Name: a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)
Uploaded: 2018-04-11T14:00:00
Duration: 7 min 58 s
Description: Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

אנו מודים אלסנדרו Cellerino, טיירון Genade, סחופת אן, סברינה שארפ, מיקי פאוול, סימון Keil, קים יומי, פטריק סמית, Mathar קאי, כל חברי המעבדה Valenzano במכון מקס פלאנק על הביולוגיה של הזדקנות לתרום היבטים שונים הנוכחי דגים גמבוזיים גידול בפרוטוקול לאורך השנים.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

כל המחברים מצהירים אין אינטרסים מתחרים לא-כספיים ופיננסיים.

אנו מתארים עבור המעבדה culturing של דגים גמבוזיים טורקיז, כולל אוסף העובר, דגירה, כמו גם דגים למבוגרים דיור, פרוטוקול, רבייה, האכלה. פרוטוקול שלנו במיוחד לאוכלוסייה מעבדות כי התנהלות המחקר התמקד דגים למבוגרים, בפרט ללימודי ניסיוני על הזדקנות ואת תוחלת החיים. דגים גמבוזיים טורקיז יכול יגודל על מתקן דג זברה רגיל; עם זאת, היבטים חשובים של גידול דגים גמבוזיים שונים של טיפול סטנדרטי דג זברה16. התאמות אלה כוללים מעבר מיגדרי מוקדם של דיאטה רק שרימפסים דיאטה עם תולעת דם עשירים בחלבון, וכן פירוט השלבים הדגירה העובר, המורכב שלב הדגירה נוזלי ויבש.
שלבים קריטיים בתוך הפרוטוקול כוללים משלוח העוברים בטווח טמפרטורה 8-30 ° C. במקרה של גידול, פוריות תלוי האכלה תדירות ואיכות המזון; לכן, מומלץ לפחות שני בפטריה ליום רבייה טנק לגדל עוברי תשואה (ראו סעיף 5.6.). במהלך העובר הלבנת, לא להרחיב העובר הדגירה בפתרון הלבנה. זה עלול לגרום נזק chorion ביצה, העובר מוגבר לתמותה. כאשר המקננת העוברים עם כחול מתילן, לא להאריך דגירה של עוברי מוכן לצוהר-יותר מ 2 שבועות כפי הכדאיות שלהם יקטן באופן משמעותי. הבקיעה דגים גמבוזיים טורקיז, טמפרטורה נמוכה של תמיסה חומצית רקבובי משפר הבקיעה, טבילה מלאה של העוברים בפתרון מאפשר הבקיעה מסונכרן. לא מספיק לערבב במהלך בתוצאות הדגירה שיעור גבוה של פריי לא תוכל למלא גז שלפוחית השתן ("בטן-המחוון" פנוטיפ, עיין בהערות בסעיף 5.1).
הגבלה של פרוטוקול לגידול כולל את המצע חול אשר מציבה אתגרים כדי מרכזי מערכות סינון, צריך להיות מוחלף על ידי שיטות אלטרנטיביות בעתיד. חלופות אפשריות יכולה להיות השימוש של דג זברה גידול טנקים. העובר הלבנת עלול לגרום שינויים משמעותיים פיזית-כימית ב chorion ביצה אשר עלולה לגרום chorion שינו פיסיולוגיה, הבקיעה הצלחה. חשיפה מתמדת של העוברים מתילן כחול עלול לגרום שינוי ארוך טווח בפיזיולוגיה דגים למבוגרים. גידול דגים למבוגרים במיכלים נפרדים במחקרי עוקבה הישרדות עלול להשפיע לרעה דגים התנהגות ובריאות. עם זאת, קבוצת הדיור במחקרי עוקבה הישרדות מוסיף גורמים מבלבלים משמעותית עקב הקמת הדומיננטיות החברתית וטריטוריות זכר, שמוביל הירארכיות חברתיות קפדנית. לכן, אנו שופטים כי הבידוד של דג זכר ללימודי הישרדות היא פשרה סבירה. האכלה מושבות דגים גמבוזיים מעבדה עם מזון חי ממקורות בלתי מבוקרת להוסיף סיכון עבור מציג חיצוני טפילים וקהילות חיידקים פתוגניים פוטנציאלי. בעתיד, צריכה להיות מפותחת של מזון הדגים סטרילי אד הוק.
שיפורים עתידיים פרוטוקול זה יתמקד דיאטה מבוקרת, שאינם חיים, אשר עדיין מוביל השלמת התבגרות מינית בתוך 3-4 שבועות. לסיכום, פרוטוקול שלנו מציע נגישות דגים גמבוזיים טורקיז מעבדה culturing קהילה מדעית רחבה.

בהתחשב שלהם תוכלת חיים קצרה, מהירה מחזור חיים, דגים גמבוזיים טורקיז גדלים במהירות כ אורגניזם מודל חדש מבטיח ביולוגיה1,2,3. מין זה מאופיין על ידי מחזור חיים ייחודי עבור teleost, המורכב של דיאפאוזה, התבגרות מינית מהירה של משך חיים post-reproductive שלב4,5. העבודה האחרונה תרם שחקרתי את הביולוגיה של מין זה בשבי והן את הבר6,7. דגים גמבוזיים טורקיז חיים גופי מים טריים עונתיים טופס זה במהלך העונה הגשומה, בסוואנה האפריקנית ב זימבבואה ומוזמביק. במהלך העונה היבשה, העוברים לשרוד בבוץ יבש בהיעדר מים מכוח שלב חיים עמידים ללחץ הנקרא תרדמה ואסטרטגיה.
הגנטי מפות עבור המין הזה שנוצר8,9, לאחרונה את הגנום שלהם היה ברצף, שהורכבו10,11. פותחו זנים שונים של דגים מעבדה המפגרים, ו transgenesis ו גנום עריכה דרך CRISPR/Cas9 הופכים לזמינים במין זה, דה-פקטו קידום דגים גמבוזיים טורקיז כאורגניזם מודל חוליות תחרותי מעבדה 1213,,14.
למרות שכבר פורסמה פרוטוקול המעבדה הזה מינים15, בפרוטוקול הנוכחי אנו מפתחים רשימה מקיפה של קווים מנחים מעבדה ניסויית מכוונים במיוחד מחקרים לחקור הזדקנות והישרדות. בפרוטוקול הנוכחי מאפשר לחוקרים מוכר כבר עם גידול דג זברה, medaka הופכים שבקיאים גידול דגים גמבוזיים טורקיז על ידי אימוץ מספר מינימלי של התאמות מפתח. במקביל, פרוטוקול זה מספק חוקרים ללא ניסיון קודם בגידול דגים עם כלים חיוניים לגדל מושבה דגים גמבוזיים טורקיז משגשגת.

<table>
	<tbody>
		<tr>
			<td>Probe calibration buffer solution pH=7.0</td>
			<td>Roth</td>
			<td>A518.1</td>
			<td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Probe calibration buffer solution pH=4.0</td>
			<td>Roth</td>
			<td>P712.1</td>
			<td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Conductivity standard</td>
			<td>VWR</td>
			<td>83607.260</td>
			<td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td>
		</tr>
		<tr>
			<td>Easy Strips Test 6in1</td>
			<td>JBL</td>
			<td>2533900</td>
			<td>Test strips for determination chlorine values of system water</td>
		</tr>
		<tr>
			<td>Ammonia Test</td>
			<td>JBL</td>
			<td>2536500</td>
			<td>Test to determine ammonia content of system water</td>
		</tr>
		<tr>
			<td>Red Sea Salt</td>
			<td>Red Sea</td>
			<td></td>
			<td>22 kg bucket</td>
		</tr>
		<tr>
			<td>Sodium hydrogen carbonate</td>
			<td>VWR</td>
			<td>27780.360</td>
			<td></td>
		</tr>
		<tr>
			<td>Humic acid</td>
			<td>Sigma- Aldrich</td>
			<td>53680-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>New HUFA Artemia enrichment</td>
			<td>ZM Systems UK</td>
			<td></td>
			<td>75g bottle</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Roth</td>
			<td>AE64.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrogen peroxide solution</td>
			<td>Sigma- Aldrich</td>
			<td>31642-1L</td>
			<td>30% (w/w)</td>
		</tr>
		<tr>
			<td>Cononut fiber</td>
			<td>Dragon</td>
			<td>ZCS010</td>
			<td></td>
		</tr>
		<tr>
			<td>Whatman paper</td>
			<td>GE healthcare</td>
			<td>3030-690</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol pure</td>
			<td>VWR</td>
			<td>20821.467</td>
			<td>100%</td>
		</tr>
		<tr>
			<td>Silica sand</td>
			<td>local pet shop</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Artemia Eggs Premium Grade</td>
			<td>Sanders</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bloodworm</td>
			<td>local distributor</td>
			<td></td>
			<td>Poseidon Aquakultur Germany</td>
		</tr>
		<tr>
			<td>dNTPs solution mix</td>
			<td>Biolabs</td>
			<td>N04472</td>
			<td>10mM</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>5U/uL</td>
		</tr>
		<tr>
			<td>PCR 10x Buffer</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>NaOH</td>
			<td>Sigma- Aldrich</td>
			<td>S8045-500g</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>Tris-HCl, pH=8.0 solution</td>
			<td>Sigma- Aldrich</td>
			<td>T2694-1L</td>
			<td>1M</td>
		</tr>
		<tr>
			<td>HCl 37%</td>
			<td>Sigma- Aldrich</td>
			<td>H1758-500mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Aquatic housing system</td>
			<td>Aquaneering</td>
			<td></td>
			<td>Central filtration equipped aquatic system</td>
		</tr>
		<tr>
			<td>Fish tanks</td>
			<td>Aquaneering</td>
			<td></td>
			<td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td>
		</tr>
		<tr>
			<td>Orbital shaker</td>
			<td>VWR</td>
			<td>89032-100</td>
			<td>model 5000</td>
		</tr>
		<tr>
			<td>Microbiological incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>50125882</td>
			<td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Cooling Incubator</td>
			<td>Binder</td>
			<td>9020-0209</td>
			<td>model KT115; for storage embryos in the solid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Hatching incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>51028114</td>
			<td>model OGS180; for embryos hatching, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Stereomicroscope</td>
			<td>Leica</td>
			<td></td>
			<td>model M80</td>
		</tr>
		<tr>
			<td>Breeding sand/hatching boxes</td>
			<td>Roth</td>
			<td>1598.1</td>
			<td>1000mL</td>
		</tr>
		<tr>
			<td>Petri dish</td>
			<td>Sarstedt</td>
			<td>82.1473</td>
			<td>92x16mm</td>
		</tr>
		<tr>
			<td>50mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.547.254</td>
			<td></td>
		</tr>
		<tr>
			<td>15mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.554.002</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Plastic Pasteur pipette</td>
			<td>Roth</td>
			<td>EA71.1</td>
			<td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td>
		</tr>
		<tr>
			<td>Serological pipette</td>
			<td>Sarstedt</td>
			<td>86.1689.001</td>
			<td>50mL</td>
		</tr>
		<tr>
			<td>Syringe</td>
			<td>Henke Sass Wolf</td>
			<td>4100-000V0</td>
			<td>10mL</td>
		</tr>
		<tr>
			<td>Metal strainer</td>
			<td></td>
			<td></td>
			<td>fineness &#60;1mm; for embryos collection</td>
		</tr>
		<tr>
			<td>Tweezers</td>
			<td>Dumont</td>
			<td>0508-5/45-PO</td>
			<td>type5/45; for embryos transfer</td>
		</tr>
		<tr>
			<td>25L Brine shrimps hatcher</td>
			<td>Aquaneering</td>
			<td>ZHBS25</td>
			<td>main hatcher</td>
		</tr>
		<tr>
			<td>500mL Brine shrimps hatcher</td>
			<td>JBL</td>
			<td>6106100</td>
			<td>model Artemio 1; backuo hatcher</td>
		</tr>
		<tr>
			<td>Narrow-mesh fish nets</td>
			<td>JBL</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sand beaker</td>
			<td>VWR</td>
			<td>BURK7102-5000</td>
			<td>5000mL</td>
		</tr>
		<tr>
			<td>Brine shrimps separation beaker</td>
			<td>VWR</td>
			<td>BURK7102-2000</td>
			<td>2000mL</td>
		</tr>
		<tr>
			<td>Plastic zipper bag</td>
			<td>Roth</td>
			<td>P279.2</td>
			<td>for dead fish storage</td>
		</tr>
		<tr>
			<td>Pipetboy</td>
			<td>Integra</td>
			<td>155000</td>
			<td>model Pipetboy acu2</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>P-Lab</td>
			<td>P701605</td>
			<td></td>
		</tr>
		<tr>
			<td>Air tubing</td>
			<td>www.zajac.de</td>
			<td>AQ380</td>
			<td>4-6 mm diameter</td>
		</tr>
		<tr>
			<td>1L Glass bottle</td>
			<td>VWR</td>
			<td>215-1595</td>
			<td></td>
		</tr>
		<tr>
			<td>2L Glass bottle</td>
			<td>VWR</td>
			<td>215-1596</td>
			<td></td>
		</tr>
		<tr>
			<td>500mL Squeeze bottle</td>
			<td>Roth</td>
			<td>K665.1</td>
			<td>for fish feeding with brine shrimps</td>
		</tr>
		<tr>
			<td>120 micron brine shrimps strainer</td>
			<td>Florida Aqua Farms</td>
			<td>BB-PC2</td>
			<td>for brine shrimps/bloodworm collection</td>
		</tr>
		<tr>
			<td>Finish filter socks</td>
			<td>Aquaneering</td>
			<td>MFVB025C</td>
			<td>25 micron</td>
		</tr>
		<tr>
			<td>Central filtration fish housing system</td>
			<td></td>
			<td></td>
			<td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td>
		</tr>
	</tbody>
</table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

פיתוח שיטות גידול דגים-מודל מעבדה המשמש למטרות ניסוי הרוויחה במידה רבה הנובעת מקיומן של הפניה דגים דגם מערכות, כגון דג זברה, medaka. בשנים האחרונות, דגים המתעוררים – טורקיז דגים גמבוזיים (Nothobranchius furzeri) – אומץ על ידי מספר גדל והולך של קבוצות מחקר בתחומי הביולוגיה של הזדקנות ואקולוגיה. עם תוחלת החיים בשבי של 4-8 חודשים, מין זה חוליות shortest-lived גידלה בשבי ומאפשרת לקהילה המדעית התערבויות ניסיוני מבחן – תוך זמן קצר – זה יכול להוביל שינוי קצב ההזדקנות ואת תוחלת החיים. בהתחשב הביולוגיה ייחודי של מין זה, המאופיין דיאפאוזה, התבגרות מינית נפץ, מסומן מורפולוגיים והתנהגותיים צורתיות - ו שלהם קצר יחסית למבוגרים אורך החיים - גידול אד הוק נוהלי הם בדחוף לפי דרישה. פרוטוקול זה מדווחת קבוצת מפתח בעלי אמצעים המאפשרים דגים גמבוזיים טורקיז אופטימלית טיפול מעבדה, הפיכת הקהילה המדעית לאמץ את המין הזה כמודל חיות מעבדה רב עוצמה.

דגים גמבוזיים טורקיז גידול נאות תוצאות חציון ההישרדות הנע בין 12-18 שבועות בנימה GRZ (למשל איור 4A). וריאציות של חציון ההישרדות תלויה דיאטה, האכלה תדירות ודיור בתנאי טמפרטורה. תוצאות המסכן גידול בפניות הישרדות הצגת גברה התמותה המוקדמת, טיפות חוזרים, פתאומית של הישרדות לאורך זמן, המאופיינת במספר נקודות פיתול (איור 4B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> איור 1: נציג העובריים התפתחותית עם סובסטרט הדגירה בהתאמה. (א) טרי שנאספו עוברי, מודגרות תמיסת מתילן כחול בחממה ב 28 º C. (B) העוברים מוכנים להעביר בינוני מוצק, לסנן גם סיבי נייר או קוקוס. (ג) העוברים מוכן לתכנון, הצגת אופייני קשתיות הזהב. סרגל קנה מידה שווה ל 1 מ מ. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> איור 2: שלבי דגים גמבוזיים טורקיז לאחר הבקיעה פיתוח. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> איור 3: דגים נציג תג זיהוי דגים משלב 3 ואילך. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> איור 4: עקומת הישרדות נציג עבור 70 דגים גמבוזיים זכר בצבע טורקיז. (א) עקומת הישרדות אופייני לכל הרים-מעבדה דגים גמבוזיים בצבע טורקיז. (B) השוואה של הישרדות עקומות המתקבל הדג גידל תחת תנאי גידול אופטימליים (שחור) ואת בעלי המסכן (אדום וכחול). קו מקווקו אופקי אדום מציין 50% הישרדות, עקומת הישרדות מצטלבים-חציון תוחלת החיים (מסומן בציר ה-x). <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>מזהה</td>
			<td colspan="2">פריימר לפנים</td>
			<td colspan="2">פריימר הפוכה</td>
			<td>גודל הטווח (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166 - 214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220 - 272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209 - 240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198 - 238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164 - 226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196 - 197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252 - 295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216 - 248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174 - 205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355 - 373</td>
		</tr>
<tr>
<td colspan="6">* - סקס נחישות סמנים</td>
		</tr>
</tbody></table>טבלה 1: תחל Genotyping לזיהוי מתח.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

דיור מעבדה של טורקיז דגים גמבוזיים ניתן לשנות את בית ולגדל ביעילות אלפי דגים בודדים במערכת סינון מים מרכזי, העסקת התשתית באותו המשמש להכנת דג זברה סטנדרטי. כאן אנחנו פירוט רשימת נהלים סטנדרטיים לאפשר דגים גמבוזיים יעיל תחזוקה.

פרוטוקול עבור המעבדה דיור של טורקיז דגים גמבוזיים (Nothobranchius furzeri)

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

Protocol for Mosquito Rearing (A. gambiae)

Protocol for Mosquito Rearing A. gambiae

פרוטוקול לגידול יתושים (א gambiae)

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night ...

Neutrophil Isolation Protocol

נויטרופילים בידוד פרוטוקול

Neutrophil polymorphonuclear granulocytes (PMN) are the most abundant leukocytes in humans and among the first cells to arrive on the site of inflammatory ...

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia (SCG)

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia SCG

פרוטוקול נוירונים culturing הסימפתטית מן הגרעינים עכברוש צוואר הרחם מעולה (SCG)

The superior cervical ganglia (SCG) in rats are small, glossy, almond-shaped structures that contain sympathetic neurons.  These neurons provide ...

A Protocol for the Production of KLRG1 Tetramer

פרוטוקול לייצור KLRG1 Tetramer

Killer cell lectin-like receptor G1 (KLRG1) is a type II transmembrane glycoprotein inhibitory receptor belonging to the C type lectin-like superfamily. ...

A Protocol for Computer-Based Protein Structure and Function Prediction

פרוטוקול מבנה מחשב מבוסס חלבון חיזוי פונקציה

Genome sequencing projects have ciphered millions of protein sequence, which require knowledge of their structure and function to improve the ...

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

טיפול קבוע ותחזוקה של דג זברה (<em&gt; Danio rerio</em&gt;) מעבדה: מבוא

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

A Protocol for Phage Display and Affinity Selection Using Recombinant Protein Baits

פרוטוקול לתצוגת הפאג וזיקה בחירה באמצעות פיתיונות חלבון רקומביננטי

Using  recombinant phage as a scaffold to present various protein portions encoded by  a directionally cloned cDNA library to immobilized bait molecules ...

SIVQ-LCM Protocol for the ArcturusXT Instrument

SIVQ-LCM פרוטוקול עבור מכשיר ArcturusXT

SIVQ-LCM is a new methodology that automates and streamlines the more traditional, user-dependent laser dissection process.&#160;It aims to create an ...

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers

פרוטוקול המעבדה הגנטית ניתוחים תוכן הבטן של הימית Macroinvertebrates באמצעות קבוצה ספציפית rDNA תחל

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the ...