Name: detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr
Uploaded: 2018-02-05T15:00:00
Description: Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Los autores desean agradecer a Gráinne Tierney por asistencia editorial.

El protocolo sigue las pautas del Comité de ética de investigación humana de primera.
Nota: Este procedimiento está diseñado específicamente para la detección de un bajo número de moléculas de cDNA en tejidos humanos, congelado. Las secciones de tejido se han reducido en hielo seco, mientras que siguen congeladas, de tumor gástrico paciente derivado previamente validado o muestras de tejido normal.
1. purificación y aislamiento de ARN
<ol><li>
E...

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

dPCR fue desarrollado originalmente para el ADN molecular medidas10,11,12,13 y en el tiempo que esta tecnología fue adaptada para la cuantificación de microRNAs y RNA transcripciones5, 14,15. En este protocolo hemos ampliado la lista de aplicaciones que incluyen la detección de las transcripciones ...

El gen CDH1 codifica para E-cadherina, un factor clave en el mantenimiento del epitelio gástrico normal a través de la regulación de la adherencia, la supervivencia, proliferación y migración de células1. Pérdida de la proteína cadherina-como resultado del germline deletéreo o alteraciones somáticas de CDH1 se han asociado con el desarrollo del GC2,3. Otras transcripciones resultantes del intrón 2 del gen también han presumido para desempeñar un papel en la carcinogénesis gástrica4,5. En particular, un tal transcripción, CDH1a, se ha demostrado para ser expresados en líneas celulares de GC pero está ausente de los de estómago normal4. Recientemente detectamos CDH1a en muestras de tejido de GC de GC pacientes utilizando dPCR basada en chip5. dPCR fue utilizado para evaluar, por primera vez, la presencia de la transcripción del gene CDH1a GC intestinal y el tejido normal.
El método estándar de oro para determinar la expresión génica es la PCR cuantitativa en tiempo real (qPCR). Sin embargo, los datos resultantes a veces pueden ser variable y de mala calidad, especialmente cuando el nivel de objetivo en la muestra es bajo. Esta variabilidad puede ser causada por contaminantes, los cuales inhiben la actividad de polimerasa y el recocido de la cartilla, conduciendo a la amplificación inespecífica y de reacciones del lado competitivo6.
Aunque los principios bioquímicos básicos de dPCR son similares a los de la qPCR, dPCR muestra algunas ventajas, lo que permite mediciones muy precisas de DNA genómico (gDNA) / complementarios las moléculas de ADN (cDNA). De hecho, dPCR es una reacción de punto final que se basa en repartir calibrado de una muestra en miles de pozos, para que cada uno también contiene cero o molécula de un solo objetivo. Amplificación se produce sólo en los pozos que contienen una copia del blanco y se indica mediante una señal fluorescente. Entonces, el número absoluto de moléculas Diana en la muestra original puede calcularse determinando la proporción de positivos a particiones total con binomial Poisson estadísticas7.
Además, la técnica de dPCR elimina la necesidad para el funcionamiento de una curva estándar y, por tanto, el sesgo asociado y variabilidad, lo que permite una cuantificación directa de objetivos8,9; produce resultados más precisos y reproducibles independientemente de contaminantes y eficiencia debido a su alta tolerancia a los inhibidores de la10; es más sensible y específica que la qPCR y por lo tanto es un método fiable para la detección de un blanco raro. Por último, el repartir de la muestra en reacciones múltiples reduce la competencia con las moléculas de fondo y mejora el límite de detección de blancos, permitiendo la amplificación y facilitar la detección de las moléculas individuales del gDNA/cDNA6 . La detección y cuantificación de ácidos nucleicos por dPCR basada en chip se ha aplicado cada vez más para copiar la variación en el número, fragmentos de cuantificación del ADN y mutación analiza11,12,13, dado el precisión y el material de baja entrada de requisito del método. Además, dPCR recientemente se ha integrado en el análisis de ambos microRNAs14 y gene transcripción5,15.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a, una no-canónico transcripción del gen CDH1 , se ha encontrado para ser expresado en algunas líneas celulares de cáncer gástrico (CG), mientras que está ausente en la mucosa gástrica normal. Recientemente, se detectó CDH1a variante de transcripción en los tejidos del tumor congelado obtenidos de pacientes con GC. La expresión de esta variante en muestras de tejido fueron investigada por el chip digital PCR (dPCR) enfoque presentado aquí. dPCR ofrece el potencial para una medición precisa, robusta y altamente sensible de los ácidos nucleicos y cada vez más se utiliza para muchas aplicaciones en diferentes campos. dPCR es capaz de detectar blancos raros; Además, dPCR ofrece la posibilidad de cuantificación absoluta y precisa de los ácidos nucleicos sin necesidad de calibradores y curvas estándar. De hecho, el repartir de reacción enriquece el objetivo del fondo, que mejora la eficiencia de amplificación y tolerancia a los inhibidores. Tales características hacen dPCR una herramienta óptima para la detección de la transcripción rara CDH1a .

Utilizando el procedimiento presentado aquí, se revisaron para la expresión de la variante rara transcripción CDH1a en tejidos gástricos congelado. El análisis de dPCR fue realizado en muestras de tejido de normal y cáncer 21-emparejados y en 11 muestras de tumor adicionales. CDH1a era perceptible en los tumores de 15 clientes de los 32 (47%), mientras que no hay muestras de tejido normal demostraron la presencia de esta rara transcripción5...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Detección de una variante rara transcripción de CDH1 en tejidos de cáncer gástrico congelado por PCR Digital basado en el Chip

El manuscrito describe un ensayo PCR digital basado en el chip para detectar una variante rara de transcripción CDH1 (CDH1a) en congelado normal y los tejidos del tumor obtenidos de pacientes con cáncer gástrico.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

Desarrollo de un modelo humano de preclínico de osteoclastogénesis de monocitos de sangre periférica cultivadas conjuntamente con líneas de células de cáncer de mama

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Investigación

Investigación sobre el cáncer

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

Detección de mutaciones raras en CtDNA usando la siguiente secuencia de generación

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

Suero y Plasma copia número detección mediante PCR en tiempo real

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

Tinción elástica en diapositivas incrustadas en parafina de tejido de cáncer gástrico pT3N0M0

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

Análisis digital de inmunomanchado de ZW10 Interacción de proteínas en tejidos pulmonares humanos

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

Detección de actividad de la proteasa por Zymography péptido fluorescente

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Evaluation of Colorectal Cancer Risk and Prevalence by Stool DNA Integrity Detection

Evaluación del riesgo y la prevalencia del cáncer colorrectal mediante la detección de la integridad del ADN de las heces

Nowadays, stool DNA can be isolated and analyzed by several methods. The long fragments of DNA in stool can be detected by a qPCR assay, which provides a ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

Establecimiento de modelos de xenoinjerto saqueos derivados del paciente y líneas celulares primarias

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Detección de la actividad de retrotransposición de Hot LINE-1 por PCR inverso de larga distancia

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

Detección de la progresión del tumor pulmonar en ratones por imágenes por ultrasonido

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...