Name: visualization of cellular electrical activity in zebrafish early embryos and tumors
Uploaded: 2018-04-25T14:00:00
Description: Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Het onderzoekswerk gemeld in deze publicatie werd gesteund door de National Institute of General Medical Sciences van de National Institutes of Health onder de Award nummer R35GM124913, Purdue University PI4D incentive programma en PVM interne concurrerende Basisonderzoek fondsen programma. De inhoud is uitsluitend de verantwoordelijkheid van de auteurs en vertegenwoordigt niet noodzakelijk de officiële standpunten van de financiering agenten. Wij danken Koichi Kawakami voor de Tol2 constructie, Michael Lin voor constructie voor de ASAP1 en Leonard Zon voor de ubi -promotor bouwen via Addgene.

De zebravis zijn gehuisvest in een AAALAC-goedgekeurd dier faciliteit, en alle experimenten werden uitgevoerd volgens de protocollen die zijn goedgekeurd door de Purdue Animal Care en gebruik Comité (PACUC).
1. Tol2 Transposon plasmide Construct voorbereiding
Opmerking: Tol2, een transposon die werd ontdekt in medaka, vis is wijd gebruikt in de zebravis onderzoek Gemeenschap8,9. Het is met succes aangenomen o...

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

Hoewel de cellulaire en weefsel niveau elektrische activiteiten tijdens de embryonale ontwikkeling en ziekten bij de mens lang geleden ontdekt waren, nog de in vivo dynamische elektrische veranderingen en hun biologische rollen grotendeels onbekend. Een van de grootste uitdagingen is het visualiseren en kwantificeren van de elektrische veranderingen. Patch-clamp-technologie is een doorbraak voor het bijhouden van afzonderlijke cellen, maar de toepassing ervan op gewervelde embryo's is beperkt, omdat ze samengest...

Bioelectriciteit verwijst naar het endogene elektrische signalering gemedieerd door ionenkanalen en pompen, gelegen op de celmembraan1. Ionische exchanges over de cellulaire membraan, en de gekoppelde elektrische potentiële en huidige wijzigingen, zijn essentieel voor de signalering van processen van prikkelbaar neuronale en motorische cellen. Bovendien, hebben bioelectriciteit en ion verlopen allerlei andere belangrijke biologische functies zoals energieopslag, biosynthese en transport metaboliet. Bioelectrische signalen werd ook ontdekt als een regulator van embryonale patroonformatie, zoals lichaam assen, de celcyclus en cel differentiatie1. Het is dus cruciaal voor het begrip van vele aangeboren ziekten bij de mens die uit de verkeerde regulering van dit type van signalering voortvloeien. Hoewel patch-clamp wijd verbeid gebruikt is voor het opnemen van de afzonderlijke cellen, is het nog steeds verre van ideaal voor de gelijktijdige bewaking van meerdere cellen tijdens de embryonale ontwikkeling in vivo. Spanning gevoelige kleine moleculen zijn bovendien ook niet ideaal voor in vivo toepassingen als gevolg van hun specifieke kenmerken, gevoeligheden en toxicities.
De oprichting van een verscheidenheid van genetisch gecodeerd fluorescerende spanning indicatoren (GEVIs) biedt een nieuw mechanisme om deze kwestie te overwinnen, en zorgt voor gemakkelijke toepassing te bestuderen van de embryonale ontwikkeling, hoewel zij oorspronkelijk waren bedoeld voor het toezicht op neurale cellen2,3. Een van de momenteel beschikbare GEVIs is de versnelde Sensor van actie Potentials 1 (ASAP1)4. Het is samengesteld uit een extracellulaire lus van een spanning-sensing domein van spanning gevoelige fosfatase en een circulair permuted groen fluorescent proteïne. Daarom, ASAP1 kunt visualisatie van cellulaire elektrische potentiële veranderingen (polarisatie: heldergroen; depolarisatie: donkergroen). ASAP1 heeft 2 ms op-en-off kinetiek en subthreshold potentiële verandering4kunt bijhouden. Dus, deze genetische tool zorgt voor een nieuw niveau van werkzaamheid in real-time bioelectrische bewaking in levende cellen. Verder begrip van de rol van bioelectriciteit in de embryonale ontwikkeling en vele menselijke ziekten, zoals kanker, zal nieuwe licht werpen op de onderliggende mechanismen, die is van cruciaal belang voor de behandeling van de ziekte en preventie.
Zebravis hebben bewezen een krachtige diermodel ontwikkelingsbiologie en menselijke ziekten waaronder kanker5,6te gaan studeren. Zij 70% orthologous genen delen met mensen, en ze hebben soortgelijke gewervelde biologie7. Zebravis bieden relatief gemakkelijk te onderhouden, de grootte van een grote koppeling van eieren, hanteerbare genetica, gemakkelijk Transgenese en transparante externe embryonale ontwikkeling, waardoor ze een superieur systeem voor in vivo imaging5,6. Met een grote bron van mutant vis lijnen al aanwezig en een volledig gesequenceerd genoom zorgt zebravis voor een relatief onbeperkt scala aan wetenschappelijke ontdekking.
Om te onderzoeken de in vivo real-time elektrische activiteit van cellen, profiteren we van de zebravis modelsysteem en ASAP1. In deze paper, we beschrijven hoe de fluorescerende spanning biosensor ASAP1 geïntegreerd in het genoom van de zebravis met behulp van Tol2 transposon Transgenese en visualiseren van cellulaire elektrische activiteit tijdens de embryonale ontwikkeling, vis larvale beweging, en in levende tumor .

<table>
	<tbody>
		<tr>
			<td>14mL cell culture tubes</td>
			<td>VWR</td>
			<td>60818-725</td>
			<td>E.Coli culture</td>
		</tr>
		<tr>
			<td>Agarose electrophoresis tank</td>
			<td>Thermo Scientific</td>
			<td>Owl B2</td>
			<td>DNA eletrophoresis</td>
		</tr>
		<tr>
			<td>Agarose RA</td>
			<td>Amresco</td>
			<td>N605-500G</td>
			<td>For making the injection gels</td>
		</tr>
		<tr>
			<td>Attb1-ASAP1-F primer</td>
			<td>IDT DNA</td>
			<td>GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGACGACTGTGAGGTATGAACA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Attb2-ASAP1-R primer</td>
			<td>IDT DNA</td>
			<td>GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGGTTACCACTTCAAGTTGTTTCTTCTGTGAAGCCA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Bright field dissection scope</td>
			<td>Nikon</td>
			<td>SMZ 745</td>
			<td>Dechorionation, microinjection, mounting</td>
		</tr>
		<tr>
			<td>Color camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRc</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Concave slide</td>
			<td>VWR</td>
			<td>48336-001</td>
			<td>For holding fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>Disposable transfer pipette 3.4 ml</td>
			<td>Thermo Scientific</td>
			<td>13-711-9AM</td>
			<td>Fish embryos and water transfer</td>
		</tr>
		<tr>
			<td>Endonuclease enzyme, Not I</td>
			<td>NEB</td>
			<td>R0189L</td>
			<td>For linearizing plasmid DNA</td>
		</tr>
		<tr>
			<td>Epifuorescent compound scope</td>
			<td>Zeiss</td>
			<td>Axio Imager.A2</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Epifuorescent stereo dissection scope</td>
			<td>Zeiss</td>
			<td>Stereo Discovery.V12</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Fluorescent light source</td>
			<td>Lumen dynamics</td>
			<td>X-cite seris 120</td>
			<td>Light source for fluorescence microscopes</td>
		</tr>
		<tr>
			<td>Forceps #5</td>
			<td>WPI</td>
			<td>500342</td>
			<td>Dechorionation and needle breaking</td>
		</tr>
		<tr>
			<td>Gateway BP Clonase II Enzyme mix</td>
			<td>Thermo Scientific</td>
			<td>11789020</td>
			<td>Gateway BP recombination cloning</td>
		</tr>
		<tr>
			<td>Gateway LR Clonase II Plus enzyme</td>
			<td>Thermo Scientific</td>
			<td>12538120</td>
			<td>Gateway LR recombination cloning</td>
		</tr>
		<tr>
			<td>Gel DNA Recovery Kit</td>
			<td>Zymo Research</td>
			<td>D4002</td>
			<td>DNA gel purification</td>
		</tr>
		<tr>
			<td>Loading tip</td>
			<td>Eppendorf</td>
			<td>930001007</td>
			<td>For loading injection solution into capilary needles</td>
		</tr>
		<tr>
			<td>Methylcellulose (1600cPs)</td>
			<td>Alfa Aesar</td>
			<td>43146</td>
			<td>Fish embryo mounting</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Sigma-Aldrich</td>
			<td>M9140</td>
			<td>Suppresses fungal outbreaks in Petri dishes</td>
		</tr>
		<tr>
			<td>Microinjection mold</td>
			<td>Adaptive Science Tools</td>
			<td>TU-1</td>
			<td>To prepare agaorse mold tray for holding fish embryos during injection</td>
		</tr>
		<tr>
			<td>Microinjector</td>
			<td>WPI</td>
			<td>Pneumatic Picopump PV820</td>
			<td>Microinjection injector</td>
		</tr>
		<tr>
			<td>Micro-manipulator</td>
			<td>WPI</td>
			<td>Microinjector mm33 rechts</td>
			<td>Microinjection operation</td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Sutter instrument</td>
			<td>P-1000</td>
			<td>For preparing capillary needle</td>
		</tr>
		<tr>
			<td>Mineral oil</td>
			<td>Amresco</td>
			<td>J217-500ml</td>
			<td>For calibrating injection volume</td>
		</tr>
		<tr>
			<td>mMESSAGE mMACHINE SP6 Transcription Kit</td>
			<td>Thermo Scientific</td>
			<td>AM1340</td>
			<td>mRNA in vitro transcription</td>
		</tr>
		<tr>
			<td>Monocolor camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRm</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4020</td>
			<td>Prepare small amount of plasmid DNA</td>
		</tr>
		<tr>
			<td>Plastic Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td>For holding fish or fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>RNA Clean &#38; Concentrator-5</td>
			<td>Zymo Research</td>
			<td>R1015</td>
			<td>mRNA cleaning after in vitro transcription</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>NanoDrop 2000</td>
			<td>For measuring DNA and RNA concentrations</td>
		</tr>
		<tr>
			<td>Stage Micrometer</td>
			<td>Am Scope</td>
			<td>MR100</td>
			<td>Microinjection volume calibration</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>Bio-Rad</td>
			<td>T100</td>
			<td>DNA amplification for gene cloning</td>
		</tr>
		<tr>
			<td>Thin wall glass capillaries</td>
			<td>WPI</td>
			<td>TW100F-4</td>
			<td>Raw glass for making cappilary needle</td>
		</tr>
		<tr>
			<td>Tol2-exL1 primer</td>
			<td>IDT DNA</td>
			<td>GCACAACACCAGAAATGCCCTC</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>Tol2-exR primer</td>
			<td>IDT DNA</td>
			<td>ACCCTCACTAAAGGGAACAAAAG</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>TOP10 Chemically Competent E. coli</td>
			<td>Thermo Scientific</td>
			<td>C404006</td>
			<td>Used for transformation during gene cloning</td>
		</tr>
		<tr>
			<td>Tricaine mesylate</td>
			<td>Sigma-Aldrich</td>
			<td>A5040</td>
			<td>For anesthetizing fish or fish embryos</td>
		</tr>
		<tr>
			<td>UV trans-illuminator 302nm</td>
			<td>UVP</td>
			<td>M-20V</td>
			<td>DNA visualization</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Thermo Scientific</td>
			<td>2853</td>
			<td>For transformation process of gene cloning</td>
		</tr>
	</tbody>
</table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

Bioelectriciteit, endogene elektrische signalering gemedieerd door ionenkanalen en pompen gelegen op de celmembraan, speelt belangrijke rol in het signaleren van processen van prikkelbaar neuronale en motorische cellen en vele andere biologische processen, zoals embryonale Developmental patronen. Er is echter behoefte aan een in vivo elektrische Activiteitencontrole in gewervelde embryogenese. De voorschotten van genetisch gecodeerde fluorescerende spanningsindicatoren (GEVIs) hebben het mogelijk gemaakt te bieden een oplossing voor deze uitdaging. Hier beschrijven we hoe maak je een transgene voltage indicator zebrafish met behulp van de gevestigde voltage-indicator, ASAP1 (versnelde Sensor van actie Potentials 1), als voorbeeld. De Tol2 kit en een promotor van de alomtegenwoordige zebrafish, ubi, werden gekozen in deze studie. We leggen ook de processen van Gateway site-specific klonen, Tol2 transposon gebaseerde zebrafish Transgenese en de procedure voor beginnende vis embryo's en vis tumoren met behulp van reguliere epifluorescerende microscopen. Met behulp van deze vis lijn, vonden wij dat er veranderingen van cellulaire elektrische spanning tijdens de embryogenese van zebravis en vis larvale beweging. Bovendien werd naar voren gebracht dat in een paar zebrafish maligne perifere zenuw schede tumoren, de tumor cellen waren over het algemeen gepolariseerde ten opzichte van het omliggende normale weefsel.

In een succesvolle injectie, meer dan 50% geïnjecteerd vis embryo's verschijnt een zekere mate van groene fluorescentie in de lichaamscellen, maar de meeste van hen zullen positief door Tol2 transposon accijnzen assay (Figuur 2). Na 2-4 generaties van uitgaande kruis met wildtype vis (totdat de fluorescerende vis 50 procent, de verwachte Mendelian verhouding tot), werden de transgene vis gebruikt voor de beeldvorming experiment om bij te houden van de celmem...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Visualisatie van cellulaire elektrische activiteit in de zebravis vroege embryo's en tumoren

Hier, laten we het proces van het creëren van een cellulaire elektrische spanning verslaggever zebrafish lijn om te visualiseren van embryonale ontwikkeling, beweging, en vis tumor cellen in vivo.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

Research

JoVE Journal

Developmental Biology

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion (FDAP)

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion FDAP

Meten Eiwit Stabiliteit in Living zebravis embryo&#39;s met behulp van fluorescentie Decay Na Photoconversion (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological ...

Mechanical Vessel Injury in Zebrafish Embryos

Mechanische vatverwonding in zebravis embryo&#39;s

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes.  External development ...

Loss- and Gain-of-function Approach to Investigate Early Cell Fate Determinants in Preimplantation Mouse Embryos

Verlies- en Gain-of-function Aanpak Early Cell Fate Determinanten Onderzoek in Pre-implantatie muizenembryo&#39;s

 Gene silencing and overexpression techniques are instrumental for the identification of genes involved in embryonic development. Direct target gene ...

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Transcriptome Profilering van<em&gt; In-Vivo</em&gt; Geproduceerd Bovine Pre-implantatie embryo&#39;s met behulp van twee-kleuren Microarray Platform

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo ...

Isolation and Characterization of Single Cells from Zebrafish Embryos

Isolatie en karakterisering van enkele cellen van zebravis embryo&#39;s

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

Biosensing Motor Neuron Membraan Potentieel in Live Zebrafish Embryo&#39;s

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Inductie van hypoxie in levende kikker en zebravis embryo&#39;s

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Multi-Photon Time Lapse Imaging to Visualize Development in Real-time: Visualization of Migrating Neural Crest Cells in Zebrafish Embryos

Multi foton Time Lapse Imaging te visualiseren van ontwikkeling in realtime: visualisatie van migreren neurale kamcellen in Zebrafish embryo's

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

Visualiseren van het knooppunt en de Notochordal plaat In Gastrulating muis embryo's met behulp van Scanning elektronen microscopie en hele Mount immunofluorescentie

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Whole Mount Immunohistochemistry in Zebrafish Embryos and Larvae

Hele mount immunohistochemie in zebravissen embryo's en larven

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. ...