Name: a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)
Uploaded: 2018-04-11T14:00:00
Duration: 7 min 58 s
Description: Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

우리 감사 Alessandro Cellerino, 타이론 Genade, 앤 검은 머리, 사 브리 나 샤 프, 미키 파월, 시몬 Keil, 김 유미, 패트릭 스미스, 카이 Mathar 및 Valenzano 연구소의 모든 구성원 막스 플랑크 연구소에서 노화의 생물학에 대 한 다양 한 측면에 기여 년 동안 현재 송사리 축산 프로토콜.

<ol>
	<li>Valenzano, D. R., Aboobaker, A., Seluanov, A., Gorbunova, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-canonical+aging+model+systems+and+why+we+need+them.">Non-canonical aging model systems and why we need them.</a> EMBO J. 36 (8), 959-963 (2017).</li><li>Harel, I., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish:+A+Model+for+Exploring+Vertebrate+Aging+and+Diseases+in+the+Fast+Lane.">The African Turquoise Killifish: A Model for Exploring Vertebrate Aging and Diseases in the Fast Lane.</a> Cold Spring Harb Symp Quant Biol. 80, 275-279 (2015).</li><li>Smith, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+life+span+by+the+gut+microbiota+in+the+short-lived+African+turquoise+killifish.">Regulation of life span by the gut microbiota in the short-lived African turquoise killifish.</a> Elife. 6, (2017).</li><li>Cellerino, A., Valenzano, D. R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+bush+to+the+bench:+the+annual+Nothobranchius+fishes+as+a+new+model+system+in+biology.">From the bush to the bench: the annual Nothobranchius fishes as a new model system in biology.</a> Biol Rev Camb Philos Soc. 91 (2), 511-533 (2016).</li><li>Kim, Y., Nam, H. G., Valenzano, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+short-lived+African+turquoise+killifish:+an+emerging+experimental+model+for+ageing.">The short-lived African turquoise killifish: an emerging experimental model for ageing.</a> Dis Model Mech. 9 (2), 115-129 (2016).</li><li>Blazek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repeated+intraspecific+divergence+in+life+span+and+aging+of+African+annual+fishes+along+an+aridity+gradient.">Repeated intraspecific divergence in life span and aging of African annual fishes along an aridity gradient.</a> Evolution. 71 (2), 386-402 (2017).</li><li>Terzibasi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+differences+in+aging+phenotype+between+strains+of+the+short-lived+annual+fish+Nothobranchius+furzeri.">Large differences in aging phenotype between strains of the short-lived annual fish Nothobranchius furzeri.</a> PLoS One. 3 (12), e3866 (2008).</li><li>Kirschner, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+quantitative+trait+loci+controlling+lifespan+in+the+short-lived+fish+Nothobranchius+furzeri--a+new+vertebrate+model+for+age+research.">Mapping of quantitative trait loci controlling lifespan in the short-lived fish Nothobranchius furzeri--a new vertebrate model for age research.</a> Aging Cell. 11 (2), 252-261 (2012).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+loci+associated+with+tail+color+and+sex+determination+in+the+short-lived+fish+Nothobranchius+furzeri.">Mapping loci associated with tail color and sex determination in the short-lived fish Nothobranchius furzeri.</a> Genetics. 183 (4), 1385-1395 (2009).</li><li>Reichwald, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+Sex+Chromosome+Evolution+and+Aging+from+the+Genome+of+a+Short-Lived+Fish.">Insights into Sex Chromosome Evolution and Aging from the Genome of a Short-Lived Fish.</a> Cell. 163 (6), 1527-1538 (2015).</li><li>Valenzano, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+African+Turquoise+Killifish+Genome+Provides+Insights+into+Evolution+and+Genetic+Architecture+of+Lifespan.">The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.</a> Cell. 163 (6), 1539-1554 (2015).</li><li>Harel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+platform+for+rapid+exploration+of+aging+and+diseases+in+a+naturally+short-lived+vertebrate.">A platform for rapid exploration of aging and diseases in a naturally short-lived vertebrate.</a> Cell. 160 (5), 1013-1026 (2015).</li><li>Valenzano, D. R., Sharp, S., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon-Mediated+Transgenesis+in+the+Short-Lived+African+Killifish+Nothobranchius+furzeri,+a+Vertebrate+Model+for+Aging.">Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging.</a> G3. 1 (7), 531-538 (2011).</li><li>Harel, I., Valenzano, D. R., Brunet, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+genome+engineering+approaches+for+the+short-lived+African+turquoise+killifish.">Efficient genome engineering approaches for the short-lived African turquoise killifish.</a> Nat Protoc. 11 (10), 2010-2028 (2016).</li><li>Polacik, M., Blazek, R., Reichard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+breeding+of+the+short-lived+annual+killifish+Nothobranchius+furzeri.">Laboratory breeding of the short-lived annual killifish Nothobranchius furzeri.</a> Nat Protoc. 11 (8), 1396-1413 (2016).</li><li>Avdesh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regular+care+and+maintenance+of+a+zebrafish+(Danio+rerio)+laboratory:+an+introduction.">Regular care and maintenance of a zebrafish (Danio rerio) laboratory: an introduction.</a> J Vis Exp. (69), e4196 (2012).</li></ol>

모든 저자는 아무 경쟁 금융 및 비 금융 관심사를 선언합니다.

우리 실험실 청록색 송사리, 성인 물고기 주택 뿐만 아니라 태아 컬렉션, 부 화, 등의 재배에 대 한 프로토콜을 설명, 사육 및 먹이. 우리의 프로토콜 노화와 수명에 대 한 실험 연구에 대 한 특히 성인 물고기에 초점을 맞춘 연구 실험실을 구체적으로 타겟팅 됩니다. 청록색 송사리 표준 zebrafish 시설;에 올려질 수 있다 그러나, 송사리 농업의 중요 한 측면에서 표준 zebrafish 케어16다. 이러한 배아 부 화, 액체와 건조 부 화 단계 구성의 특정 단계 뿐 아니라 단백질이 풍부한 혈액 벌레, 보충 다이어트 소금물 새우만 다이어트에서 초기 전환 포함 됩니다.
프로토콜 내에서 중요 한 단계 8-30 ° C의 온도 범위 내에서 운송 배아를 포함합니다. 번 식, 경우 통치 주파수 및 식품 품질; 먹이에 따라 달라 집니다. 따라서, 배아 수율 (참조 섹션 5.6.) 인상 탱크 사육 당 하루 두 개 이상 feedings를 좋습니다. 태아는 표백, 동안 표백 솔루션에서 태아 외피를 확장 하지 않습니다. 이 계란 chorion 및 증가 태아 사망률에 손상을 일으킬 수 있습니다. 메 틸 렌 블루와 배아를 배양 할 때로 그들의 생존 능력을 극적으로 감소 될 것 이다 2 주에 이상에 대 한 준비-해치 배아의 부 화를 연장 하지 마십시오. 청록색 송사리를 부 화, 대 한 humic 산 성 솔루션의 낮은 온도 향상 부 화 하며 솔루션에 배아의 완전 한 침수 동기화 된 해칭 가스 방광을 채울 수 없는 튀김의 높은 가격에 부 화 결과 동안 충분 한 통 기 통풍 ("배꼽-슬라이더" 표현 형, 섹션 5.1 참조 하십시오).
번 식에 대 한 프로토콜의 한계는 포즈에 여과 시스템을 중앙 집중식 도전과 미래에 다른 방법으로 대체 한다 모래 기판의 사용을 포함. 가능한 대안 zebrafish 사육 탱크의 사용 될 수 있습니다. 배아 표백 변경된 chorion 생리학 및 부 화 성공 귀 착될 수 있는 계란 chorion에 주요 물리 화학 변화를 일으킬 수 있습니다. Methylene 청색에 배아의 지속적인 노출 성인 물고기 생리학에 장기적인 변화 유도 수 있습니다. 성인 물고기 생존 코 호트 연구에 대 한 개별 탱크에서 높이 생선 행동과 건강을 부정적인 영향을 수 있습니다. 그러나, 생존 코 호트 연구 그룹 주택 엄격한 사회 계층으로 이어지는 사회 지배와 남성 영토의 설립으로 인해 상당한 혼란 요소를 추가 합니다. 따라서, 우리는 생존 연구에 대 한 남성 생선의 절연은 합리적인 타협 판단. 취소 제어 소스에서 라이브 음식 먹이 실험실 송사리 식민지는 기생충과 잠재적으로 병원 성 미생물 지역 사회에서 외부 오염에 대 한 위험을 추가합니다. 미래에 ad hoc 메 마른 물고기 피드 개발 되어야 한다.
이 프로토콜에 미래 개선 여전히 3-4 주 이내 성적 성숙 완료 리드 제어, 비-라이브 다이어트에 집중할 것 이다. 요약 하자면, 우리의 프로토콜 넓은 과학계에 청록색 송사리 실험실 경작에 대 한 접근을 제공 합니다.

그들의 짧은 생애 경 간 및 빠른 라이프 사이클을 감안할 때, 청록색 송사리를 유망한 새로운 모델 유기 체 생물학1,2,3로 급속 하 게 성장 하고있다. 이 종 한 teleost, 미 발달 diapause, 급속 한 성적인 성숙, 및 post-reproductive 수명 연장된 단계4,5의 구성에 대 한 고유한 라이프 사이클에 의해 특징입니다. 최근 작품은 포로 야생6,7에서이 종의 생물학 elucidating에 기여 했다. 청록색 송사리 짐바브웨, 모잠비크는 아프리카 사바나에 우기 동안 양식 계절 신선한 물 시체에 살고 있습니다. 건조 한 계절, 태아 건조 진흙 물 diapause 이라는 스트레스 저항 생활 단계 미 덕의 부재에 남아 있다.
이 종족에 대 한 유전자 지도 생성 된8,9, 그리고 최근에 그들의 게놈 시퀀스 및 조립10,11되었습니다. 여러 가지 타고 난된 실험실 물고기 종자를 개발 하 고 transgenesis 및 CRISPR/Cas9를 통해 편집 하는 게놈이이 종, 사실상 경쟁 실험실 척추 모델 유기 체 로 청록색 송사리를 홍보에 제공 되 12,,1314.
실험실 프로토콜 이미이 종15게시 되었습니다, 비록 현재 프로토콜에서 우리 개발 특히 노화 및 생존을 조사 연구 목적으로 실험 실험실 지침의 포괄적인 목록. 현재 프로토콜 연구원은 제 브라와 메 다카 축산에 이미 익숙한 키 조정의 최소 수를 채택 하 여 청록색 송사리 축산에 조예가 될 수 있습니다. 동시에이 프로토콜 번성 청록색 송사리 식민지를 필수 도구로 생선 농업에 사전 경험 없이 연구를 제공 합니다.

<table>
	<tbody>
		<tr>
			<td>Probe calibration buffer solution pH=7.0</td>
			<td>Roth</td>
			<td>A518.1</td>
			<td>1L buffer solution pH=7.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Probe calibration buffer solution pH=4.0</td>
			<td>Roth</td>
			<td>P712.1</td>
			<td>1L buffer solution pH=4.0 to calibrate water system pH-electrode</td>
		</tr>
		<tr>
			<td>Conductivity standard</td>
			<td>VWR</td>
			<td>83607.260</td>
			<td>500 mL Conductivity standard 1,413 uS/cm to calibrate water system conductivity-electrode</td>
		</tr>
		<tr>
			<td>Easy Strips Test 6in1</td>
			<td>JBL</td>
			<td>2533900</td>
			<td>Test strips for determination chlorine values of system water</td>
		</tr>
		<tr>
			<td>Ammonia Test</td>
			<td>JBL</td>
			<td>2536500</td>
			<td>Test to determine ammonia content of system water</td>
		</tr>
		<tr>
			<td>Red Sea Salt</td>
			<td>Red Sea</td>
			<td></td>
			<td>22 kg bucket</td>
		</tr>
		<tr>
			<td>Sodium hydrogen carbonate</td>
			<td>VWR</td>
			<td>27780.360</td>
			<td></td>
		</tr>
		<tr>
			<td>Humic acid</td>
			<td>Sigma- Aldrich</td>
			<td>53680-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>New HUFA Artemia enrichment</td>
			<td>ZM Systems UK</td>
			<td></td>
			<td>75g bottle</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Roth</td>
			<td>AE64.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrogen peroxide solution</td>
			<td>Sigma- Aldrich</td>
			<td>31642-1L</td>
			<td>30% (w/w)</td>
		</tr>
		<tr>
			<td>Cononut fiber</td>
			<td>Dragon</td>
			<td>ZCS010</td>
			<td></td>
		</tr>
		<tr>
			<td>Whatman paper</td>
			<td>GE healthcare</td>
			<td>3030-690</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol pure</td>
			<td>VWR</td>
			<td>20821.467</td>
			<td>100%</td>
		</tr>
		<tr>
			<td>Silica sand</td>
			<td>local pet shop</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Artemia Eggs Premium Grade</td>
			<td>Sanders</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Bloodworm</td>
			<td>local distributor</td>
			<td></td>
			<td>Poseidon Aquakultur Germany</td>
		</tr>
		<tr>
			<td>dNTPs solution mix</td>
			<td>Biolabs</td>
			<td>N04472</td>
			<td>10mM</td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>5U/uL</td>
		</tr>
		<tr>
			<td>PCR 10x Buffer</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Invitrogen</td>
			<td>18038-042</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>NaOH</td>
			<td>Sigma- Aldrich</td>
			<td>S8045-500g</td>
			<td>50mM</td>
		</tr>
		<tr>
			<td>Tris-HCl, pH=8.0 solution</td>
			<td>Sigma- Aldrich</td>
			<td>T2694-1L</td>
			<td>1M</td>
		</tr>
		<tr>
			<td>HCl 37%</td>
			<td>Sigma- Aldrich</td>
			<td>H1758-500mL</td>
			<td></td>
		</tr>
		<tr>
			<td>Aquatic housing system</td>
			<td>Aquaneering</td>
			<td></td>
			<td>Central filtration equipped aquatic system</td>
		</tr>
		<tr>
			<td>Fish tanks</td>
			<td>Aquaneering</td>
			<td></td>
			<td>volume: 0.8L, 2.8L, 9.5L; equipped with baffles, fry mesh and lids</td>
		</tr>
		<tr>
			<td>Orbital shaker</td>
			<td>VWR</td>
			<td>89032-100</td>
			<td>model 5000</td>
		</tr>
		<tr>
			<td>Microbiological incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>50125882</td>
			<td>model IMC18; for storage embryos in the liquid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Cooling Incubator</td>
			<td>Binder</td>
			<td>9020-0209</td>
			<td>model KT115; for storage embryos in the solid phase, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Hatching incubator</td>
			<td>Thermo Scientific, Heratherm</td>
			<td>51028114</td>
			<td>model OGS180; for embryos hatching, set to t=27-28&#176;C</td>
		</tr>
		<tr>
			<td>Stereomicroscope</td>
			<td>Leica</td>
			<td></td>
			<td>model M80</td>
		</tr>
		<tr>
			<td>Breeding sand/hatching boxes</td>
			<td>Roth</td>
			<td>1598.1</td>
			<td>1000mL</td>
		</tr>
		<tr>
			<td>Petri dish</td>
			<td>Sarstedt</td>
			<td>82.1473</td>
			<td>92x16mm</td>
		</tr>
		<tr>
			<td>50mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.547.254</td>
			<td></td>
		</tr>
		<tr>
			<td>15mL Conical tube</td>
			<td>Sarstedt</td>
			<td>62.554.002</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable Plastic Pasteur pipette</td>
			<td>Roth</td>
			<td>EA71.1</td>
			<td>2mL; For fish feeding with bloodworms, or embryos selection cut off the tip to open 3-4mm diameter</td>
		</tr>
		<tr>
			<td>Serological pipette</td>
			<td>Sarstedt</td>
			<td>86.1689.001</td>
			<td>50mL</td>
		</tr>
		<tr>
			<td>Syringe</td>
			<td>Henke Sass Wolf</td>
			<td>4100-000V0</td>
			<td>10mL</td>
		</tr>
		<tr>
			<td>Metal strainer</td>
			<td></td>
			<td></td>
			<td>fineness &#60;1mm; for embryos collection</td>
		</tr>
		<tr>
			<td>Tweezers</td>
			<td>Dumont</td>
			<td>0508-5/45-PO</td>
			<td>type5/45; for embryos transfer</td>
		</tr>
		<tr>
			<td>25L Brine shrimps hatcher</td>
			<td>Aquaneering</td>
			<td>ZHBS25</td>
			<td>main hatcher</td>
		</tr>
		<tr>
			<td>500mL Brine shrimps hatcher</td>
			<td>JBL</td>
			<td>6106100</td>
			<td>model Artemio 1; backuo hatcher</td>
		</tr>
		<tr>
			<td>Narrow-mesh fish nets</td>
			<td>JBL</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Sand beaker</td>
			<td>VWR</td>
			<td>BURK7102-5000</td>
			<td>5000mL</td>
		</tr>
		<tr>
			<td>Brine shrimps separation beaker</td>
			<td>VWR</td>
			<td>BURK7102-2000</td>
			<td>2000mL</td>
		</tr>
		<tr>
			<td>Plastic zipper bag</td>
			<td>Roth</td>
			<td>P279.2</td>
			<td>for dead fish storage</td>
		</tr>
		<tr>
			<td>Pipetboy</td>
			<td>Integra</td>
			<td>155000</td>
			<td>model Pipetboy acu2</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>P-Lab</td>
			<td>P701605</td>
			<td></td>
		</tr>
		<tr>
			<td>Air tubing</td>
			<td>www.zajac.de</td>
			<td>AQ380</td>
			<td>4-6 mm diameter</td>
		</tr>
		<tr>
			<td>1L Glass bottle</td>
			<td>VWR</td>
			<td>215-1595</td>
			<td></td>
		</tr>
		<tr>
			<td>2L Glass bottle</td>
			<td>VWR</td>
			<td>215-1596</td>
			<td></td>
		</tr>
		<tr>
			<td>500mL Squeeze bottle</td>
			<td>Roth</td>
			<td>K665.1</td>
			<td>for fish feeding with brine shrimps</td>
		</tr>
		<tr>
			<td>120 micron brine shrimps strainer</td>
			<td>Florida Aqua Farms</td>
			<td>BB-PC2</td>
			<td>for brine shrimps/bloodworm collection</td>
		</tr>
		<tr>
			<td>Finish filter socks</td>
			<td>Aquaneering</td>
			<td>MFVB025C</td>
			<td>25 micron</td>
		</tr>
		<tr>
			<td>Central filtration fish housing system</td>
			<td></td>
			<td></td>
			<td>Aquaneering, Techniplast, Aquatic Habitats, Aqua Schwarz</td>
		</tr>
	</tbody>
</table>

a protocol for laboratory housing of turquoise killifish (nothobranchius furzeri)

실험적인 목적을 위해 사용 하는 비 모델 실험실 물고기에서 농업 관행의 개발은 크게 혜택 참조 물고기의 설립에서 모델 시스템, 제 브라와 메 다카. 최근 몇 년 동안, 신흥 물고기-청록색 송사리 (Nothobranchius furzeri)-노화와 생태의 생물학의 분야에서 연구 그룹의 성장 수에 의해 채택 되었습니다. 4-8 개월의 포로 생활 스팬,이 종 감 금에서 발생 하는 shortest-lived 척추 이며 노화 속도와 수명이 변경으로 이어질 수 있는--짧은 시간에에서 테스트 실험 개입을 과학적으로 지역 사회를 수 있습니다. 이 종, 미 발달 diapause, 특징의 독특한 생물학 주어 폭발적인 성적 성숙, 표시 형태학과 행동 성적인이 형태 성-그리고 그들의 상대적으로 짧은 성인 수명- 임시 농업 관행은 긴급 수요입니다. 이 프로토콜 허용 최적의 청록색 송사리 실험실 관리, 강력한 실험실 동물 모델로이 종 채택 하 사회 과학을 사용 하는 주요 축산 측정값 집합을 보고 합니다.

청록색 송사리 적절 한 농업 메디아 생존 GRZ 변형 (예: 그림 4A)에 12-18 주 사이에 발생 합니다. 메디아 생존의 다이어트, 주파수, 수 유 및 주택 온도 조건에 따라 달라 집니다. 불 쌍 한 축산 결과 제시 하는 생존 곡선에서 초기 사망률 및 반복, 갑자기 여러 굴절 포인트 (그림 4B) 특징, 시간에 걸쳐 생존의 증가.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57073/57073fig1.jpg"> 그림 1: 각 인큐베이션 기판 대표 배아 발달 단계. (A) 갓 배아, 28 ° c.에 인큐베이터에서 메 틸 렌 블루 솔루션에서 incubated 수집 (B) 고체 매체를 전송할 준비가 배아 중 종이 또는 코코넛 섬유 필터. (C) 배아 준비가 해치 할 일반적인 황금 홍 채를 표시 합니다. 눈금 막대는 1 mm.에 <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57073/57073fig2.jpg"> 그림 2: 청록색 송사리 후 부 화 개발의 단계. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57073/57073fig3.jpg"> 그림 3: 3 단계 이후에서 물고기에 대 한 대표적인 물고기 ID 태그. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57073/57073fig4.jpg"> 그림 4: 70 남성 청록색 송사리에 대 한 대표적인 생존 곡선. (A) 실험실 제기 청록색 송사리에 대 한 일반적인 생존 곡선. (B) 생존 곡선의 비교는 최적의 농업 조건 (블랙)에서 발생 하는 물고기에서 얻은 고 가난한 농업 (빨간색과 파란색). 수평 빨간색 파선 50% 생존, 평균 수명 (x 축에 표시)에 교차 생존 곡선을 나타냅니다. <a href="https://cloudflare.jove.com/files/ftp_upload/57073/57073fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>ID</td>
			<td colspan="2">앞으로 뇌관</td>
			<td colspan="2">반전 뇌관</td>
			<td>크기 범위 (bp)</td>
		</tr>
<tr>
<td>* NfuSU0007</td>
			<td colspan="2">GGCTAAGCCTTGCTGACAGA</td>
			<td colspan="2">CAGGGAGCTGAAAACCTCAG</td>
			<td>166-214</td>
		</tr>
<tr>
<td>* NfuSU0010</td>
			<td colspan="2">CGCAGTCTGATCAAATCGTGT</td>
			<td colspan="2">TGTTTGAAGGTTCACATTCATTATC</td>
			<td>220-272</td>
		</tr>
<tr>
<td>NfuSU0016</td>
			<td colspan="2">CATGGCTAAACCGTGATGAA</td>
			<td colspan="2">GAAGGACGCCAGCTATGAAG</td>
			<td>209-240</td>
		</tr>
<tr>
<td>NfuSU0022</td>
			<td colspan="2">AACACAGCTCTCGTAAGGAGGTA</td>
			<td colspan="2">TTCAGACTTGTCTTACTACCATGTTT</td>
			<td>198-238</td>
		</tr>
<tr>
<td>NfuSU0027</td>
			<td colspan="2">TCCAGCTGAATCGGTAATGA</td>
			<td colspan="2">AAACTCGAGGGTGCAATCTG</td>
			<td>164-226</td>
		</tr>
<tr>
<td>NfuSU0049</td>
			<td colspan="2">CTGGACAAAGTGCCAATCAC</td>
			<td colspan="2">CTCCCACAGTCCCAAAACAT</td>
			<td>196-197</td>
		</tr>
<tr>
<td>NfuSU0050</td>
			<td colspan="2">CCAGAATGAACAATACTCAGATCAA</td>
			<td colspan="2">GCAGCTTAGTTTAATGATATCACAATG</td>
			<td>252-295</td>
		</tr>
<tr>
<td>NfuSU0060</td>
			<td colspan="2">CTAGCCACTCCCCTGGTTTA</td>
			<td colspan="2">CCGTCACGATGTGCTGATAC</td>
			<td>216-248</td>
		</tr>
<tr>
<td>NfuFLI0030</td>
			<td colspan="2">CAGAAGCTAAAGGCCAGACG</td>
			<td colspan="2">GGGAAACAATAGGGAACCAC</td>
			<td>174-205</td>
		</tr>
<tr>
<td>* NfuFLI0091</td>
			<td colspan="2">ACGCTGACTCTACCCAGTC</td>
			<td colspan="2">CTGCCTGCTACTGACAATG</td>
			<td>355-373</td>
		</tr>
<tr>
<td colspan="6">*-섹스 결정 마커</td>
		</tr>
</tbody></table>표 1: 스트레인 식별 유전형 뇌관입니다.

Watch this Scientific Journal Video about A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri at JoVE.com

A Protocol for Laboratory Housing of Turquoise Killifish Nothobranchius furzeri

실험실 주택 터키석 송사리 집 고 효율적으로 개별 물고기의 수천 고용 표준 zebrafish 시설에 사용 하는 동일한 인프라는 중앙 집중식된 물 여과 시스템에서 확장할 수 있습니다. 여기 우리가 유지 보수 효율적 송사리 수 있도록 표준화 된 절차의 목록을 자세하게.

실험실 주택의 청록색 송사리 (Nothobranchius furzeri)에 대 한 프로토콜

The development of husbandry practices in non-model laboratory fish used for experimental purposes has greatly benefited from the establishment of ...

Research

JoVE Journal

Biology

A Protocol for Laboratory Housing of Turquoise Killifish (Nothobranchius furzeri)

Protocol for Mosquito Rearing (A. gambiae)

Protocol for Mosquito Rearing A. gambiae

모스키토 리어링 (A. gambiae)에 대한 프로토콜

This protocol describes mosquito rearing in the insectary. The insectary rooms are maintained at 28&deg;C and ~80% humidity, with a 12 hr. day/night ...

연구

생물학

Neutrophil Isolation Protocol

호중구 격리 프로토콜

Neutrophil polymorphonuclear granulocytes (PMN) are the most abundant leukocytes in humans and among the first cells to arrive on the site of inflammatory ...

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia (SCG)

Protocol for Culturing Sympathetic Neurons from Rat Superior Cervical Ganglia SCG

쥐 우수한 자궁암 신경 (SCG)에서 Culturing 교감 신경에 대한 프로토콜

The superior cervical ganglia (SCG) in rats are small, glossy, almond-shaped structures that contain sympathetic neurons.  These neurons provide ...

A Protocol for the Production of KLRG1 Tetramer

KLRG1 Tetramer의 생산을위한 프로토콜

Killer cell lectin-like receptor G1 (KLRG1) is a type II transmembrane glycoprotein inhibitory receptor belonging to the C type lectin-like superfamily. ...

A Protocol for Computer-Based Protein Structure and Function Prediction

컴퓨터 기반의 단백질 구조 및 기능 예측을위한 프로토콜

Genome sequencing projects have ciphered millions of protein sequence, which require knowledge of their structure and function to improve the ...

Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction

Regular Care and Maintenance of a Zebrafish Danio rerio Laboratory: An Introduction

Zebrafish의 일반 관리 및 유지 관리 (<em&gt; Danio rerio</em&gt;) 실험실 : 소개

This protocol describes regular care and maintenance of a zebrafish laboratory. Zebrafish are now gaining popularity in genetics, pharmacological and ...

A Protocol for Phage Display and Affinity Selection Using Recombinant Protein Baits

재조합 단백질의 미끼를 사용 파지 디스플레이와 궁합 선택을위한 프로토콜

Using  recombinant phage as a scaffold to present various protein portions encoded by  a directionally cloned cDNA library to immobilized bait molecules ...

SIVQ-LCM Protocol for the ArcturusXT Instrument

ArcturusXT 악기 SIVQ-LCM 프로토콜

SIVQ-LCM is a new methodology that automates and streamlines the more traditional, user-dependent laser dissection process.&#160;It aims to create an ...

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers

Macroinvertebrates 사용 하 여 그룹별 수생 rDNA 뇌관의 유전 직감 콘텐츠 분석을 위한 실험실 프로토콜

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the ...

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

무척 추 동물 모델 시스템으로 독성 테스트 실험실에서 초파리 를 사용 하 여 실험 프로토콜

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ...