Name: detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr
Uploaded: 2018-02-05T15:00:00
Description: Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Les auteurs tiennent à remercier Gráinne Tierney pour aide à la rédaction.

Le protocole suit les directives de l’IRST Human Research Ethics Committee.
Remarque : Cette procédure est spécialement conçue pour la détection d’un faible nombre de molécules de cDNA dans les tissus humains frais congelé. Les sections de tissu ont été coupées sur la glace sèche, alors qu’il est encore gelé, précédemment validé patient dérivé de tumeur gastrique ou des échantillons de tissus normaux.
1. isolement et purification
<ol><li>
<...

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

dPCR a été initialement développé pour ADN moléculaire mesures10,11,12,13 et dans le temps, que cette technologie a été adaptée pour la quantification des microARN et RNA transcription5, 14,15. Dans ce protocole, nous avons étendu la liste des applications à inclure la détection des transcr...

Le gène CDH1 code E-cadhérine, un facteur clé dans le maintien de l’épithélium gastrique normal grâce à la régulation de l’adhérence, la survie, la prolifération et la migration des cellules1. Perte de protéine E-cadhérine par suite de la lignée germinale délétère ou des altérations somatiques de CDH1 a été associées au développement de GC2,3. Non-canonical transcriptions résultant de l’intron 2 du gène ont également émis l’hypothèse pour jouer un rôle dans la cancérogenèse gastrique4,5. En particulier, une telle transcription, CDH1a, s’est avérée être exprimée dans les lignées cellulaires GC mais est absente de l' estomac normal4. Nous avons décelé récemment CDH1a dans des échantillons de tissus de GC de patients GC à l’aide de la puce dPCR5. dPCR a permis d’évaluer, pour la première fois, la présence de la transcription de gène de CDH1a en GC intestinal et dans les tissus normaux.
La méthode de l’étalon-or pour déterminer l’expression des gènes est PCR quantitative en temps réel (qPCR). Toutefois, les données qui en résulte peuvent parfois être variable et de mauvaise qualité, surtout quand le niveau de la cible dans l’échantillon est faible. Cette variabilité peut être causée par des contaminants, qui inhibent l’activité polymérase et apprêt recuit, conduisant à l’amplification non spécifique et compétitif côté réactions6.
Bien que les principes biochimiques de dPCR sont semblables à ceux de qPCR, dPCR montre certains avantages, permettant des mesures très précises de l’ADN génomique (ADNg) / complémentaires des molécules d’ADN (ARNC). En effet, dPCR est une réaction de point d’arrêt qui s’appuie sur le partitionnement calibrée d’un échantillon à des milliers de puits, afin que chacun contient bien zéro ou une molécule cible unique. Amplification puis se produit seulement dans les puits contenant une copie de la cible et est indiquée par un signal fluorescent. Le nombre absolu des molécules cibles dans l’échantillon initial peut ensuite être calculé en déterminant le rapport positif au totales partitions à l’aide de binomial Poisson statistiques7.
En outre, la technique dPCR élimine la nécessité d’une courbe d’étalonnage en cours d’exécution et, par conséquent, le biais associés et la variabilité, ce qui permet une quantification directe de cibles8,9; elle produit des résultats plus précis et reproductibles indépendamment de contaminants et d’efficacité en raison de sa grande tolérance aux inhibiteurs10; Il est plus sensible et plus spécifique que la qPCR et est donc une méthode fiable pour la détection d’une cible rare. Enfin, la répartition de l’échantillon dans plusieurs réactions réduit la compétition avec les molécules de fond et améliore la limite de détection de la cible, permettant l’amplification et de faciliter la détection des molécules simples de l’ADNg/ADNc6 . La détection et la quantification d’acides nucléiques par puce dPCR a été appliquée de plus en plus pour copier le numéro variation, fragments de quantification de l’ADN et analyse de mutation11,12,13, compte tenu de la précision et les matières radioactives faiblement exigence de la méthode d’entrée. En outre, dPCR a récemment été intégré dans l’analyse de ces deux microARN14 et gène transcriptions5,15.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a, un relevé de notes non canoniques du gène CDH1 , s’est avéré être exprimée dans certaines lignées cellulaires de cancer de l’estomac (GC), considérant qu’il est absent dans la muqueuse gastrique normale. Récemment, nous avons détecté CDH1a variante de transcription dans les tissus frais congelés tumeur provenant de patients atteints de GC. L’expression de cette variante dans les échantillons de tissus a été étudiée par l’approche de la PCR (dPCR) en numérique de puce, présentée ici. dPCR offre le potentiel pour une mesure précise, robuste et hautement sensible d’acides nucléiques et est de plus en plus utilisé pour de nombreuses applications dans différents domaines. dPCR est capable de détecter des cibles rares ; en outre, dPCR offre la possibilité pour la quantification précise et absolue d’acides nucléiques sans nécessiter de calibrateurs et courbes d’étalonnage. En fait, la réaction de partitionnement enrichit la cible de l’arrière-plan, ce qui améliore l’efficacité de l’amplification et la tolérance aux inhibiteurs. Ces caractéristiques rendent dPCR un outil optimal pour la détection de la transcription de rares CDH1a .

À l’aide de la procédure présentée ici, nous avons vérifié pour l’expression de la variante rare de transcription CDH1a dans les tissus frais congelés gastriques. L’analyse par dPCR a été réalisée sur des échantillons de tissu normal et le cancer 21 paires et dans 11 échantillons de tumeur supplémentaires. CDH1a a été détecté dans 15 des 32 (47 %) des tumeurs, alors qu’aucun échantillon de tissus normaux ont montré la présence de cette transc...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Détection d’une variante de transcription Rare CDH1 dans les tissus frais congelés de Cancer gastrique par puce numérique PCR

Le manuscrit décrit une puce numérique PCR pour détecter une variante rare du transcript CDH1 (CDH1a) en mode normal frais-congelé et tissus tumoraux obtenus de patients atteints de cancer gastrique.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

Développement d’un humain modèle préclinique de Osteoclastogenesis de Monocytes du sang périphérique conjointement mis en culture avec des lignées cellulaires de Cancer du sein

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Recherche

Recherche en cancérologie

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

Détection des Mutations rares dans ADNct à l’aide de prochaine génération séquençage

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

Sérum et Plasma copie numéro détection par PCR en temps réel

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

Staining élastique sur les diapositives intégrées à la paraffine du tissu du cancer gastrique pT3N0M0

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

Analyse numérique de l'immunostaining de ZW10 Interagir les protéines dans les tissus pulmonaires humains

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

Détection d’activité de la protéase par Zymographie peptides fluorescents

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Evaluation of Colorectal Cancer Risk and Prevalence by Stool DNA Integrity Detection

Évaluation du risque et de la prévalence du cancer colorectal par détection de l’intégrité de l’ADN des selles

Nowadays, stool DNA can be isolated and analyzed by several methods. The long fragments of DNA in stool can be detected by a qPCR assay, which provides a ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

Établissement de modèles de xénogreffe dérivés du cancer gastrique et de lignées cellulaires primaires

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Détection de l'activité de rétrotransposition des lignes-1 chaudes par PCR inverse à longue distance

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

Détection de la progression des tumeurs pulmonaires chez les souris par imagerie par ultrasons

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...