Name: a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)
Uploaded: 2018-04-11T14:00:00
Duration: 7 min 58 s
Description: Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

Nous remercions Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar et tous les membres du laboratoire Valenzano à l’Institut Max Planck pour la biologie du vieillissement pour contribuer aux différents aspects le protocole actuel de l’élevage barrés au fil des ans.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

Tous les auteurs déclarent sans intérêts financiers et non financiers concurrents.

Les auteurs décrivent un protocole d’élevage de laboratoire de killifish turquoise, y compris la collecte des embryons, incubation, ainsi que logement poissons adultes, d’élevage et d’alimentation. Notre protocole est expressément conçu pour les laboratoires qui effectuent la recherche axée sur les poissons adultes, en particulier dans les études expérimentales sur le vieillissement et la durée de vie. Fondule barré turquoise peut être déclenché sur une installation standard de poisson-zèbre ; Cependant, des aspects importants de ressources pétrolières barrés diffèrent du poisson-zèbre standard soins16. Ces rajustements comprennent la transition précoce d’un seul régime d’artémia à un régime additionné de ver de sang riche en protéines, mais aussi des mesures concrètes d’incubation de l’embryon, consistant en une étape d’incubation liquides et solides.
Étapes critiques au sein du protocole comprennent des embryons expédition 8-30 ° C plage de températures. En cas de reproduction, fécondité dépend de l’alimentation fréquence et qualité des aliments ; par conséquent, nous recommandons au moins deux tétées par jour et par reproduction de réservoir pour augmenter le rendement des embryons (voir la section 5.6.). Au cours de l’embryon de blanchiment, ne s’étendent pas d’incubation embryon dans la solution de blanchiment. Cela peut endommager le chorion de l’oeuf et la mortalité des embryons accrue. Lors de l’incubation des embryons avec le bleu de méthylène, ne pas prolonger l’incubation des embryons de prêt-à-trappe pendant plus de 2 semaines que leur viabilité sera considérablement réduite. À couver turquoise barrés, basse température de la solution acide humique améliore l’éclosion et immersion complète des embryons dans la solution permet de synchronisé à couver. Aération insuffisante durant les résultats de l’incubation des taux élevés d’alevins pas en mesure de remplir la vessie natatoire (phénotype « ventre-slider », voir les notes relatives à la section 5.1).
Limitation du protocole pour la reproduction comprend l’utilisation du substrat sable quels défis de poses à filtration systèmes centralisés et devraient être remplacés par des méthodes alternatives à l’avenir. Des solutions de rechange possibles pourraient être l’utilisation du poisson-zèbre, réservoirs de reproduction. Embryon de blanchiment pourrait provoquer des changements physiques et chimiques majeurs dans le chorion de l’oeuf qui pourrait résulter en physiologie chorion altérée et le succès de l’éclosion. L’exposition constante des embryons au bleu de méthylène peut induire des changements à long terme dans la physiologie des poissons adultes. Élevage de poissons adultes dans les réservoirs individuels pour les études de cohortes de survie peut affecter négativement la comportement du poisson et la santé. Logement de groupe pour les études de cohortes de survie ajoute cependant, des facteurs de confusion importantes due à l’établissement de la domination sociale et territoires mâles, conduisant à des hiérarchies sociales strictes. Par conséquent, nous jugeons que l’isolement des poissons mâles pour des études de survie constitue un compromis raisonnable. Alimentation laboratoire barrés colonies avec des aliments vivants provenant de sources non contrôlées ajoute un risque de contamination externe des parasites et des communautés microbiennes potentiellement pathogènes. À l’avenir, une alimentation de type poisson stérile ad hoc devrait être développée.
Les améliorations futures à ce protocole mettra l’accent sur une alimentation contrôlée, non vivants, qui mène toujours à achever la maturation sexuelle dans 3-4 semaines. En résumé, notre protocole offre l’accessibilité aux barrés turquoise laboratoire mise en culture d’une communauté scientifique.

Compte tenu de leur courte durée de vie et le cycle de vie rapide, barrés turquoises croissent rapidement comme un prometteur nouvel organisme modèle en biologie1,2,3. Cette espèce se caractérise par un cycle de vie unique pour un téléostéen, consistant en diapause embryonnaire, la maturation sexuelle rapide et une longue durée de vie post-reproductive Etape4,5. Des travaux récents ont contribué à élucider la biologie de cette espèce en captivité et en les sauvages6,7. Turquoises barrés vivent dans des plans d’eau douce saisonniers qui se forment pendant la saison des pluies dans la savane africaine au Zimbabwe et au Mozambique. Pendant la saison sèche, les embryons survivent dans la boue sèche en l’absence d’eau en vertu d’un stade de résistance au stress de la vie appelé la diapause.
Les cartes génétiques de cette espèce ont été généré8,9, et récemment leur génome a été séquencé et monté de10,11. Plusieurs souches de poissons de laboratoire consanguines ont été développés, et la transgénèse et génome édition via CRISPR/Cas9 sont apparues chez cette espèce, qui fait promotion turquoise fondule barré comme un organisme modèle vertébrés de laboratoire concurrentiel 12,13,14.
Même si un protocole de laboratoire a déjà été publié pour cette espèce15, dans le présent protocole, nous développons une liste exhaustive des directives du laboratoire expérimental qui visent spécifiquement les études qui examinent le vieillissement et la survie. Le présent protocole permet aux chercheurs déjà familiers avec l’élevage de poisson-zèbre et chez les sujets exposés à devenir versé dans l’élevage turquoise barrés en adoptant un certain nombre d’ajustements clés. Dans le même temps, ce protocole prévoit des chercheurs sans expérience préalable dans l’élevage de poissons avec les outils essentiels pour élever une colonie prospère de turquoise barrés.

<table>
	<tbody>
		<tr>
			<td>Probe calibration buffer solution pH=7.0</td>
			<td>Roth</td>
			<td>A518.1</td>
			<td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Probe calibration buffer solution pH=4.0</td>
			<td>Roth</td>
			<td>P712.1</td>
			<td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Conductivity standard</td>
			<td>VWR</td>
			<td>83607.260</td>
			<td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td>
		</tr>
		<tr>
			<td>Easy Strips Test 6in1</td>
			<td>JBL</td>
			<td>2533900</td>
			<td>Test strips for determination chlorine values of system water</td>
		</tr>
		<tr>
			<td>Ammonia Test</td>
			<td>JBL</td>
			<td>2536500</td>
			<td>Test to determine ammonia content of system water</td>
		</tr>
		<tr>
			<td>Red Sea Salt</td>
			<td>Red Sea</td>
			<td></td>
			<td>22 kg bucket</td>
		</tr>
		<tr>
			<td>Sodium hydrogen carbonate</td>
			<td>VWR</td>
			<td>27780.360</td>
			<td></td>
		</tr>
		<tr>
			<td>Humic acid</td>
			<td>Sigma- Aldrich</td>
			<td>53680-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>New HUFA Artemia enrichment</td>
			<td>ZM Systems UK</td>
			<td></td>
			<td>75g bottle</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Roth</td>
			<td>AE64.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrogen peroxide solution</td>
			<td>Sigma- Aldrich</td>
			<td>31642-1L</td>
			<td>30% (w/w)</td>
		</tr>
		<tr>
			<td>Cononut fiber</td>
			<td>Dragon</td>
			<td>ZCS010</td>
			<td></td>
		</tr>
		<tr>
			<td>Whatman paper</td>
			<td>GE healthcare</td>
			<td>3030-690</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol pure</td>
			<td>VWR</td>
			<td>20821.467</td>
			<td>100%</td>
		</tr>
		<tr>
			<td>Silica sand</td>
			<td>local pet shop</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Artemia Eggs Premium Grade</td>
			<td>Sanders</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bloodworm</td>
			<td>local distributor</td>
			<td></td>
			<td>Poseidon Aquakultur Germany</td>
		</tr>
		<tr>
			<td>dNTPs solution mix</td>
			<td>Biolabs</td>
			<td>N04472</td>
			<td>10mM</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>5U/uL</td>
		</tr>
		<tr>
			<td>PCR 10x Buffer</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>NaOH</td>
			<td>Sigma- Aldrich</td>
			<td>S8045-500g</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>Tris-HCl, pH=8.0 solution</td>
			<td>Sigma- Aldrich</td>
			<td>T2694-1L</td>
			<td>1M</td>
		</tr>
		<tr>
			<td>HCl 37%</td>
			<td>Sigma- Aldrich</td>
			<td>H1758-500mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Aquatic housing system</td>
			<td>Aquaneering</td>
			<td></td>
			<td>Central filtration equipped aquatic system</td>
		</tr>
		<tr>
			<td>Fish tanks</td>
			<td>Aquaneering</td>
			<td></td>
			<td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td>
		</tr>
		<tr>
			<td>Orbital shaker</td>
			<td>VWR</td>
			<td>89032-100</td>
			<td>model 5000</td>
		</tr>
		<tr>
			<td>Microbiological incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>50125882</td>
			<td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Cooling Incubator</td>
			<td>Binder</td>
			<td>9020-0209</td>
			<td>model KT115; for storage embryos in the solid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Hatching incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>51028114</td>
			<td>model OGS180; for embryos hatching, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Stereomicroscope</td>
			<td>Leica</td>
			<td></td>
			<td>model M80</td>
		</tr>
		<tr>
			<td>Breeding sand/hatching boxes</td>
			<td>Roth</td>
			<td>1598.1</td>
			<td>1000mL</td>
		</tr>
		<tr>
			<td>Petri dish</td>
			<td>Sarstedt</td>
			<td>82.1473</td>
			<td>92x16mm</td>
		</tr>
		<tr>
			<td>50mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.547.254</td>
			<td></td>
		</tr>
		<tr>
			<td>15mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.554.002</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Plastic Pasteur pipette</td>
			<td>Roth</td>
			<td>EA71.1</td>
			<td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td>
		</tr>
		<tr>
			<td>Serological pipette</td>
			<td>Sarstedt</td>
			<td>86.1689.001</td>
			<td>50mL</td>
		</tr>
		<tr>
			<td>Syringe</td>
			<td>Henke Sass Wolf</td>
			<td>4100-000V0</td>
			<td>10mL</td>
		</tr>
		<tr>
			<td>Metal strainer</td>
			<td></td>
			<td></td>
			<td>fineness &#60;1mm; for embryos collection</td>
		</tr>
		<tr>
			<td>Tweezers</td>
			<td>Dumont</td>
			<td>0508-5/45-PO</td>
			<td>type5/45; for embryos transfer</td>
		</tr>
		<tr>
			<td>25L Brine shrimps hatcher</td>
			<td>Aquaneering</td>
			<td>ZHBS25</td>
			<td>main hatcher</td>
		</tr>
		<tr>
			<td>500mL Brine shrimps hatcher</td>
			<td>JBL</td>
			<td>6106100</td>
			<td>model Artemio 1; backuo hatcher</td>
		</tr>
		<tr>
			<td>Narrow-mesh fish nets</td>
			<td>JBL</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sand beaker</td>
			<td>VWR</td>
			<td>BURK7102-5000</td>
			<td>5000mL</td>
		</tr>
		<tr>
			<td>Brine shrimps separation beaker</td>
			<td>VWR</td>
			<td>BURK7102-2000</td>
			<td>2000mL</td>
		</tr>
		<tr>
			<td>Plastic zipper bag</td>
			<td>Roth</td>
			<td>P279.2</td>
			<td>for dead fish storage</td>
		</tr>
		<tr>
			<td>Pipetboy</td>
			<td>Integra</td>
			<td>155000</td>
			<td>model Pipetboy acu2</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>P-Lab</td>
			<td>P701605</td>
			<td></td>
		</tr>
		<tr>
			<td>Air tubing</td>
			<td>www.zajac.de</td>
			<td>AQ380</td>
			<td>4-6 mm diameter</td>
		</tr>
		<tr>
			<td>1L Glass bottle</td>
			<td>VWR</td>
			<td>215-1595</td>
			<td></td>
		</tr>
		<tr>
			<td>2L Glass bottle</td>
			<td>VWR</td>
			<td>215-1596</td>
			<td></td>
		</tr>
		<tr>
			<td>500mL Squeeze bottle</td>
			<td>Roth</td>
			<td>K665.1</td>
			<td>for fish feeding with brine shrimps</td>
		</tr>
		<tr>
			<td>120 micron brine shrimps strainer</td>
			<td>Florida Aqua Farms</td>
			<td>BB-PC2</td>
			<td>for brine shrimps/bloodworm collection</td>
		</tr>
		<tr>
			<td>Finish filter socks</td>
			<td>Aquaneering</td>
			<td>MFVB025C</td>
			<td>25 micron</td>
		</tr>
		<tr>
			<td>Central filtration fish housing system</td>
			<td></td>
			<td></td>
			<td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td>
		</tr>
	</tbody>
</table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

Le développement de pratiques d’élevage en laboratoire non-modèle poissons utilisés à des fins expérimentales a grandement bénéficié de la mise en place des poissons de référence systèmes modèles, comme le poisson-zèbre et chez les sujets exposés. Ces dernières années, un poisson émergent – le cyprinodonte turquoise (Nothobranchius furzeri) – a été adopté par un nombre croissant de groupes de recherche dans les domaines de la biologie du vieillissement et de l’écologie. Avec une durée de vie en captivité de 4 à 8 mois, cette espèce est le vertébré microcebu élevé en captivité et permet à la communauté scientifique d’essai – en peu de temps – interventions expérimentales qui peuvent entraîner des modifications du rythme de vieillissement et l’espérance de vie. Compte tenu de la biologie particulière de cette espèce, caractérisée par la diapause embryonnaire, la maturation sexuelle explosive, marquée morphologique et comportemental dimorphisme sexuel - et leur durée de vie adulte relativement courte - spécial élevage pratiques soient urgents demande. Ce protocole indique un ensemble de mesures clés de l’élevage qui permettent aux barrés turquoise optimale soins de laboratoire, permettant à la communauté scientifique à adopter cette espèce comme un modèle animal de laboratoire puissant.

Bon élevage des barrés turquoise se traduit par survie médiane allant de 12 à 18 semaines chez la souche GRZ (par exemple la Figure 4 a). Variations de la durée médiane de survie dépendent diet, fréquence des repas et logement à des conditions de température. Résultats élevage pauvres en présentant des courbes de survie ont augmenté la mortalité précoce et répétitifs, brusques gouttes de survie pendant toute période, caractérisée par plusieurs points d’inflexion (Figure 4 b).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> Figure 1 : des stades de développement embryonnaires représentatifs avec substrat respectifs d’incubation. (A) fraîchement recueillies des embryons, incubés dans une solution de bleu de méthylène dans l’incubateur à 28 ° C. (B) les embryons prêts à être transférés sur milieu solide, filtre soit fibre de papier ou de la noix de coco. (C) embryons prêts à hachurer, affichage typiques Iris dorés. La barre d’échelle est égale à 1 mm. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> Figure 2 : étapes de turquoise barrés développement après l’éclosion. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> Figure 3 : étiquette d’identification de poisson représentatif pour le poisson dès phase 3. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> Figure 4 : courbe de survie représentatif pour 70 cyprinodonte turquoise mâle. (A) courbe de survie typique pour cyprinodonte turquoise élevés en laboratoire. (B) une comparaison des courbes de survie provenant de poissons élevés dans des conditions optimales d’élevage (noir) et de l’élevage pauvre (rouge et bleu). La ligne horizontale rouge pointillée indique 50 % de survie, courbe de survie qui se croisent à la longévité médiane (indiquée sur l’axe des abscisses). <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>ID</td>
			<td colspan="2">Primer avant</td>
			<td colspan="2">Inverser l’apprêt</td>
			<td>Classe de grandeur (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
<tr>
<td colspan="6">* - des marqueurs de détermination du sexe</td>
		</tr>
</tbody></table>Tableau 1 : Les amorces de génotypage pour l’identification de la souche.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Logement de laboratoire de turquoise barrés peuvent être transposés à la maison et de sensibiliser efficacement des milliers de poissons dans un système de filtration d’eau centralisée, utilisant la même infrastructure utilisée pour les installations standard de poisson-zèbre. Ici, nous détaillons une liste de procédures normalisées qui permettent aux barrés efficace entretien.

Un protocole pour laboratoire logement de Turquoise cyprinodonte (Nothobranchius furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

Protocol for Mosquito Rearing (A. gambiae)

Protocol for Mosquito Rearing A. gambiae

Protocole pour l&#39;élevage des moustiques (A. gambiae)

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night ...

Recherche

Biologie

Neutrophil Isolation Protocol

Isolement des neutrophiles Protocole

Neutrophil polymorphonuclear granulocytes (PMN) are the most abundant leukocytes in humans and among the first cells to arrive on the site of inflammatory ...

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia (SCG)

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia SCG

Protocole pour les neurones sympathiques de rat Culture ganglions cervicaux supérieur (SCG)

The superior cervical ganglia (SCG) in rats are small, glossy, almond-shaped structures that contain sympathetic neurons.  These neurons provide ...

A Protocol for the Production of KLRG1 Tetramer

Un protocole pour la production de KLRG1 tétramère

Killer cell lectin-like receptor G1 (KLRG1) is a type II transmembrane glycoprotein inhibitory receptor belonging to the C type lectin-like superfamily. ...

A Protocol for Computer-Based Protein Structure and Function Prediction

Un protocole pour la structure des protéines Computer-Based et prédiction de la fonction

Genome sequencing projects have ciphered millions of protein sequence, which require knowledge of their structure and function to improve the ...

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

Soins et entretien réguliers d&#39;un poisson zèbre (<em&gt; Danio rerio</em&gt;) Laboratoire: An Introduction

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

A Protocol for Phage Display and Affinity Selection Using Recombinant Protein Baits

Un protocole pour Phage Display et Affinity sélection en utilisant appâts protéine recombinante

Using  recombinant phage as a scaffold to present various protein portions encoded by  a directionally cloned cDNA library to immobilized bait molecules ...

SIVQ-LCM Protocol for the ArcturusXT Instrument

Protocole SIVQ-LCM pour l&#39;instrument ArcturusXT

SIVQ-LCM is a new methodology that automates and streamlines the more traditional, user-dependent laser dissection process.&#160;It aims to create an ...

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers

Protocole de laboratoire pour les Analyses de contenu Gut génétiques de macroinvertébrés aquatiques Using Group-specific ADNr amorces

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the ...

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Protocole expérimental pour l’utilisation de drosophile comme un système modèle d’invertébrés pour les essais de toxicité en laboratoire

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ...