Name: detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr
Uploaded: 2018-02-05T15:00:00
Description: Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

लेखकों को संपादकीय सहायता के लिए Gráinne Tierney शुक्रिया अदा करना चाहता हूं ।

प्रोटोकॉल IRST ह्यूमन रिसर्च एथिक्स कमेटी के दिशानिर्देशों का पालन करता है ।
नोट: यह प्रक्रिया विशेष रूप से मानव ताजा जमे हुए ऊतकों में सीडीएनए अणुओं की एक कम संख्या का पता लगाने के लिए बनाया गय...

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

dPCR मूल रूप से डीएनए के लिए विकसित किया गया था आणविक माप10,11,12,13 और समय में इस प्रौद्योगिकी microRNAs और आरएनए के ठहराव के लिए अनुकूलित किया गया था5, <sup clas...

ई-cadherin, सेल आसंजन, अस्तित्व, प्रसार, और प्रवासन के विनियमन के माध्यम से सामांय गैस्ट्रिक उपकला के रखरखाव में शामिल एक प्रमुख कारक के लिए CDH1 जीन encodings1। बचके germline या CDH1 के दैहिक परिवर्तन का एक परिणाम के रूप में ई cadherin प्रोटीन की हानि जीसी2,3के विकास के साथ जुड़ा हुआ है । गैर विहित टेप जीन के 2 intron से उत्पंन भी गैस्ट्रिक कैंसरजनन4में एक भूमिका निभाने के लिए परिकल्पना की गई है,5। विशेष रूप से, एक ऐसी प्रतिलिपि, CDH1a, GC सेल लाइनों में व्यक्त किया जा दिखाया गया है, लेकिन सामांय पेट4से अनुपस्थित है । हमने हाल ही में gc रोगियों से जीसी ऊतक के नमूनों में चिप-आधारित dPCR5का उपयोग कर CDH1a का पता लगाया. dPCR का मूल्यांकन करने के लिए इस्तेमाल किया गया था, पहली बार के लिए, CDH1a जीन प्रतिलिपि के आंत्र GC में और सामांय ऊतक में उपस्थिति ।
सोने मानक विधि जीन अभिव्यक्ति का निर्धारण करने के लिए वास्तविक समय मात्रात्मक पीसीआर (qPCR) है । हालांकि, परिणामी डेटा कभी भी चर और खराब गुणवत्ता का हो सकता है, खासकर जब नमूना में लक्ष्य का स्तर कम है । यह परिवर्तनशीलता दूषित होने की वजह से हो सकता है, जो पोलीमरेज़ गतिविधि और प्राइमरी एनीलिंग को बाधित करते हैं, गैर-विशिष्ट प्रवर्धन और प्रतिस्पर्धी पक्ष प्रतिक्रियाओं6के लिए अग्रणी ।
हालांकि dPCR के बुनियादी जैव रासायनिक सिद्धांतों qPCR के उन लोगों के समान हैं, dPCR कुछ लाभ से पता चलता है, जीनोमिक डीएनए (gDNA)/complementary डीएनए (सीडीएनए) अणुओं की बहुत सटीक माप के लिए अनुमति देता है । दरअसल, dPCR एक अंत बिंदु प्रतिक्रिया है कि कुओं के हजारों में एक नमूने के नपे विभाजन पर निर्भर करता है, ताकि प्रत्येक अच्छी तरह से शूंय या एक एकल लक्ष्य अणु शामिल है । प्रवर्धन तो केवल लक्ष्य की एक प्रति युक्त कुओं में होता है और एक फ्लोरोसेंट संकेत द्वारा संकेत दिया है । मूल नमूने में लक्ष्य अणुओं की निरपेक्ष संख्या तो कुल द्विपद Poisson सांख्यिकी7का उपयोग कर विभाजन के लिए सकारात्मक के अनुपात का निर्धारण करके गणना की जा सकती है ।
इसके अलावा, dPCR तकनीक एक मानक वक्र चलाने के लिए की जरूरत समाप्त और, इसलिए, संबद्ध पूर्वाग्रह और परिवर्तनशीलता, लक्ष्य8,9के एक प्रत्यक्ष ठहराव के लिए अनुमति; यह अवरोधकों के लिए अपनी उच्च सहिष्णुता के कारण संदूषणों और दक्षता के स्वतंत्र रूप से और अधिक सटीक और प्रतिलिपि परिणाम पैदा करता है10; यह अधिक संवेदनशील और qPCR से विशिष्ट है, और इस प्रकार एक दुर्लभ लक्ष्य का पता लगाने के लिए एक विश्वसनीय तरीका है । अंत में, कई प्रतिक्रियाओं में नमूने के विभाजन पृष्ठभूमि अणुओं के साथ प्रतिस्पर्धा को कम कर देता है और लक्ष्य का पता लगाने की सीमा में सुधार, प्रवर्धन संभव बनाने और gDNA/सीडीएनए 6 के एकल अणुओं का पता लगाने की सुविधा . पता लगाने और चिप आधारित dPCR द्वारा न्यूक्लिक एसिड की ठहराव तेजी से संख्या में भिन्नता, डीएनए टुकड़े की ठहराव, और उत्परिवर्तन विश्लेषणों के लिए लागू किया गया है11,12,13, दिया विधि की परिशुद्धता और कम सामग्री इनपुट की आवश्यकता । इसके अलावा, dPCR हाल ही में दोनों microRNAs14 और जीन टेप5,15के विश्लेषण में एकीकृत किया गया है ।

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a, एक गैर CDH1 जीन के विहित प्रतिलिपि, कुछ गैस्ट्रिक कैंसर में व्यक्त किया जा पाया गया है (जीसी) सेल लाइनों, जबकि यह सामांय गैस्ट्रिक म्यूकोसा में अनुपस्थित है । हाल ही में, हम नए सिरे से जमे हुए ट्यूमर के साथ GC रोगियों से प्राप्त ऊतकों में CDH1a प्रतिलिपि संस्करण का पता लगाया । ऊतक नमूनों में इस वैरिएंट की अभिव्यक्ति की जांच चिप आधारित डिजिटल पीसीआर (dPCR) के दृष्टिकोण से यहां प्रस्तुत की गई. dPCR न्यूक्लिक एसिड की एक सटीक, मजबूत, और अत्यधिक संवेदनशील माप के लिए क्षमता प्रदान करता है और तेजी से विभिन्न क्षेत्रों में कई अनुप्रयोगों के लिए उपयोग किया जाता है । dPCR दुर्लभ लक्ष्यों का पता लगाने में सक्षम है; इसके अलावा, dPCR औजार और मानक curves के लिए की आवश्यकता के बिना न्यूक्लिक एसिड की निरपेक्ष और सटीक ठहराव के लिए संभावना प्रदान करता है । वास्तव में, प्रतिक्रिया विभाजन पृष्ठभूमि है, जो प्रवर्धन क्षमता और अवरोधकों को सहिष्णुता में सुधार से लक्ष्य को समृद्ध करता है । इस तरह की विशेषताओं का पता लगाने के लिए dPCR एक इष्टतम उपकरण बनाने के CDH1a दुर्लभ प्रतिलिपि ।

यहां प्रस्तुत प्रक्रिया का प्रयोग, हम गैस्ट्रिक ताजा-जमे हुए ऊतकों में दुर्लभ प्रतिलिपि संस्करण CDH1a की अभिव्यक्ति के लिए जांच की । dPCR द्वारा विश्लेषण 21 पर प्रदर्शन किया था-सामांय और कैंस?...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

चिप आधारित डिजिटल पीसीआर द्वारा ताजा जमे हुए गैस्ट्रिक कैंसर ऊतकों में एक CDH1 दुर्लभ प्रतिलिपि संस्करण का पता लगाने

पांडुलिपि का वर्णन एक चिप आधारित डिजिटल पीसीआर परख एक दुर्लभ CDH1 प्रतिलिपि प्रकार (CDH1a) ताजा जमे हुए सामांय और ट्यूमर गैस्ट्रिक कैंसर के साथ रोगियों से प्राप्त ऊतकों में पता लगाने के लिए ।

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

परिधीय रक्त Monocytes सह से Osteoclastogenesis के एक मानव नैदानिक मॉडल का विकास स्तन कैंसर सेल लाइनों के साथ-कल्चरल

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

अगली पीढ़ी अनुक्रमण का उपयोग कर CtDNA में दुर्लभ उत्परिवर्तनों का पता लगाने

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

सीरम और प्लाज्मा कॉपी नंबर का पता लगाने रीयल टाइम पीसीआर का उपयोग

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

pT3N0M0 गैस्ट्रिक कैंसर ऊतक के पैराफिन-एम्बेडेड स्लाइड पर लोचदार दाग

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

मानव फेफड़ों के ऊतकों में $W10 बातचीत प्रोटीन के इम्यूनोस्टेनिंग का डिजिटल विश्लेषण

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

फ्लोरोसेंट पेप्टाइड Zymography द्वारा चिढ़ा गतिविधि का पता लगाने

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Evaluation of Colorectal Cancer Risk and Prevalence by Stool DNA Integrity Detection

स्टूल डीएनए इंटीग्रिटी डिटेक्शन द्वारा कोलोरेक्टल कैंसर जोखिम और व्यापकता का मूल्यांकन

Nowadays, stool DNA can be isolated and analyzed by several methods. The long fragments of DNA in stool can be detected by a qPCR assay, which provides a ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

गैस्ट्रिक कैंसर रोगी व्युत्पन्न Xenograft मॉडल और प्राथमिक सेल लाइनों की स्थापना

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

लंबी दूरी के व्युत्क्रम पीसीआर द्वारा हॉट लाइन-1s के रेट्रोट्रांसपोजिशन गतिविधि का पता लगाना

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

अल्ट्रासाउंड इमेजिंग द्वारा चूहों में फेफड़ों के ट्यूमर प्रगति का पता लगाना

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...