Name: detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr
Uploaded: 2018-02-05T15:00:00
Description: Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

저자 편집 지원 Gráinne Tierney를 감사 하 고 싶습니다.

프로토콜은 IRST 인간의 연구 윤리 위원회의 지침을 따릅니다.
참고:이 절차는 신선한 냉동 인간의 조직에 cDNA 분자의 낮은 수의 탐지를 위해 특별히 설계 되었습니다. 조직 섹션 동안 여전히 동결, 이전 검증된 환자 파생 위 종양 또는 정상적인 조직 샘플에서 드라이 아이스에 잘라 왔다.
1. RNA 분리 및 정화
<ol><li>
RNA 추출 참고: 특정 제품을...

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

dPCR는 원래 위해 개발 DNA 분자 측정10,11,,1213 시간 microRNAs 및 RNA 사본5의 정량화에이 기술을 적응 했다 , 1415. 이 프로토콜에서 우리는 신선한 냉동 조직 샘플에서 파생 된 희귀 증명서의 탐지를 포함 하는 응용 프로그램의 목록을 확...

CDH1 유전자 세포 접착, 생존, 확산, 및 마이그레이션1의 규제를 통해 정상적인 위 상피의 유지에 관여 하는 핵심 요소 E cadherin 위한 인코딩합니다. 해로운 생식의 결과로 전자 cadherin 단백질의 손실 또는 CDH1 의 체세포 변경 GC2,3의 개발과 관련 된 되었습니다. Intron의 유전자 2에서 발생 하는 비 정식 성적 증명서 또한 위 발암4,5에 역할을 가설 되어 있다. 특히, 이러한 한 사본, CDH1a, GC 셀 라인에 표현 될 표시 되었습니다 하지만 결 석 정상 위4에서. 우리는 최근 칩 기반 dPCR5를 사용 하 여 GC 환자에서 GC 조직 샘플에서 CDH1a 를 감지. dPCR CDH1a 유전자 사본 장 GC에 정상 조직에의 존재를 처음으로 평가 하는 데 사용 되었다.
유전자 발현을 확인 하기 위해 표준 방법은 실시간 양이 많은 PCR (정량)입니다. 그러나, 결과 데이터 때로는 변수 수 이며 가난한 품질, 특히 때 샘플에는 대상의 수준 낮은. 이 변화는 일반적인 증폭 및 경쟁 측 반응6뇌관 어 닐 링, 및 중 합 효소 활동을 억제 하는 오염 물질에 의해 발생할 수 있습니다.
DPCR의 기본적인 생 화 확 적인 원리는 정량의 그들과 유사 하, dPCR genomic DNA (gDNA)의 매우 정확한 측정을 위해 수 있도록 하는 몇 가지 장점을 보여줍니다 / 보완 DNA (cDNA) 분자. 실제로, dPCR 각각 잘 0 또는 단일 대상 분자 포함 되도록 수천 웰 스, 샘플의 보정 분할에 의존 하는 끝점 반응입니다. 증폭 대상의 복사본을 포함 하는 우물에만 발생 합니다 그리고 형광 신호에 의해 표시 됩니다. 원래 샘플에서 대상 분자의 절대 수 다음 이항 포아송 통계7를 사용 하 여 전체 파티션을 긍정적인의 비율을 결정 하 여 계산할 수 있습니다.
DPCR 기술 표준 곡선을 실행 하기 위한 필요성을 제거 하는 또한, 및, 따라서, 연결 된 바이어스 및 다양성, 대상8,9;의 직접 정량화에 대 한 허용 그것은 오염 물질과 효율성 억제제10; 높은 관용 때문에 독립적으로 더 정확 하 고 재현 가능한 결과 생산 하 그것 더 과민 하 고 정량, 보다 구체적 이며 따라서 드문 대상의 검출에 대 한 신뢰할 수 있는 방법입니다. 마지막으로, 여러 반응으로 샘플의 분할 배경 분자와 경쟁 줄어들고 대상 검출, 증폭을 가능 하 게 하 고 gDNA/cDNA6의 단일 분자의 검출 한계 향상 . 검색 및 칩 기반 dPCR에 의해 핵 산의 정량화 점점에 적용 된 복사 번호 유사, DNA의 정량화는 파편, 그리고 돌연변이 분석11,,1213, 주어진는 정밀도 낮은 자료 입력 방법의 요구 사항. 또한, dPCR는 최근 두 microRNAs14 그리고 유전자 사본5,15의 분석에 통합 되었습니다.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

반면 결 석 CDH1a, CDH1 유전자의 정식이 아닌 대 본 일부 위 암 (GC) 셀 라인에 표현 될 발견 되었습니다 정상 위 점 막에서. 최근에, 우리는 GC 가진 환자에서 얻은 신선한 냉동 종양 조직에 CDH1a 사본 이체를 감지. 조직 샘플에서이 이체의 식 칩 기반 디지털 PCR (dPCR) 접근 방식에 의해 여기에 제시 된 조사 했다. dPCR 핵 산의 정확한, 강력한, 그리고 매우 중요 한 측정에 대 한 잠재력을 제공 하 고 점점 더 다양 한 분야에 많은 응용 프로그램에 대 한 활용. dPCR는 감지 드문 목표; 또한, dPCR는 교정기 및 표준 곡선에 대 한 필요 없이 핵 산의 완전 하 고 정확한 정량화에 대 한 가능성을 제공합니다. 사실, 증폭 효율과 억제제에 내성 향상 배경에서 대상을 풍요롭게 반응 분할. 이러한 특성 dPCR CDH1a 희소 한 대 본의 검출을 위한 최적의 도구를 확인합니다.

여기에 제시 된 절차를 사용 하 여, 우리는 위 신선한 냉동 조직에 드문 사본 이체 CDH1a 의 표현에 대 한 확인 합니다. DPCR에 의해 분석 및 11 추가 종양 샘플 21 쌍 정상 및 암 조직 샘플에서 수행 되었다. 아니 정상적인 조직 샘플 보여이 희소 한 대 본5의 존재 하는 반면 CDH1a 15 중 32 (47%) 종양에서 감지 했다. 우리의 분석으로 비 균질 로드 칩 미...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

칩 기반 디지털 PCR에 의해 신선한 냉동 위 암 조직에서 CDH1 드문 사본 이체의 탐지

원고는 칩 기반 디지털 PCR 분석 결과를 신선한 냉동 정상에 드문 CDH1 사본 이체 (CDH1a) 및 위 암 환자에서 얻은 종양 조직 검출을 설명 합니다.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

말 초 혈액 Monocytes 유 방 암 세포 라인 공동 경작에서 Osteoclastogenesis의 인간의 전 임상 모델의 개발

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

연구

암 연구학

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

다음 세대 시퀀싱을 사용 하 여 CtDNA에서 희소 한 변이의 탐지

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

혈 청 및 혈장 복사 번호 검출 실시간 PCR를 사용 하 여

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

pT3N0M0 위암 조직의 파라핀 내장 슬라이드에 탄성 염색

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

인간 폐 조직에서 ZW10 상호 작용 단백질의 면역 염색의 디지털 분석

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

형광 성 펩 티 드 Zymography에 의해 프로 테아 제 활동의 탐지

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Evaluation of Colorectal Cancer Risk and Prevalence by Stool DNA Integrity Detection

대변 DNA 무결성 검출에 의한 대장암 위험 및 유병률 평가

Nowadays, stool DNA can be isolated and analyzed by several methods. The long fragments of DNA in stool can be detected by a qPCR assay, which provides a ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

위암 환자 유래 이종이식 모델 및 1차 세포주 구축

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

장거리 역PCR에 의한 핫 LINE-1의 역변도 활성 감지

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

초음파 화상 진찰에 의하여 마우스에 있는 폐 종양 진행의 탐지

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...