Name: detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr
Uploaded: 2018-02-05T15:00:00
Description: Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Yazarlar Gráinne Tierney Editör Yardım için teşekkür etmek istiyorum.

Protokol IRST insan araştırma Etik Komitesi kuralları izler.
Not: Bu yordam insan taze donmuş dokularda cDNA moleküllerinin düşük bir sayı tespiti için özel olarak tasarlanmıştır. Doku bölümleri hala donmuş, hasta kaynaklı önceden doğrulanmış Gastrik tümör ya da normal doku örnekleri ise kuru buza kesmiş olduk.
1. RNA izolasyon ve arıtma
<ol><li>
RNA çıkarma Not: RNA izolasyon belirli bir ürün kullanarak başlık ...

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

dPCR Aslında DNA moleküler ölçümleri10,11,12,13 ve miktar mikroRNA ve RNA transkript5için bu teknoloji uyarlanmıştır zamanında geliştirildi, 14,15. Bu protokol için taze donmuş Doku örneklerinden elde edilen nadir transkript tespiti dahil etmek için uygulamaların listesini genişletmi?...

CDH1 gen E-cadherin, önemli bir faktör normal Gastrik epitel hücre adezyon, hayatta kalma, yayılmasını önleme ve geçiş1düzenlenmesi aracılığıyla bakım dahil için kodlar. Zararlı germline sonucunda E-cadherin protein kaybı veya somatik değişikliklere CDH1 GC2,3gelişimi ile ilişkili olduğu düşünülmektedir. Sigara-kurallı transkript intron 2 gen / doğan da mide karsinojenezis4,5' te bir rol olan. Özellikle, bir tür transkript, CDH1a, GC hücre hatlarında ifade edilecek göstermiştir ama yok normal mide4. Son zamanlarda CDH1a GC doku örneklerinde dPCR çip tabanlı5kullanarak GC hastalardan tespit ettik. dPCR değerlendirmek, ilk kez, CDH1a gen transkript bağırsak GC ve normal doku varlığı için kullanıldı.
Gen ifadesinin belirlemek için altın standart yöntem gerçek zamanlı kantitatif PCR (qPCR) dir. Ancak, sonuçta elde edilen veriler bazen değişken olabilir ve kalitesiz, özellikle ne zaman hedef örnek düzeyi düşüktür. Bu değişkenlik polimeraz etkinlik ve astar tavlama, non-spesifik amplifikasyon ve rekabetçi yan reaksiyonlar6yol inhibe kirletici neden olabilir.
DPCR Temel biyokimyasal prensipleri qPCR benzer olmakla birlikte, dPCR genomik DNA (gDNA) çok hassas ölçümler için izin bazı avantajları gösterir / Tamamlayıcı DNA (cDNA) molekülleri. Gerçekten de, dPCR böylece her de sıfır veya bir tek hedef molekül içerir, kalibre edilmiş bir örnek wells, binlerce içine bölümleme üzerinde dayanan bir son nokta reaksiyondur. Amplifikasyon sonra yalnızca bir kopyasını hedef içeren kuyu içinde oluşur ve floresan bir sinyal ile belirtilir. Orijinal örnek hedef molekülleri kesin sayısı sonra binom Poisson istatistikleri7kullanarak toplam bölümler için olumlu oranını belirleyerek hesaplanabilir.
Buna ek olarak, dPCR teknik standart bir eğri çalıştırmak için gereksinimini ortadan kaldırır ve bu nedenle, ilişkili önyargı ve değişkenliği, hedefleri8,9; doğrudan bir miktar için izin kirletici ve verimliliği inhibitörleri10onun yüksek tolerans nedeniyle bağımsız olarak daha hassas ve tekrarlanabilir sonuçlar üretir; daha hassas ve qPCR daha belirli ve böylece nadir bir hedef tespiti için güvenilir bir yöntemdir. Son olarak, arka plan molekülleri ile rekabet azaltır örnek birden çok tepkiler bölümleme ve hedef tespit, amplifikasyon mümkün verme ve gDNA/cDNA6 tek molekülleri algılama kolaylaştırmak sınırı artırır . Algılama ve miktar Nükleik asitlerin çip tabanlı dPCR tarafından giderek uygulanmış sayı varyasyon kopyalamak için miktar DNA parçaları ve mutasyon analizleri verilen11,12,13, hassas ve düşük malzeme gereksinimi yönteminin girdi. Buna ek olarak, dPCR son zamanlarda her iki mikroRNA'lar14 ve gen transkript5,15analiz entegre edilmiştir.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a, CDH1 gene, kanonik olmayan bir transkript bulundu bazı mide kanseri (GC) hücre hatlarında ifade edilecek yok ise normal mide mukozasında. Son zamanlarda, GC ile hastalardan elde edilen taze donmuş tümör dokularda CDH1a transkript varyantı tespit ettik. Bu varyant doku örneklerinde ifade burada sunulan çip tabanlı dijital PCR (dPCR) yaklaşım tarafından araştırılmıştır. dPCR Nükleik asitlerin doğru güçlü ve son derece hassas bir ölçüm için potansiyel sunmaktadır ve giderek farklı alanlardan birçok uygulama için kullanılmaktadır. dPCR nadir hedefleri tespit yeteneğine sahiptir; Buna ek olarak, dPCR Nükleik asitlerin KALİBRATÖRLER ve standart Eğriler için gerek kalmadan mutlak ve kesin miktar için imkanı sunuyor. Aslında, reaksiyon bölümleme amplifikasyon ve toleransı inhibitörleri ile artırır arka plan hedef zenginleştiriyor. Bu tür özellikleri dPCR CDH1a nadir transkript tespiti için optimum bir takım olun.

Burada sunulan yordamı kullanarak, Gastrik taze donmuş dokularda nadir transkript değişken CDH1a bir ifade için kontrol ettik. DPCR göre analiz 21 eşleştirilmiş normal ve kanser doku örnekleri ve 11 ek tümör örnekleri gerçekleştirildi. CDH1a 32 üzerinden 15 (% 47) tümör tespit iken bu nadir transkript5varlığı yok normal doku örneği gösterdi. Homojen olmayan yükleme çiplerle olduğu gibi bizim analizi, daha az 13.000 veri ...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Bir CDH1 nadir transkript değişken mide kanseri taze donmuş dokularda çip tabanlı dijital PCR tarafından algılanması

El yazması bir nadir CDH1 transkript değişken (CDH1a) taze donmuş normal ve mide kanseri olan hastalarda elde edilen tümör doku algılamak için bir çip tabanlı dijital PCR tahlil açıklar.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

Osteoclastogenesis periferik kan monosit kültürlü meme kanseri hücre hatları ile birlikte gelen bir insan preklinik modelinin geliştirilmesi

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

Sonraki nesil sıralama kullanarak CtDNA nadir mutasyonların tespiti

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

Serum ve plazma kopya sayı algılama gerçek zamanlı PCR kullanarak

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

Parafin üzerinde elastik boyama-pT3N0M0 gastrik kanser dokusu gömülü slaytlar

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

Insan akciğer dokularında ZW10 etkileşim protein Immünoster dijital Analizi

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

Floresan peptid Zymography tarafından proteaz aktivitesinin algılama

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Evaluation of Colorectal Cancer Risk and Prevalence by Stool DNA Integrity Detection

Kolorektal Kanser Riski ve Yaygınlığının Dışkı DNA Bütünlüğü Saptanması ile Değerlendirilmesi

Nowadays, stool DNA can be isolated and analyzed by several methods. The long fragments of DNA in stool can be detected by a qPCR assay, which provides a ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

Mide kanseri hasta-türetilen xenograft modelleri ve primer hücre hatları kurulması

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Uzun mesafe ters PCR tarafından sıcak hat-1s Retrotransposition aktivitesinin tespiti

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

Ultrason Görüntüleme ile Farelerde Akciğer Tümörü İlerlemesinin Saptanması

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...