Name: visualization of cellular electrical activity in zebrafish early embryos and tumors
Uploaded: 2018-04-25T14:00:00
Description: Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

עבודות המחקר דיווח בפרסום זה נתמך על ידי הלאומית המכון כללי רפואי למדעים של מכוני הבריאות הלאומיים תחת פרס מספר R35GM124913 PI4D מאוניברסיטת Purdue תמריץ התוכנית, PVM פנימי תחרותי תוכנית קרנות מחקר בסיסי. התוכן הוא אך ורק באחריות המחברים, ואינם מייצגים בהכרח את הנופים הרשמי של הסוכנים מימון. אנו מודים קואיצ'י Kawakami על Tol2 הבונה, מייקל לין עבור הבונה ASAP1, ולבנות לאונרד Zon ייצוג המקדם ubi דרך Addgene.

דג זברה מוחזקים במתקן בעל חיים שאושרו על-ידי AAALAC, כל הניסויים בוצעו לפי הפרוטוקולים אושרה על ידי טיפול בעלי חיים פרדו שימוש הוועדה (PACUC).
1. Tol2 Transposon פלסמיד לבנות הכנה
הערה: Tol2, transposon שנתגלה בשנת medaka דגים, נרחב שימש ב8,9קהילת המחקר דג...

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

למרות הפעילות חשמל רמת הסלולר ורקמות במהלך התפתחות מחלות אנושיות התגלו לפני זמן רב, אין ויוו חשמל השינויים הדינמיים ותפקידיהם ביולוגי נותרו עדיין אינו מודע לקיומם. אחד האתגרים הגדולים הוא להמחיש ולכמת את השינויים חשמל. תיקון קלאמפ טכנולוגיה פריצת דרך עבור מעקב אחר תאים בודדים, אך את ...

ביו מתייחס אנדוגני איתות חשמלי מתווך על ידי תעלות יונים ומשאבות ממוקם על קרום התא1. חילופי יוניים על פני הממברנה התאית, והשינויים בשילוב חשמל פוטנציאלית ועדכניים, חיוניים עבור איתות תהליכים של טמפרמנט תאים עצביים ושרירי. בנוסף, ביו ומעברי יון יש מגוון רחב של תפקודים ביולוגיים חשובים אחרים כולל אחסון אנרגיה, ביוסינטזה של המטבוליט תחבורה. איתות הביו-חשמליות התגלה גם כרגולטור של היווצרות תבנית עובריים, כגון צירים הגוף, מחזור התא, תא בידול1. לפיכך, חיוני להבנת מחלות מולדות אנושיים רבים הנובעים התקנה שגויה של סוג זה של איתות. למרות מלחציים תיקון כבר בשימוש נרחב עבור הקלטה תאים בודדים, הוא עדיין רחוק מלהיות אידיאלי בו זמנית פיקוח על תאים מרובים במהלך התפתחות עובריים בתוך vivo. יתר על כן, מולקולות קטנות רגיש מתח אינם גם אידיאלי עבור יישומים ויוו שלהם specificities, רגישויות וכתוצאה רעילות.
היצירה של מגוון רחב של גנטית מקודד מתח פלורסנט אינדיקטורים (GEVIs) מציע מנגנון חדש כדי להתגבר על בעיה זו, והיא מאפשרת יישום קל ללמוד התפתחות עובריים, למרות שהם נועדו במקור עבור ניטור עצבית תאים2,3. אחד GEVIs זמין כעת הוא האצת חיישן של פוטנציאל פעולה 1 (ASAP1)4. הוא מורכב ללולאה חוץ-תאי של תחום חישה מתח של מתח פוספטאז רגיש, חלבון פלואורסצנטי ירוק permuted באופן מעגלי. לכן, ASAP1 מאפשר הדמיה של שינויים סלולריים פוטנציאל חשמלי (קיטוב: ירוק בהיר; דפולריזציה: ירוק כהה). ASAP1 יש 2 מילי-שניות על לסירוגין קינטיקה, ולא ניתן לעקוב אחר שינוי פוטנציאליים subthreshold4. לכן, כלי גנטי זה מאפשר רמה חדשה של יעילות ניטור בזמן אמת הקינטיות בתאים חיים. הבנה נוספת של התפקידים של ביו בתחום הפיתוח עובריים למחלות רבות, כגון סרטן, שופכים אור חדש על המנגנון הבסיסי, אשר הוא קריטי עבור מחלת טיפול ומניעה.
דג זברה הוכחו במודל בעלי חיים רב עוצמה ללמוד ביולוגיה התפתחותית ו האדם מחלות כולל סרטן5,6. הם חולקים גנים orthologous 70% עם בני אדם, ויש להם ביולוגיה חוליות דומות7. דג זברה מספקים טיפול קל יחסית, בגודל גדול מצמד של ביצים, גנטיקה צייתן, transgenesis קל ופיתוח שקופים חיצוני עובריים, ההופכים אותם מערכת מעולה עבור ויוו הדמיה5,6. עם מקור גדול של דגים מוטנטים קווים כבר נוכח, גנום מלא ברצף, דג זברה תספק מגוון מוגבל יחסית של תגלית מדעית.
כדי לחקור את ויוו בזמן אמת הפעילות החשמלית של תאים, עלינו לנצל של דג זברה מודל המערכת ASAP1. בנייר זה, אנו מתארים כיצד לשלב את החיישן מתח פלורסנט ASAP1 הגנום דג זברה באמצעות Tol2 transposon transgenesis, ותנסו לדמיין את הפעילות החשמלית הסלולר במהלך התפתחות, תנועה זחל דגים, ובבתי גידול בשידור חי .

<table>
	<tbody>
		<tr>
			<td>14mL cell culture tubes</td>
			<td>VWR</td>
			<td>60818-725</td>
			<td>E.Coli culture</td>
		</tr>
		<tr>
			<td>Agarose electrophoresis tank</td>
			<td>Thermo Scientific</td>
			<td>Owl B2</td>
			<td>DNA eletrophoresis</td>
		</tr>
		<tr>
			<td>Agarose RA</td>
			<td>Amresco</td>
			<td>N605-500G</td>
			<td>For making the injection gels</td>
		</tr>
		<tr>
			<td>Attb1-ASAP1-F primer</td>
			<td>IDT DNA</td>
			<td>GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGACGACTGTGAGGTATGAACA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Attb2-ASAP1-R primer</td>
			<td>IDT DNA</td>
			<td>GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGGTTACCACTTCAAGTTGTTTCTTCTGTGAAGCCA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Bright field dissection scope</td>
			<td>Nikon</td>
			<td>SMZ 745</td>
			<td>Dechorionation, microinjection, mounting</td>
		</tr>
		<tr>
			<td>Color camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRc</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Concave slide</td>
			<td>VWR</td>
			<td>48336-001</td>
			<td>For holding fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>Disposable transfer pipette 3.4 ml</td>
			<td>Thermo Scientific</td>
			<td>13-711-9AM</td>
			<td>Fish embryos and water transfer</td>
		</tr>
		<tr>
			<td>Endonuclease enzyme, Not I</td>
			<td>NEB</td>
			<td>R0189L</td>
			<td>For linearizing plasmid DNA</td>
		</tr>
		<tr>
			<td>Epifuorescent compound scope</td>
			<td>Zeiss</td>
			<td>Axio Imager.A2</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Epifuorescent stereo dissection scope</td>
			<td>Zeiss</td>
			<td>Stereo Discovery.V12</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Fluorescent light source</td>
			<td>Lumen dynamics</td>
			<td>X-cite seris 120</td>
			<td>Light source for fluorescence microscopes</td>
		</tr>
		<tr>
			<td>Forceps #5</td>
			<td>WPI</td>
			<td>500342</td>
			<td>Dechorionation and needle breaking</td>
		</tr>
		<tr>
			<td>Gateway BP Clonase II Enzyme mix</td>
			<td>Thermo Scientific</td>
			<td>11789020</td>
			<td>Gateway BP recombination cloning</td>
		</tr>
		<tr>
			<td>Gateway LR Clonase II Plus enzyme</td>
			<td>Thermo Scientific</td>
			<td>12538120</td>
			<td>Gateway LR recombination cloning</td>
		</tr>
		<tr>
			<td>Gel DNA Recovery Kit</td>
			<td>Zymo Research</td>
			<td>D4002</td>
			<td>DNA gel purification</td>
		</tr>
		<tr>
			<td>Loading tip</td>
			<td>Eppendorf</td>
			<td>930001007</td>
			<td>For loading injection solution into capilary needles</td>
		</tr>
		<tr>
			<td>Methylcellulose (1600cPs)</td>
			<td>Alfa Aesar</td>
			<td>43146</td>
			<td>Fish embryo mounting</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Sigma-Aldrich</td>
			<td>M9140</td>
			<td>Suppresses fungal outbreaks in Petri dishes</td>
		</tr>
		<tr>
			<td>Microinjection mold</td>
			<td>Adaptive Science Tools</td>
			<td>TU-1</td>
			<td>To prepare agaorse mold tray for holding fish embryos during injection</td>
		</tr>
		<tr>
			<td>Microinjector</td>
			<td>WPI</td>
			<td>Pneumatic Picopump PV820</td>
			<td>Microinjection injector</td>
		</tr>
		<tr>
			<td>Micro-manipulator</td>
			<td>WPI</td>
			<td>Microinjector mm33 rechts</td>
			<td>Microinjection operation</td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Sutter instrument</td>
			<td>P-1000</td>
			<td>For preparing capillary needle</td>
		</tr>
		<tr>
			<td>Mineral oil</td>
			<td>Amresco</td>
			<td>J217-500ml</td>
			<td>For calibrating injection volume</td>
		</tr>
		<tr>
			<td>mMESSAGE mMACHINE SP6 Transcription Kit</td>
			<td>Thermo Scientific</td>
			<td>AM1340</td>
			<td>mRNA in vitro transcription</td>
		</tr>
		<tr>
			<td>Monocolor camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRm</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4020</td>
			<td>Prepare small amount of plasmid DNA</td>
		</tr>
		<tr>
			<td>Plastic Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td>For holding fish or fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>RNA Clean &#38; Concentrator-5</td>
			<td>Zymo Research</td>
			<td>R1015</td>
			<td>mRNA cleaning after in vitro transcription</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>NanoDrop 2000</td>
			<td>For measuring DNA and RNA concentrations</td>
		</tr>
		<tr>
			<td>Stage Micrometer</td>
			<td>Am Scope</td>
			<td>MR100</td>
			<td>Microinjection volume calibration</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>Bio-Rad</td>
			<td>T100</td>
			<td>DNA amplification for gene cloning</td>
		</tr>
		<tr>
			<td>Thin wall glass capillaries</td>
			<td>WPI</td>
			<td>TW100F-4</td>
			<td>Raw glass for making cappilary needle</td>
		</tr>
		<tr>
			<td>Tol2-exL1 primer</td>
			<td>IDT DNA</td>
			<td>GCACAACACCAGAAATGCCCTC</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>Tol2-exR primer</td>
			<td>IDT DNA</td>
			<td>ACCCTCACTAAAGGGAACAAAAG</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>TOP10 Chemically Competent E. coli</td>
			<td>Thermo Scientific</td>
			<td>C404006</td>
			<td>Used for transformation during gene cloning</td>
		</tr>
		<tr>
			<td>Tricaine mesylate</td>
			<td>Sigma-Aldrich</td>
			<td>A5040</td>
			<td>For anesthetizing fish or fish embryos</td>
		</tr>
		<tr>
			<td>UV trans-illuminator 302nm</td>
			<td>UVP</td>
			<td>M-20V</td>
			<td>DNA visualization</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Thermo Scientific</td>
			<td>2853</td>
			<td>For transformation process of gene cloning</td>
		</tr>
	</tbody>
</table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

ביו, איתות חשמלי אנדוגני מתווך על ידי תעלות יונים, משאבות ממוקם על קרום התא, משחק תפקידים חשובים באיתות תהליכים של תאים עצביים ושרירי טמפרמנט של תהליכים ביולוגיים רבים אחרים, כגון עובריים המתבנת התפתחותית. עם זאת, יש צורך ויוו פעילות חשמלית מהפיקוח מופרה חוליות. ההתקדמות של מקודדים גנטית פלורסנט מחוני מתח (GEVIs) הפכו אותה ניתן לספק פתרון עבור האתגר הזה. כאן, אנו נתאר כיצד ליצור דג מחוון הטרנסגניים מתח באמצעות מחוון ויצר מתח, ASAP1 (האצת חיישן של פוטנציאל פעולה 1), כדוגמה. ערכת Tol2, מקדם דג זברה בכל מקום, ubi, נבחרו במחקר זה. נסביר גם את התהליכים של שיבוט בייעודי לאתר שער Tol2 דג זברה מבוסס-transposon transgenesis, את תהליך ההדמיה בשלב מוקדם דגים עוברי ודגים גידולים באמצעות מיקרוסקופ פלורסנטי רגיל. באמצעות קו דגים, מצאנו כי ישנם שינויים מתח חשמלי הסלולר במהלך דג זברה מופרה והתנועה זחל דגים. יתר על כן, זה היה ציין כי כמה דג זברה ממאיר במערכת העצבים ההיקפית נדן גידולים, הגידול התאים היו בדרך כלל מקוטב בהשוואה ל נורמלי הרקמות הסובבות.

בזריקה מוצלחת, יותר מ 50% מוזרק דגים עוברי יציג מידה מסוימת של זריחה ירוק בתאים סומטיים ולא רובם יהיה חיובי על-ידי Tol2 transposon בלו assay (איור 2). אחרי 2-4 דורות של יותר לחצות עם דגים wildtype (עד הדג פלורסנט מגיעים 50%, היחס Mendelian הצפוי), הדג הטרנסגניים שימשו הניסוי הדמיה כ?...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

ויזואליזציה של הפעילות החשמלית הסלולר עוברי מוקדם דג זברה, גידולים

כאן, אנו מראים את התהליך של יצירת קו דג זברה כתב מתח חשמלי הסלולר להמחיש את התפתחות, תנועה, דגים גידול תאים ויוו.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

Research

JoVE Journal

Developmental Biology

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion (FDAP)

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion FDAP

מדידת יציבות חלבון בחיים עוברי דג הזברה שימוש הקרינה רדיואקטיבית לאחר photoconversion (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological ...

Mechanical Vessel Injury in Zebrafish Embryos

פגיעה כלי מכאנית בעוברי דג הזברה

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes.  External development ...

Loss- and Gain-of-function Approach to Investigate Early Cell Fate Determinants in Preimplantation Mouse Embryos

Loss- ו-של-פונקצית רווח גישה לחקר תא מוקדם קובעי גורל preimplantation עכבר עובר

 Gene silencing and overexpression techniques are instrumental for the identification of genes involved in embryonic development. Direct target gene ...

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Transcriptome Profiling של<em&gt; In-Vivo</em&gt; עוברי אדם שור הופק באמצעות פלטפורמת microarray שני צבעים

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo ...

Isolation and Characterization of Single Cells from Zebrafish Embryos

בידוד ואפיון של תאים בודדים מעוברים דג הזברה

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

Biosensing מוטורית נוירון פוטנציאל ממברנה עוברי דג הזברה חיים

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

אינדוקציה של היפוקסיה צפרדע חיה דג הזברה עוברי

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Multi-Photon Time Lapse Imaging to Visualize Development in Real-time: Visualization of Migrating Neural Crest Cells in Zebrafish Embryos

פוטון רב זמן לשגות הדמיה כדי להמחיש את התפתחות בזמן אמת: ויזואליזציה של העברת תאי הרכס העצבי עוברי דג זברה

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

להמחיש את צומת ואת צלחת Notochordal Gastrulating עוברי העכבר באמצעות מיקרוסקופ אלקטרונים סריקה כל הר Immunofluorescence

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Whole Mount Immunohistochemistry in Zebrafish Embryos and Larvae

כל הר אימונוהיסטוכימיה בזיבפיש עוברים וזחלים

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. ...