Name: a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)
Uploaded: 2018-04-11T14:00:00
Duration: 7 min 58 s
Description: Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

Wij danken Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar en alle leden van de lab Valenzano aan het Max Planck Instituut voor de biologie van de vergrijzing voor zijn bijdrage aan de verschillende aspecten van het huidige poolfish veehouderij protocol door de jaren heen.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

Alle auteurs verklaren geen concurrerende financiële en niet-financiële belangen.

We beschrijven een protocol voor het laboratorium kweken van turquoise killifish, met inbegrip van de embryo's worden verzameld, incubatie, evenals volwassen vis huisvesting, fokken, en voeding. Ons protocol is specifiek gericht op de laboratoria die onderzoek gericht op de volwassen vis, in het bijzonder voor experimentele onderzoek naar veroudering en levensduur. Turquoise poolfish kan worden verhoogd op een standaard zebrafish faciliteit; belangrijke aspecten van poolfish veehouderij is echter afwijken van standaard zebrafish zorg16. Deze aanpassingen zijn vroege overgang van een Artemia enige voeding naar een dieet aangevuld met eiwitrijke bloed worm, evenals de specifieke stappen voor het embryo incubatie, bestaande uit een vloeibare en droge incubatie-fase.
Kritische stappen binnen het protocol bevatten scheepvaart embryo's binnen 8-30 ° C temperatuurbereik. In het geval van fok, vruchtbaarheid is afhankelijk van voeding van de frequentie en de kwaliteit van de levensmiddelen; Daarom raden we ten minste twee voedingen per dag per fokken tank te verhogen van de opbrengst van de embryo's (zie punt 5.6.). Tijdens het embryo bleken, embryo incubatie in de bleken oplossing niet te verlengen. Dit kan schade aan de ei chorion en verhoogde embryo sterfte veroorzaken. Wanneer het broeden van embryo's met methyleenblauw, niet verlengen incubatie van klaar-aan-hatch embryo's voor meer dan 2 weken als hun levensvatbaarheid drastisch zal worden verminderd. Broedeieren turquoise killifish, lage temperatuur van humic zuuroplossing verbetert broedeieren en volledige onderdompeling van de embryo's in de oplossing kunt gesynchroniseerde broedeieren. Onvoldoende beluchting tijdens de incubatie resultaten in hoge tarieven van FRJ niet kundig voor vullen van de blaas gas ("buik-slider" fenotype, zie opmerkingen in punt 5.1).
Beperking van het protocol voor de fokkerij omvat ook het gebruik van het zand substraat welke uitdagingen vormt voor gecentraliseerde filtratiesystemen en moeten worden vervangen door alternatieve methoden in de toekomst. Mogelijke alternatieven zou het gebruik van zebravis fokken van tanks. Embryo bleken kan grote fysisch-chemische veranderingen veroorzaken in het ei chorion die kan resulteren in gewijzigde chorion fysiologie en broedeieren van succes. Constante Gasbedwelming met behulp van embryo's methyleenblauw veroorzaken op lange termijn veranderingen in de Fysiologie van de volwassen vis. Verhogen van volwassen vis in individuele tanks voor overleving cohortstudies kan negatief beïnvloeden vis gedrag en gezondheid. Groepshuisvesting voor overleving cohortstudies voegt echter belangrijke storende factoren als gevolg van de invoering van sociale dominantie en mannelijke gebieden, wat leidt tot strikte sociale hiërarchieën. Daarom beoordelen we dat isolement van mannelijke vis voor overleving studies een redelijk compromis is. Voeding laboratorium poolfish kolonies met levend voer uit niet-gecontroleerde bronnen toevoegen een risico voor externe verontreinigingen van parasieten en potentieel pathogene microbiële gemeenschappen. In de toekomst moet een ad hoc-steriele visvoer worden ontwikkeld.
Toekomstige verbeteringen aan dit protocol zal zich richten op een gecontroleerde, niet-live dieet, dat nog steeds leidt tot voltooiing van de seksuele rijping binnen 3-4 weken. Kortom biedt ons protocol toegankelijkheid van turquoise poolfish laboratorium kweken voor een brede wetenschappelijke gemeenschap.

Gezien hun korte levensduur en snelle levenscyclus, groeien turquoise poolfish snel als een veelbelovende nieuwe model-organisme in biologie1,2,3. Deze soort wordt gekenmerkt door een unieke life cycle voor een teleost, bestaande uit embryonale diapauze, snelle seksuele rijping en een langere levensduur van de post-reproductive fase4,5. Recent werk heeft bijgedragen aan het ophelderen van de biologie van deze soorten in gevangenschap zowel in het wild6,-7. Turquoise poolfish leven in seizoensgebonden verse waterlichamen die vorm tijdens het regenseizoen in de Afrikaanse savanne in Zimbabwe en Mozambique. Tijdens het droge seizoen overleven embryo's in de droge modder in de afwezigheid van water op grond van een stress-bestendig leven stadium genoemd diapauze.
Genetische kaarten voor deze soort geweest gegenereerde8,9, en onlangs hun genoom geweest gesequenceerd en gemonteerd10,11. Verschillende ingeteelde laboratorium vis stammen zijn ontwikkeld, en Transgenese en genoom bewerken via CRISPR/Cas9 zijn beschikbaar in deze soort, feitelijke bevordering van turquoise poolfish als een concurrerende laboratorium gewervelde modelorganisme geworden 12,13,14.
Hoewel een laboratorium protocol reeds gepubliceerd voor deze soorten15, in het huidige protocol ontwikkelen we een uitgebreide lijst van experimenteel laboratorium richtlijnen die specifiek gericht zijn op studies die veroudering en overleving onderzoeken. Dit protocol kan onderzoekers al vertrouwd met de zebravis en medaka veeteelt worden berijmd in turquoise poolfish veehouderij door vaststelling van een minimum aantal belangrijke aanpassingen. Op hetzelfde moment biedt dit protocol onderzoekers zonder voorafgaande ervaring in vis veehouderij met de essentiële instrumenten te verhogen van een bloeiende turquoise poolfish kolonie.

<table>
	<tbody>
		<tr>
			<td>Probe calibration buffer solution pH=7.0</td>
			<td>Roth</td>
			<td>A518.1</td>
			<td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Probe calibration buffer solution pH=4.0</td>
			<td>Roth</td>
			<td>P712.1</td>
			<td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Conductivity standard</td>
			<td>VWR</td>
			<td>83607.260</td>
			<td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td>
		</tr>
		<tr>
			<td>Easy Strips Test 6in1</td>
			<td>JBL</td>
			<td>2533900</td>
			<td>Test strips for determination chlorine values of system water</td>
		</tr>
		<tr>
			<td>Ammonia Test</td>
			<td>JBL</td>
			<td>2536500</td>
			<td>Test to determine ammonia content of system water</td>
		</tr>
		<tr>
			<td>Red Sea Salt</td>
			<td>Red Sea</td>
			<td></td>
			<td>22 kg bucket</td>
		</tr>
		<tr>
			<td>Sodium hydrogen carbonate</td>
			<td>VWR</td>
			<td>27780.360</td>
			<td></td>
		</tr>
		<tr>
			<td>Humic acid</td>
			<td>Sigma- Aldrich</td>
			<td>53680-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>New HUFA Artemia enrichment</td>
			<td>ZM Systems UK</td>
			<td></td>
			<td>75g bottle</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Roth</td>
			<td>AE64.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrogen peroxide solution</td>
			<td>Sigma- Aldrich</td>
			<td>31642-1L</td>
			<td>30% (w/w)</td>
		</tr>
		<tr>
			<td>Cononut fiber</td>
			<td>Dragon</td>
			<td>ZCS010</td>
			<td></td>
		</tr>
		<tr>
			<td>Whatman paper</td>
			<td>GE healthcare</td>
			<td>3030-690</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol pure</td>
			<td>VWR</td>
			<td>20821.467</td>
			<td>100%</td>
		</tr>
		<tr>
			<td>Silica sand</td>
			<td>local pet shop</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Artemia Eggs Premium Grade</td>
			<td>Sanders</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bloodworm</td>
			<td>local distributor</td>
			<td></td>
			<td>Poseidon Aquakultur Germany</td>
		</tr>
		<tr>
			<td>dNTPs solution mix</td>
			<td>Biolabs</td>
			<td>N04472</td>
			<td>10mM</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>5U/uL</td>
		</tr>
		<tr>
			<td>PCR 10x Buffer</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>NaOH</td>
			<td>Sigma- Aldrich</td>
			<td>S8045-500g</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>Tris-HCl, pH=8.0 solution</td>
			<td>Sigma- Aldrich</td>
			<td>T2694-1L</td>
			<td>1M</td>
		</tr>
		<tr>
			<td>HCl 37%</td>
			<td>Sigma- Aldrich</td>
			<td>H1758-500mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Aquatic housing system</td>
			<td>Aquaneering</td>
			<td></td>
			<td>Central filtration equipped aquatic system</td>
		</tr>
		<tr>
			<td>Fish tanks</td>
			<td>Aquaneering</td>
			<td></td>
			<td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td>
		</tr>
		<tr>
			<td>Orbital shaker</td>
			<td>VWR</td>
			<td>89032-100</td>
			<td>model 5000</td>
		</tr>
		<tr>
			<td>Microbiological incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>50125882</td>
			<td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Cooling Incubator</td>
			<td>Binder</td>
			<td>9020-0209</td>
			<td>model KT115; for storage embryos in the solid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Hatching incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>51028114</td>
			<td>model OGS180; for embryos hatching, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Stereomicroscope</td>
			<td>Leica</td>
			<td></td>
			<td>model M80</td>
		</tr>
		<tr>
			<td>Breeding sand/hatching boxes</td>
			<td>Roth</td>
			<td>1598.1</td>
			<td>1000mL</td>
		</tr>
		<tr>
			<td>Petri dish</td>
			<td>Sarstedt</td>
			<td>82.1473</td>
			<td>92x16mm</td>
		</tr>
		<tr>
			<td>50mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.547.254</td>
			<td></td>
		</tr>
		<tr>
			<td>15mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.554.002</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Plastic Pasteur pipette</td>
			<td>Roth</td>
			<td>EA71.1</td>
			<td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td>
		</tr>
		<tr>
			<td>Serological pipette</td>
			<td>Sarstedt</td>
			<td>86.1689.001</td>
			<td>50mL</td>
		</tr>
		<tr>
			<td>Syringe</td>
			<td>Henke Sass Wolf</td>
			<td>4100-000V0</td>
			<td>10mL</td>
		</tr>
		<tr>
			<td>Metal strainer</td>
			<td></td>
			<td></td>
			<td>fineness &#60;1mm; for embryos collection</td>
		</tr>
		<tr>
			<td>Tweezers</td>
			<td>Dumont</td>
			<td>0508-5/45-PO</td>
			<td>type5/45; for embryos transfer</td>
		</tr>
		<tr>
			<td>25L Brine shrimps hatcher</td>
			<td>Aquaneering</td>
			<td>ZHBS25</td>
			<td>main hatcher</td>
		</tr>
		<tr>
			<td>500mL Brine shrimps hatcher</td>
			<td>JBL</td>
			<td>6106100</td>
			<td>model Artemio 1; backuo hatcher</td>
		</tr>
		<tr>
			<td>Narrow-mesh fish nets</td>
			<td>JBL</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sand beaker</td>
			<td>VWR</td>
			<td>BURK7102-5000</td>
			<td>5000mL</td>
		</tr>
		<tr>
			<td>Brine shrimps separation beaker</td>
			<td>VWR</td>
			<td>BURK7102-2000</td>
			<td>2000mL</td>
		</tr>
		<tr>
			<td>Plastic zipper bag</td>
			<td>Roth</td>
			<td>P279.2</td>
			<td>for dead fish storage</td>
		</tr>
		<tr>
			<td>Pipetboy</td>
			<td>Integra</td>
			<td>155000</td>
			<td>model Pipetboy acu2</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>P-Lab</td>
			<td>P701605</td>
			<td></td>
		</tr>
		<tr>
			<td>Air tubing</td>
			<td>www.zajac.de</td>
			<td>AQ380</td>
			<td>4-6 mm diameter</td>
		</tr>
		<tr>
			<td>1L Glass bottle</td>
			<td>VWR</td>
			<td>215-1595</td>
			<td></td>
		</tr>
		<tr>
			<td>2L Glass bottle</td>
			<td>VWR</td>
			<td>215-1596</td>
			<td></td>
		</tr>
		<tr>
			<td>500mL Squeeze bottle</td>
			<td>Roth</td>
			<td>K665.1</td>
			<td>for fish feeding with brine shrimps</td>
		</tr>
		<tr>
			<td>120 micron brine shrimps strainer</td>
			<td>Florida Aqua Farms</td>
			<td>BB-PC2</td>
			<td>for brine shrimps/bloodworm collection</td>
		</tr>
		<tr>
			<td>Finish filter socks</td>
			<td>Aquaneering</td>
			<td>MFVB025C</td>
			<td>25 micron</td>
		</tr>
		<tr>
			<td>Central filtration fish housing system</td>
			<td></td>
			<td></td>
			<td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td>
		</tr>
	</tbody>
</table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

De ontwikkeling van veehouderijpraktijken in niet-model laboratorium vis voor experimentele doeleinden gebruikte heeft sterk geprofiteerd van de oprichting van referentie vis modelsystemen, zoals zebravis en medaka. In de afgelopen jaren is een opkomende vis – de turquoise poolfish (Nothobranchius furzeri)-goedgekeurd door een groeiend aantal onderzoeksgroepen op het gebied van biologie van veroudering en ecologie. Met een captive levensduur van 4-8 maanden, deze soort is de massiever gewervelde opgegroeid in gevangenschap en maakt van de wetenschappelijke gemeenschap test – in een korte tijd – experimentele interventies die tot wijzigingen van het groeitempo van de veroudering en levensverwachting leiden kunnen. Gezien de unieke biologie van deze soort, gekenmerkt door embryonale diapauze, explosieve seksuele rijping, gemarkeerd morfologische en gedragsmatige seksueel dimorfisme- en hun volwassen relatief korte levensduur - ad hoc veehouderij praktijken in dringende zijn vraag. Dit protocol rapporteert een reeks belangrijke veehouderij maatregelen waarmee optimale turquoise poolfish laboratorium zorg, waardoor de wetenschappelijke gemeenschap te nemen van deze soort als een dierlijk model van krachtige laboratorium.

Turquoise poolfish goede veehouderij resulteert in mediane overleving variërend tussen 12-18 weken in de GRZ stam (bijvoorbeeld figuur 4A). Variaties van de mediane overleving is afhankelijk van dieet, voeding van de frequentie, en woonomstandigheden van de temperatuur. Arme veehouderij resultaten in overleving curven presenteren gestegen vervroegde sterfte en repetitieve, plotselinge druppels overleving doorheen de tijd, gekenmerkt door meerdere buigpunten (figuur 4B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> Figuur 1: vertegenwoordiger embryonale ontwikkelingsstadia met respectieve incubatie-substraat. (A) vers verzamelde embryo's, geïncubeerd in methyleenblauwoplossing in de incubator bij 28 ° C. (B) embryo's klaar om te worden overgebracht naar solide medium, filteren of papier of kokos vezel. (C) embryo's klaar om te worden uitgebroed, typische gouden irissen weergeven. De schaal bar bedraagt tot 1 mm. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">Klik hier voor een grotere versie van dit cijfer.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> Figuur 2: stadia van turquoise poolfish post broedeieren ontwikkeling. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">Klik hier voor een grotere versie van dit cijfer.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> Figuur 3: vertegenwoordiger vis ID tag voor vis uit vanaf fase 3. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">Klik hier voor een grotere versie van dit cijfer.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> Figuur 4: vertegenwoordiger overleving curve voor 70 mannelijke turquoise poolfish. (A) typische overleving curve voor turquoise poolfish laboratorium-aan de orde gesteld. (B) vergelijking voor overleving curves verkregen vis verhoogd onder omstandigheden van de optimale veehouderij (zwart) en slechte veehouderij (rood en blauw). De rode horizontale stippellijn geeft 50% overleving, snijdende overleving curve op gemiddelde levensduur (aangegeven op de x-as). <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">Klik hier voor een grotere versie van dit cijfer.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>ID</td>
			<td colspan="2">Voorwaartse primer</td>
			<td colspan="2">Omgekeerde primer</td>
			<td>Groottewaaier (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
<tr>
<td colspan="6">* - sex bepaling markeringen</td>
		</tr>
</tbody></table>Tabel 1: Genotypering inleidingen voor identificatie van de stam.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Laboratorium behuizing van turkoois poolfish kan worden opgeschaald naar huis en duizenden afzonderlijke vissen efficiënt te verhogen in een gecentraliseerde water filtratie-systeem, met dezelfde infrastructuur gebruikt voor standaard zebrafish faciliteiten. Hier detail we een aantal gestandaardiseerde procedures waarmee efficiënte poolfish onderhoud.

Een Protocol voor het laboratorium huisvesting van Turquoise Killifish (Nothobranchius furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

Protocol for Mosquito Rearing (A. gambiae)

Protocol for Mosquito Rearing A. gambiae

Protocol voor Mosquito Opfok (A. gambiae)

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night ...

Neutrophil Isolation Protocol

Neutrofielen Isolatie Protocol

Neutrophil polymorphonuclear granulocytes (PMN) are the most abundant leukocytes in humans and among the first cells to arrive on the site of inflammatory ...

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia (SCG)

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia SCG

Protocol voor het kweken van sympathische neuronen van Rat Superior Baarmoederhalskanker ganglia (SCG)

The superior cervical ganglia (SCG) in rats are small, glossy, almond-shaped structures that contain sympathetic neurons.  These neurons provide ...

A Protocol for the Production of KLRG1 Tetramer

Een protocol voor de productie van KLRG1 tetrameer

Killer cell lectin-like receptor G1 (KLRG1) is a type II transmembrane glycoprotein inhibitory receptor belonging to the C type lectin-like superfamily. ...

A Protocol for Computer-Based Protein Structure and Function Prediction

Een protocol voor Computer-Based Protein Structure en functie Voorspelling

Genome sequencing projects have ciphered millions of protein sequence, which require knowledge of their structure and function to improve the ...

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

Regelmatige verzorging en onderhoud van een zebravis (<em&gt; Danio rerio</em&gt;) Laboratorium: Een inleiding

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

A Protocol for Phage Display and Affinity Selection Using Recombinant Protein Baits

Een protocol voor faag display en Affiniteit selectie met recombinant eiwit Baits

Using  recombinant phage as a scaffold to present various protein portions encoded by  a directionally cloned cDNA library to immobilized bait molecules ...

SIVQ-LCM Protocol for the ArcturusXT Instrument

SIVQ-LCM protocol voor de ArcturusXT Instrument

SIVQ-LCM is a new methodology that automates and streamlines the more traditional, user-dependent laser dissection process.&#160;It aims to create an ...

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers

Laboratorium Protocol voor genetische Analyses van de inhoud van de Gut van aquatische Macroinvertebrates gebruiken groepsspecifieke rDNA Primers

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the ...