Name: detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr
Uploaded: 2018-02-05T15:00:00
Description: Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

המחברים רוצים להודות Gráinne טירני לסיוע העריכה.

הפרוטוקול עוקב אחר הקווים המנחים של ועדת האתיקה IRST מחקר אנושי.
הערה: הליך זה היא תוכננה במיוחד עבור זיהוי מספר נמוך של cDNA מולקולות ברקמות אנושיות מוקפאות. הסעיפים רקמות צומצמו בקרח יבש, בעוד עדיין קפוא, הגידול המאומת בעבר נגזר החולה קיבה או דגימות רקמה נורמלית.
<p class="jove_title"...

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

dPCR פותחה במקור עבור ה-DNA מדידות מולקולרית10,11,12,13 , בזמן שטכנולוגיה זו הותאמה עבור כימות של מיקרו Rna ו- RNA תעתיקים5, 14,15. ב פרוטוקול זה הרחבנו את רשימת יישומים לכלול גילוי ש?...

הגן CDH1 מקודד עבור E-קדהרין, גורם מפתח מעורב קיומם של האפיתל קיבה רגיל באמצעות ויסות תא אדהזיה, הישרדות, הפצה, העברה1. איבוד חלבון E-קדהרין כתוצאה germline ברישול או שינויים סומאטית של CDH1 היה קשור עם התפתחות GC2,3. Non-קנונית תעתיקים הנובעים אינטרון 2 של הגן יש גם היה שיערו לשחק תפקיד carcinogenesis קיבה4,5. בפרט, אחד תעתיק כזה, CDH1a, הוכח להתבטא שורות תאים GC אבל הוא נעדר מן בקיבה נורמלי4. לאחרונה גילינו CDH1a GC דגימות רקמות מחולים GC משתמש המבוסס על שבב dPCR5. dPCR שימש כדי להעריך, בפעם הראשונה, הנוכחות של בתמליל ג'ין CDH1a GC מעיים, רקמה נורמלית.
השיטה תקן הזהב כדי לקבוע ביטוי גנים היא PCR כמותי בזמן אמת (qPCR). עם זאת, הנתונים המתקבלים לפעמים יכול להיות משתנה, באיכות ירודה, במיוחד כאשר רמת היעד במדגם הוא נמוך. ההשתנות יכולה להיגרם על ידי מזהמים, ומפריעים פולימראז פעילות של פריימר חישול, המוביל שאינם ספציפיים הגברה צידו התחרותי תגובות6.
העקרונות הבסיסיים הביוכימי של dPCR אמנם דומים לאלה של qPCR, dPCR מראה כמה יתרונות, מתן אפשרות עבור מדידות מדויקות מאוד של דנ א גנומי (gDNA) / משלימים במולקולות דנ א (cDNA). אכן, dPCR הוא לתגובה מובילים המסתמך על מכוילת חלוקת מדגם לאלפי וולס, כך שכל אחד טוב מכיל אפס או מולקולה יעד בודד. הגברה ואז מתרחשת רק אצל הבארות המכיל עותק של המטרה, הוא הצביע על ידי אות ניאון. המספר המוחלט של היעד מולקולות במדגם המקורי ואז יכול להיות מחושב על-ידי קביעת יחס חיובי הכולל מחיצות באמצעות פואסון בינומי סטטיסטיקה7.
בנוסף, הטכניקה dPCR מבטל את הצורך להפעיל עיקול רגיל ומכאן הטיה המשויך ולשינויים, המאפשרות כימות ישירה של מטרות8,9; הוא מייצר תוצאות מדויקות יותר לשחזור ללא תלות מזהמים ויעילות בשל שלה עמידות גבוהה בפני מעכבי10; זה הוא רגיש יותר ספציפית יותר qPCR, והוא לכן שיטה אמינה עבור זיהוי מטרה נדיר. לבסוף, חלוקת המדגם לתוך תגובות מרובות מפחיתה את התחרות עם רקע מולקולות ומשפר את הגבול של גילוי מטרה, כך הגברה מאפשר והקלה הגילוי של מולקולות יחיד של gDNA/cDNA6 . זיהוי, כימות של חומצות גרעין על ידי מבוססי שבב dPCR יותר ויותר הוחל להעתיק מספר וריאציות, כימות של ה-DNA שברים, וניתוחים מוטציה11,12,13, נתן דיוק של החומר נמוכה קלט דרישה של השיטה. בנוסף, dPCR לאחרונה שולב הניתוח של שני מיקרו Rna14 וג'ין תעתיקים5,15.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a, תעתיק קאנונית של הגן CDH1 , נמצאה לבוא לידי ביטוי כמה שורות תאים של סרטן קיבה (GC), ואילו זה נעדר ב רירית קיבה נורמלית. לאחרונה, הבחנו variant תעתיק CDH1a ברקמות הגידול מוקפאות המתקבל חולים עם GC. הביטוי של זה וריאנט של דגימות רקמה נחקר על ידי מבוססי שבב דיגיטלי PCR (dPCR) הגישה המובאת כאן. dPCR מציע את הפוטנציאל מדידה מדויקת, חזקים, רגישה מאוד של חומצות גרעין, הוא מנוצל יותר ויותר עבור יישומים רבים בתחומים שונים. dPCR הוא מסוגל גילוי מטרות נדיר; בנוסף, dPCR מציע את האפשרות על כימות מוחלטת ומדויק של חומצות גרעין ללא צורך כיילים ועיקולים סטנדרטי. למעשה, התגובה למחיצות מעשיר את המטרה מהרקע, אשר משפר את עמידות בפני מעכבי ויעילות הגברה. תכונות אלה להפוך dPCR כלי אופטימלית עבור זיהוי בתמליל נדירים CDH1a .

באמצעות ההליך המובאת כאן, בדקנו עבור הביטוי של variant התעתיק נדיר CDH1a ברקמות מוקפאות קיבה. ניתוח הנתונים על-ידי dPCR היה הופיעה על 21-זוגי רגיל וסרטן דגימות רקמה 11 דגימות הגידול נוספים. CDH1a היה לזיהוי גידולים 15 מתוך 32 (47%), ואילו דגימות רקמה נורמלית לא הראה הנוכחות של התע...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

זיהוי של Variant התעתיק נדיר CDH1 ברקמות מוקפאות סרטן קיבה על ידי מבוססי שבב דיגיטלי PCR

כתב היד מתאר מבוססי שבב דיגיטלי PCR assay לזהות נדיר CDH1 התעתיק variant (CDH1a) רגילה מוקפאות ורקמות הגידול המתקבל בחולים עם סרטן קיבה.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

התפתחות מודל פרה האנושית של Osteoclastogenesis של דם היקפיים ומונוציטים תרבותי משותף עם שורות תאים של סרטן השד

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

זיהוי של מוטציות נדירות CtDNA באמצעות רצף הדור הבא

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

סרום ו פלזמה עותק מספר זיהוי באמצעות PCR בזמן אמת

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

מכתים אלסטי על פרפין-שקופיות מוטבעות של רקמת סרטן pT3N0M0 קיבה

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

ניתוח דיגיטלי של מעטפת חיסונית של חלבון ZW10 אינטראקציה רקמות ריאות האדם

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

זיהוי של פרוטאז פעילות על-ידי ניאון פפטידים Zymography

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Evaluation of Colorectal Cancer Risk and Prevalence by Stool DNA Integrity Detection

הערכה של סרטן המעי הגס סיכון ושכיחות על ידי שרפרף DNA זיהוי שלמות

Nowadays, stool DNA can be isolated and analyzed by several methods. The long fragments of DNA in stool can be detected by a qPCR assay, which provides a ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

הקמת החולה סרטן קיבה-מודלים נגזרים הנגזרות וקווי התא הראשי

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

זיהוי הפעילות הרטרוטרנספוזיציה של קו חם-1s באמצעות PCR הופכי למרחקים ארוכים

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

זיהוי של התקדמות הגידול ריאה בעכברים על ידי הדמיה אולטרסאונד

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...