de cel adhesie, overleving, proliferatie en migratie1. Verlies van E-cadherine eiwitten als gevolg van schadelijke germline of somatische wijzigingen van CDH1 is gekoppeld aan de ontwikkeling van GC2,3. Niet-canonieke afschriften die voortvloeien uit intron 2 van het gen hebben ook zijn veronderstelde om te spelen een rol in de maag carcinogenese4,5. In het bijzonder, een dergelijke transcript, CDH1a, is aangetoond moet worden uitgedrukt in GC cellijnen maar afwezig is uit de normale maag-4. We onlangs ontdekt CDH1a in GC weefselmonsters van GC patiënten met chip gebaseerde dPCR5. dPCR werd gebruikt om te evalueren, voor het eerst, de aanwezigheid van het CDH1a gene transcript in intestinale GC en in normale weefsel.
De gouden standaard methode om te bepalen van genexpressie is kwantitatieve PCR in real time (qPCR). Echter de resulterende gegevens kunnen soms variabele en van slechte kwaliteit, vooral wanneer het niveau van de doelgroep in de steekproef is laag. Deze variabiliteit kan worden veroorzaakt door verontreinigingen, die remming van polymeraseactiviteit en primer gloeien, wat leidt tot niet-specifieke versterking en concurrerende kant reacties6.
Hoewel de biochemische basisprincipes van dPCR vergelijkbaar met die van qPCR zijn, dPCR toont enkele voordelen, waardoor voor zeer nauwkeurige metingen van genomic DNA (gDNA) / complementaire DNA (cDNA) moleculen. Inderdaad, dPCR is een eindpunt reactie die is gebaseerd op de geijkte partitioneren van een monster in duizenden wells, zodat elk goed nul of een één doelmolecule bevat. Versterking vervolgens treedt alleen op in de putjes met een kopie van de doelgroep en wordt aangegeven door een fluorescerende signaal. Het absolute aantal doel moleculen in de oorspronkelijke steekproef kan vervolgens worden berekend door het bepalen van de verhouding van positief naar totale partities met behulp van de binomiale Poisson statistieken7.
Bovendien, de techniek van de dPCR elimineert de noodzaak voor het uitvoeren van een standaard curve en dus de bijbehorende bias en variabiliteit, waardoor een directe kwantificering van de doelstellingen van de8,9; het produceert meer nauwkeurige en reproduceerbare resultaten onafhankelijk van contaminanten en efficiëntie toe te schrijven aan zijn hoge tolerantie voor remmers10; het is meer gevoelig en specifiek zijn dan qPCR, en is dus een betrouwbare methode voor de detectie van een zeldzame doel. Tot slot, het partitioneren van het monster in meerdere reacties vermindert de competitie met achtergrond moleculen en verbetert de limiet van Doelsector Detectie, versterking mogelijk te maken en het vergemakkelijken van de detectie van afzonderlijke moleculen van gDNA/cDNA6 . De detectie en kwantificering van nucleic zuren door chip gebaseerde dPCR is steeds meer toegepast als u wilt kopiëren van nummer variatie, kwantificering van DNA fragmenten en mutatie analyseert11,12,13, gegeven de precisie en lage materiaal ingang eis van de methode. Bovendien, heeft dPCR onlangs zijn geïntegreerd in de analyse van beide microRNAs14 en gene afschriften5,15.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a, een niet-canonieke transcript van de CDH1 -gen, is gebleken dat moet worden uitgedrukt in sommige cellijnen van maagkanker (GC), terwijl het is afwezig in normaal maagslijmvlies. Onlangs ontdekt we CDH1a transcript variant in vers bevroren tumor weefsels verkregen van patiënten met GC. De uitdrukking van deze variant in weefselsteekproeven werd onderzocht door de chip gebaseerde digitale PCR (dPCR) hier gepresenteerde benadering. dPCR biedt de mogelijkheid voor een nauwkeurige, robuuste en zeer gevoelige meting van nucleïnezuren en wordt steeds meer gebruikt voor vele toepassingen in verschillende velden. dPCR is geschikt voor het opsporen van zeldzame doelstellingen; dPCR biedt bovendien de mogelijkheid voor absolute en precieze kwantificering van nucleïnezuren zonder de noodzaak voor kalibratoren en standaard curven. In feite, verrijkt de reactie partitionering het doel van de achtergrond, die versterking efficiëntie en tolerantie voor remmers worden. Deze kenmerken maken dPCR een optimale tool voor de detectie van de zeldzame transcript van CDH1a .

Met behulp van de procedure die hier, wij gecontroleerd voor de uitdrukking van de zeldzame transcript variant CDH1a in maag vers bevroren weefsels. De analyse door dPCR werd uitgevoerd op 21-gepaarde normaal en kanker weefselsteekproeven en in 11 extra tumor monsters. CDH1a was in 15 van 32 (47%) tumoren, worden opgespoord, terwijl geen normale weefselsteekproeven de aanwezigheid van deze zeldzame transcript5 toonde. In onze analyse, chips met mi...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Detectie van een CDH1 zeldzame Transcript Variant in vers bevroren maagkanker weefsels door Chip gebaseerde digitale PCR

Het manuscript beschrijft een chip gebaseerde digitale PCR assay om te ontdekken een zeldzame CDH1 transcript variant (CDH1a) in normale vers bevroren en tumor weefsels verkregen van patiënten met maagkanker.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

Ontwikkeling van een menselijke preklinische Model van Osteoclastogenesis uit perifeer bloed monocyten mede gekweekt met borst kanker cellijnen

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

Detectie van zeldzame mutaties in CtDNA met behulp van de volgende generatie Sequencing

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

Serum en Plasma kopiëren nummer detectie met behulp van PCR in real time

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

Elastische kleuring op paraffine-ingesloten Dia's van pT3N0M0 maagkanker weefsel

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

Digitale analyse van immunokleuring van ZW10 interactie eiwit in menselijke Long weefsels

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

Opsporen van Protease-activiteit door fluorescerende Peptide Zymography

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Evaluation of Colorectal Cancer Risk and Prevalence by Stool DNA Integrity Detection

Evaluatie van colorectale kanker risico en prevalentie door ontlasting DNA Integriteit Detectie

Nowadays, stool DNA can be isolated and analyzed by several methods. The long fragments of DNA in stool can be detected by a qPCR assay, which provides a ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

Oprichting van maagkanker patiënten afgeleide xenograft modellen en primaire cellijnen

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Detectie van de Retrotransponerings activiteit van Hot LINE-1S door de lange afstand inverse PCR

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

Detectie van longtumorprogressie bij muizen door echografie

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...