Name: a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)
Uploaded: 2018-04-11T14:00:00
Duration: 7 min 58 s
Description: Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

Wir danken Alessandro Cellerino, Tyrone Genade, Anne Brunet, Sabrina Sharp, Mickie Powell, Simone Keil, Yumi Kim, Patrick Smith, Kai Mathar und allen Mitgliedern des Valenzano Labor am Max-Planck-Institut für Biologie des Alterns für Ihren Beitrag zu verschiedenen Aspekten des derzeitigen Killifische Tierhaltung Protokolls im Laufe der Jahre.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

Die Autoren erklären keine finanzielle und nicht finanzielle Interessenkonflikte.

Wir beschreiben ein Protokoll für das Labor züchten von Türkis Killifische, einschließlich Embryo Sammlung sowie Inkubation und ausgewachsenen Fischen Gehäuse, Zucht und Fütterung. Unser Protokoll richtet sich speziell an Labore, die forschen konzentrierten sich auf Erwachsene Fische, insbesondere für experimentelle Studien über das Altern und Lebensdauer. Türkis Killifische kann auf standard Zebrafisch-Anlage angehoben werden; wichtige Aspekte der Tierhaltung Killifische unterscheiden sich jedoch von standard Zebrafisch Pflege16. Diese Anpassungen umfassen frühen Übergang von Artemia nur Diät zu einer Ernährung mit Protein-reiche Blut Wurm als auch spezifische Schritte im Embryo Inkubation, bestehend aus einer flüssigen und trockenen Inkubation Bühne ergänzt.
Wichtige Schritte im Rahmen des Protokolls beinhalten Versand Embryonen im 8-30 ° C Temperaturbereich. Fruchtbarkeit hängt bei Zucht, Fütterung, Frequenz und Qualität des Essens; Wir empfehlen daher, mindestens zwei Fütterungen pro Tag pro Zucht Tank um Embryonen Ertrag (siehe Abschnitt 5.6) zu erhöhen. Während der Embryo zu bleichen, verlängern Sie Embryo Inkubation im Bleichbad nicht. Dies kann Schäden am Ei Chorion und erhöhte Embryo Sterblichkeit führen. Wenn Embryonen mit Methylenblau Inkubation, nicht verlängern Sie, Inkubation von bereit-zu-Luke Embryonen länger als 2 Wochen, da ihre Überlebensfähigkeit drastisch verringert wird. Für Schraffur Türkis Killifische, niedriger Temperatur von Huminsäure saure Lösung verbessert die Schraffur und vollständiges Eintauchen des Embryos in der Lösung ermöglicht synchronisierten Schlupf. Nicht ausreichende Belüftung während der Inkubation resultiert hohe Raten von Fry nicht in der Lage, die Gas-Blase zu füllen ("Bauch-Schieber" Phänotyp, siehe Hinweise in Abschnitt 5.1).
Einschränkung des Protokolls für die Zucht umfasst den Einsatz von Sand Substrat welche Herausforderungen auf zentrale Filteranlagen und sollte in Zukunft durch alternative Methoden ersetzt werden. Mögliche Alternativen könnte die Verwendung von Zebrafisch Zucht Panzer. Embryo bleichen könnte wichtige physikalisch-chemische Veränderungen in der Ei-Chorion, die veränderten Chorion Physiologie und Schraffur Erfolg führen könnte. Ständiger Exposition von Embryonen zu Methylenblau kann langfristige Veränderungen der Erwachsenen Fische Physiologie induzieren. Erhöhung der Erwachsenen Fische in einzelnen Tanks für Überleben Kohortenstudien könnten Fisch Verhalten und Gesundheit beeinträchtigen. Gruppenhaltung für Überleben Kohortenstudien fügt jedoch erhebliche Störfaktoren durch die Etablierung der sozialen Dominanz und männlicher Gebiete führt zu strengen sozialen Hierarchien. Daher beurteilen wir, dass Isolation von männlichen Fischen für Überleben Studien ein vernünftiger Kompromiss ist. Fütterung Labor Killifische Kolonien mit Lebendfutter aus UN-kontrollierten Quellen fügen Sie ein Risiko für externe Verunreinigungen von Parasiten und potenziell pathogenen mikrobieller Gemeinschaften. In Zukunft sollte eine ad-hoc-sterile Fischfutter entwickelt werden.
Zukünftige Verbesserungen dieses Protokolls konzentriert sich auf eine kontrollierte, nicht-live Diät führt nach wie vor Abschluss der Geschlechtsreife innerhalb von 3-4 Wochen. Zusammenfassend bietet unser Protokoll Zugänglichkeit zum türkisblauen Killifische Labor Kultivierung einer breiten Fachöffentlichkeit.

Aufgrund ihrer kurzen Lebensdauer und schnelle Lebenszyklus, sind türkis Killifische als vielversprechende neue Modellorganismus in der Biologie1,2,3rasant. Diese Art zeichnet sich durch einen einzigartigen Lebenszyklus für eine teleost, bestehend aus embryonalen Diapause, schnelle sexuelle Reifung und eine verlängerte post-reproductive Lebensdauer Stufe4,5. Den letzten Arbeit hat dazu beigetragen, Aufklärung die Biologie dieser Arten in Gefangenschaft und im wilden6,7. Türkis Killifische Leben in saisonalen frischen Gewässer dieser Form während der Regenzeit in der afrikanischen Savanne in Simbabwe und Mosambik. Während der Trockenzeit überleben Embryonen im trockenen Schlamm in Abwesenheit von Wasser durch eine Stress-resistente Lebensstadium Diapause genannt.
Genetische Karten für diese Spezies wurden generierten8,9, und vor kurzem wurde ihr Genom sequenziert und montierten10,11. Mehreren Inzucht laborbelastungen Fisch entwickelt worden und Transgenese und Genom Bearbeitung via CRISPR/Cas9 sind verfügbar in dieser Spezies, de-facto- Förderung Türkis Killifische als wettbewerbsfähige Labor vertebrate Modellorganismus geworden 12,13,14.
Obwohl ein Laborprotokoll für diese Arten15bereits veröffentlicht worden, in diesem Protokoll entwickeln wir eine umfassende Liste von experimentellen Labor-Richtlinien, die speziell auf Studien, die untersuchen, Alterung und überleben. Dieses Protokoll ermöglicht Forschern bereits vertraut mit Zebrafisch und Medaka Tierhaltung in Türkis Killifische Zucht bewandert werden durch die Annahme einer Mindestanzahl von wesentliche Anpassungen. Zur gleichen Zeit bietet dieses Protokoll Forschern ohne Vorkenntnisse in Fisch Zucht mit wichtigen Tools um eine blühende Kolonie Türkis Killifische zu erhöhen.

<table>
	<tbody>
		<tr>
			<td>Probe calibration buffer solution pH=7.0</td>
			<td>Roth</td>
			<td>A518.1</td>
			<td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Probe calibration buffer solution pH=4.0</td>
			<td>Roth</td>
			<td>P712.1</td>
			<td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Conductivity standard</td>
			<td>VWR</td>
			<td>83607.260</td>
			<td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td>
		</tr>
		<tr>
			<td>Easy Strips Test 6in1</td>
			<td>JBL</td>
			<td>2533900</td>
			<td>Test strips for determination chlorine values of system water</td>
		</tr>
		<tr>
			<td>Ammonia Test</td>
			<td>JBL</td>
			<td>2536500</td>
			<td>Test to determine ammonia content of system water</td>
		</tr>
		<tr>
			<td>Red Sea Salt</td>
			<td>Red Sea</td>
			<td></td>
			<td>22 kg bucket</td>
		</tr>
		<tr>
			<td>Sodium hydrogen carbonate</td>
			<td>VWR</td>
			<td>27780.360</td>
			<td></td>
		</tr>
		<tr>
			<td>Humic acid</td>
			<td>Sigma- Aldrich</td>
			<td>53680-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>New HUFA Artemia enrichment</td>
			<td>ZM Systems UK</td>
			<td></td>
			<td>75g bottle</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Roth</td>
			<td>AE64.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrogen peroxide solution</td>
			<td>Sigma- Aldrich</td>
			<td>31642-1L</td>
			<td>30% (w/w)</td>
		</tr>
		<tr>
			<td>Cononut fiber</td>
			<td>Dragon</td>
			<td>ZCS010</td>
			<td></td>
		</tr>
		<tr>
			<td>Whatman paper</td>
			<td>GE healthcare</td>
			<td>3030-690</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol pure</td>
			<td>VWR</td>
			<td>20821.467</td>
			<td>100%</td>
		</tr>
		<tr>
			<td>Silica sand</td>
			<td>local pet shop</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Artemia Eggs Premium Grade</td>
			<td>Sanders</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bloodworm</td>
			<td>local distributor</td>
			<td></td>
			<td>Poseidon Aquakultur Germany</td>
		</tr>
		<tr>
			<td>dNTPs solution mix</td>
			<td>Biolabs</td>
			<td>N04472</td>
			<td>10mM</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>5U/uL</td>
		</tr>
		<tr>
			<td>PCR 10x Buffer</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>NaOH</td>
			<td>Sigma- Aldrich</td>
			<td>S8045-500g</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>Tris-HCl, pH=8.0 solution</td>
			<td>Sigma- Aldrich</td>
			<td>T2694-1L</td>
			<td>1M</td>
		</tr>
		<tr>
			<td>HCl 37%</td>
			<td>Sigma- Aldrich</td>
			<td>H1758-500mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Aquatic housing system</td>
			<td>Aquaneering</td>
			<td></td>
			<td>Central filtration equipped aquatic system</td>
		</tr>
		<tr>
			<td>Fish tanks</td>
			<td>Aquaneering</td>
			<td></td>
			<td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td>
		</tr>
		<tr>
			<td>Orbital shaker</td>
			<td>VWR</td>
			<td>89032-100</td>
			<td>model 5000</td>
		</tr>
		<tr>
			<td>Microbiological incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>50125882</td>
			<td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Cooling Incubator</td>
			<td>Binder</td>
			<td>9020-0209</td>
			<td>model KT115; for storage embryos in the solid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Hatching incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>51028114</td>
			<td>model OGS180; for embryos hatching, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Stereomicroscope</td>
			<td>Leica</td>
			<td></td>
			<td>model M80</td>
		</tr>
		<tr>
			<td>Breeding sand/hatching boxes</td>
			<td>Roth</td>
			<td>1598.1</td>
			<td>1000mL</td>
		</tr>
		<tr>
			<td>Petri dish</td>
			<td>Sarstedt</td>
			<td>82.1473</td>
			<td>92x16mm</td>
		</tr>
		<tr>
			<td>50mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.547.254</td>
			<td></td>
		</tr>
		<tr>
			<td>15mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.554.002</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Plastic Pasteur pipette</td>
			<td>Roth</td>
			<td>EA71.1</td>
			<td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td>
		</tr>
		<tr>
			<td>Serological pipette</td>
			<td>Sarstedt</td>
			<td>86.1689.001</td>
			<td>50mL</td>
		</tr>
		<tr>
			<td>Syringe</td>
			<td>Henke Sass Wolf</td>
			<td>4100-000V0</td>
			<td>10mL</td>
		</tr>
		<tr>
			<td>Metal strainer</td>
			<td></td>
			<td></td>
			<td>fineness &#60;1mm; for embryos collection</td>
		</tr>
		<tr>
			<td>Tweezers</td>
			<td>Dumont</td>
			<td>0508-5/45-PO</td>
			<td>type5/45; for embryos transfer</td>
		</tr>
		<tr>
			<td>25L Brine shrimps hatcher</td>
			<td>Aquaneering</td>
			<td>ZHBS25</td>
			<td>main hatcher</td>
		</tr>
		<tr>
			<td>500mL Brine shrimps hatcher</td>
			<td>JBL</td>
			<td>6106100</td>
			<td>model Artemio 1; backuo hatcher</td>
		</tr>
		<tr>
			<td>Narrow-mesh fish nets</td>
			<td>JBL</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sand beaker</td>
			<td>VWR</td>
			<td>BURK7102-5000</td>
			<td>5000mL</td>
		</tr>
		<tr>
			<td>Brine shrimps separation beaker</td>
			<td>VWR</td>
			<td>BURK7102-2000</td>
			<td>2000mL</td>
		</tr>
		<tr>
			<td>Plastic zipper bag</td>
			<td>Roth</td>
			<td>P279.2</td>
			<td>for dead fish storage</td>
		</tr>
		<tr>
			<td>Pipetboy</td>
			<td>Integra</td>
			<td>155000</td>
			<td>model Pipetboy acu2</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>P-Lab</td>
			<td>P701605</td>
			<td></td>
		</tr>
		<tr>
			<td>Air tubing</td>
			<td>www.zajac.de</td>
			<td>AQ380</td>
			<td>4-6 mm diameter</td>
		</tr>
		<tr>
			<td>1L Glass bottle</td>
			<td>VWR</td>
			<td>215-1595</td>
			<td></td>
		</tr>
		<tr>
			<td>2L Glass bottle</td>
			<td>VWR</td>
			<td>215-1596</td>
			<td></td>
		</tr>
		<tr>
			<td>500mL Squeeze bottle</td>
			<td>Roth</td>
			<td>K665.1</td>
			<td>for fish feeding with brine shrimps</td>
		</tr>
		<tr>
			<td>120 micron brine shrimps strainer</td>
			<td>Florida Aqua Farms</td>
			<td>BB-PC2</td>
			<td>for brine shrimps/bloodworm collection</td>
		</tr>
		<tr>
			<td>Finish filter socks</td>
			<td>Aquaneering</td>
			<td>MFVB025C</td>
			<td>25 micron</td>
		</tr>
		<tr>
			<td>Central filtration fish housing system</td>
			<td></td>
			<td></td>
			<td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td>
		</tr>
	</tbody>
</table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

Die Entwicklung von Tierhaltungspraktiken in Labor-Modell Fisch für experimentelle Zwecke hat profitiert von der Gründung des Referenz-Fisch Modellsysteme wie Zebrafisch und Medaka. In den letzten Jahren hat eine wachsende Zahl von Forschungsgruppen in den Bereichen der Biologie des Alterns und Ökologie einer aufstrebenden Fisch – die türkisfarbenen Killifische (Nothobranchius Furzeri) – angenommen. Mit einer Gefangenschaft Lebensdauer von 4 bis 8 Monate diese Art ist die kurzlebigsten Wirbeltier in Gefangenschaft angehoben und ermöglicht die wissenschaftliche Gemeinschaft Test – in kurzer Zeit – experimentelle Interventionen, die zu Veränderungen des Alterns Rate und Lebenserwartung führen können. Angesichts die einzigartigen Biologie dieser Art, gekennzeichnet durch embryonale Diapause markiert explosive sexuelle Reifung, morphologische und Verhaltensstörungen Geschlechtsdimorphismus- und ihrer relativ kurzen Erwachsenen Lebensdauer - ad-hoc- Tierhaltung sind Praktiken in dringenden Nachfrage. Dieses Protokoll berichtet eine Reihe von wichtigen Tierhaltung Maßnahmen, mit denen optimale Türkis Killifische Labor Pflege, Aktivierung der wissenschaftlichen Gemeinschaft, diese Spezies als ein leistungsfähiges Labor Tiermodell anzunehmen.

Türkis Killifische richtige Haltung führt mediane Überlebenszeit zwischen 12-18 Wochen in der GRZ Belastung (z. B. Abbildung 4A). Variationen der mediane Überlebenszeit abhängig von Ernährung, Fütterung Frequenz und Temperatur Wohnbedingungen. Schlechte Haltung führt zu überleben Kurven präsentiert erhöht frühe Sterblichkeit und repetitive, plötzlichen Tropfen des Überlebens im Laufe der Zeit zeichnet sich durch mehrere Wendepunkte (Abbildung 4 b).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> Abbildung 1: Repräsentative embryonalen Entwicklungsstufen mit entsprechenden Inkubation Substrat. (A) frisch gesammelten Embryonen, inkubiert in Methylenblau-Lösung im Inkubator bei 28 ° C. (B) Embryonen bereit, auf festem Medium übertragen werden entweder Papier oder Kokos Faser filtern. (C) Embryonen bereit, die schraffiert werden, typische golden IRIS anzeigen. Der Maßstab ist gleich bis 1 mm. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> Abbildung 2: Phasen des türkisfarbenen Killifische nach dem Schlüpfen Entwicklung. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> Abbildung 3: Repräsentative Fisch ID-Tag für Fische aus Stufe 3 ab. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> Abbildung 4: Repräsentative überleben Kurve für 70 männlichen Türkis Killifische. (A) typische überleben Kurve für Labor-raiste Türkis Killifische. (B) Vergleich der überleben Kurven gewonnenen Fische unter optimalen Haltungsbedingungen (schwarz) angehoben und schlechte Tierhaltung (rot und blau). Die gestrichelte rote horizontale Linie gibt 50 % überleben, sich überschneidenden überleben Kurve an mittlere Lebensdauer (auf der x-Achse angegeben). <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>ID</td>
			<td colspan="2">Forward primer</td>
			<td colspan="2">Rückwärts-primer</td>
			<td>Größenbereich (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
<tr>
<td colspan="6">* - sex Bestimmung Marker</td>
		</tr>
</tbody></table>Tabelle 1: Genotypisierung Zündkapseln für Stamm-Identifikation.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

Labor-Gehäuse von Türkis, die Killifische unterzubringen und effizient erhöhen Tausende von einzelnen Fische in eine zentralisierte Wasserfilter-System, mit der gleichen Infrastruktur für standard Zebrafisch genutzt skaliert werden kann. Hier zeigen wir eine Liste von standardisierten Verfahren, die effiziente Killifische Wartung ermöglichen.

Ein Protokoll für Labor Housing von Türkis Killifische (Nothobranchius Furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

Protocol for Mosquito Rearing (A. gambiae)

Protocol for Mosquito Rearing A. gambiae

Protokoll für Mosquito Aufzucht (A. gambiae)

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night ...

Forschung

Biologie

Neutrophil Isolation Protocol

Neutrophile Isolation Protocol

Neutrophil polymorphonuclear granulocytes (PMN) are the most abundant leukocytes in humans and among the first cells to arrive on the site of inflammatory ...

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia (SCG)

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia SCG

Protokoll zur Kultivierung sympathischen Neuronen aus Ratten-Superior Halsganglien (SCG)

The superior cervical ganglia (SCG) in rats are small, glossy, almond-shaped structures that contain sympathetic neurons.  These neurons provide ...

A Protocol for the Production of KLRG1 Tetramer

Ein Protokoll für die Produktion von KLRG1 Tetramer

Killer cell lectin-like receptor G1 (KLRG1) is a type II transmembrane glycoprotein inhibitory receptor belonging to the C type lectin-like superfamily. ...

A Protocol for Computer-Based Protein Structure and Function Prediction

Ein Protokoll für die Computer-Based Protein Structure and Function Prediction

Genome sequencing projects have ciphered millions of protein sequence, which require knowledge of their structure and function to improve the ...

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

Regelmäßige Pflege und Wartung eines Zebrafisch (<em&gt; Danio rerio</em&gt;) Labor: Eine Einführung

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

A Protocol for Phage Display and Affinity Selection Using Recombinant Protein Baits

Ein Protokoll für die Phagen-Display-und Affinity Auswahl mit rekombinantem Protein-Köder

Using  recombinant phage as a scaffold to present various protein portions encoded by  a directionally cloned cDNA library to immobilized bait molecules ...

SIVQ-LCM Protocol for the ArcturusXT Instrument

SIVQ LCM-Protokoll für das Instrument ArcturusXT

SIVQ-LCM is a new methodology that automates and streamlines the more traditional, user-dependent laser dissection process.&#160;It aims to create an ...

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers

Laborprotokoll für genetische Darm Inhaltsanalysen der aquatischen Makroinvertebraten Using gruppenspezifische rDNA Primer

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the ...

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Experimentelles Protokoll für die Verwendung von Drosophila als ein Wirbellosen Modellsystem für Toxizitätstests im Labor

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ...