Name: visualization of cellular electrical activity in zebrafish early embryos and tumors
Uploaded: 2018-04-25T14:00:00
Description: Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Научно-исследовательская работа в этой публикации было поддержано, Национальный институт Генеральной медицинских наук национальных институтов здоровья под награду номер R35GM124913, PI4D университет Purdue программы стимулирования и PVM внутренней конкуренции Программа фондов фундаментальных исследований. Содержание является исключительно ответственности авторов и не обязательно отражают официальную точку зрения финансирования агентов. Мы благодарим Коити Kawakami для Tol2 конструкции, Майкл Лин для ASAP1 конструкции, и Леонард Zon для ubi промоутер построить через Addgene.

Данио рерио размещаются в объекте животных АААЛЖ одобрил, и все эксперименты были проведены согласно протоколов, одобренных Purdue животное уход и использование Комитета (PACUC).
1. Tol2 Transposon плазмидные конструкции подготовка
Примечание: Tol2, transposon, которая была об?...

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

Хотя клеточные и тканевые деятельности на уровне электрические во время эмбрионального развития и болезней человека были обнаружены долгое время назад, в естественных условиях динамические электрические изменения и их биологической роли по-прежнему во многом неизвестным. Одна ?...

Шапкой относится к эндогенной электрической сигнализации при посредничестве ионных каналов и насосы расположены на клеточной мембраны1. Ионный обмен через клеточную мембрану и спаренных электрические потенциальных и текущих изменений, необходимы для сигнализации процессов возбудимых нейронов и мышечных клеток. Кроме того шапкой и градиентов ионов имеют целый ряд других важных биологических функций, включая хранение энергии, биосинтез и метаболит транспорт. Биоэлектрических сигналов был также обнаружен как регулятор формирования эмбриональных шаблон, например осей тела, клеточного цикла и дифференциации клеток1. Таким образом крайне важно для понимания многих врожденных заболеваний человека, которые в результате неправильного регулирования этого типа сигнализации. Хотя фиксации широко используется для записи одной клетки, это еще далеко не идеально подходит для одновременного контроля за несколько ячеек во время эмбрионального развития в естественных условиях. Кроме того чувствительных малые молекулы напряжения также не идеально подходит для приложений в естественных условиях из-за их особенностей, чувствительности и токсичность.
Создание целого ряда генетически кодировке напряжение люминесцентных индикаторов (Гевиш) предлагает новый механизм для преодоления этой проблемы и позволяет легко приложения для изучения эмбрионального развития, даже несмотря на то, что они были первоначально предназначены для мониторинга нейронных клетки2,3. Один из имеющихся в настоящее время Гевиш является ускоренное датчик потенциалы действия 1 (ASAP1)4. Он состоит из внеклеточная петля напряжения зондирования домена напряжения чувствительные фосфатазы и циркулярно перестановкой Зеленый флуоресцирующий белок. Таким образом, ASAP1 позволяет визуализировать сотовых электрическая потенциальных изменений (поляризации: ярко-зеленый цвет; деполяризации: темно-зеленый). ASAP1 имеет 2 мс вкл и Выкл кинетики и можно отслеживать подпорогового потенциальных изменений4. Таким образом этот генетический инструмент позволяет на новый уровень эффективности в биоэлектрические мониторинг в реальном времени в живых клетках. Углублению понимания роли шапкой в эмбриональном развитии и многих заболеваний человека, таких как рак, будет проливают новый свет на основных механизмов, который имеет решающее значение для профилактики и лечения заболеваний.
Данио рерио доказали мощный животных модель для изучения биологии развития и человеческих заболеваний, включая рак5,6. Они разделяют 70% orthologous генов с людьми, и они имеют аналогичные позвоночных биологии7. Данио рерио обеспечивают сравнительно легко ухаживать, большой сцепление размера яйца, шансов справиться с возникающими генетики, легко трансгенез и прозрачные внешние эмбрионального развития, которые делают их улучшенные системы в vivo изображений5,6. С большим источником мутант рыбы линии уже присутствует и полностью виртуализированного генома данио рерио обеспечит относительно неограниченный спектр научных открытий.
Расследовать в естественных условиях в реальном времени электрической активности клеток, мы воспользоваться zebrafish модель системы и ASAP1. В этом документе мы описывают как включить биосенсор флуоресцентные напряжения ASAP1 в геноме данио рерио, с помощью Tol2 transposon трансгенез и визуализировать сотовой электрической активности во время эмбрионального развития, Движение личинок рыбы и в живых опухолевых .

<table>
	<tbody>
		<tr>
			<td>14mL cell culture tubes</td>
			<td>VWR</td>
			<td>60818-725</td>
			<td>E.Coli culture</td>
		</tr>
		<tr>
			<td>Agarose electrophoresis tank</td>
			<td>Thermo Scientific</td>
			<td>Owl B2</td>
			<td>DNA eletrophoresis</td>
		</tr>
		<tr>
			<td>Agarose RA</td>
			<td>Amresco</td>
			<td>N605-500G</td>
			<td>For making the injection gels</td>
		</tr>
		<tr>
			<td>Attb1-ASAP1-F primer</td>
			<td>IDT DNA</td>
			<td>GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGACGACTGTGAGGTATGAACA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Attb2-ASAP1-R primer</td>
			<td>IDT DNA</td>
			<td>GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGGTTACCACTTCAAGTTGTTTCTTCTGTGAAGCCA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Bright field dissection scope</td>
			<td>Nikon</td>
			<td>SMZ 745</td>
			<td>Dechorionation, microinjection, mounting</td>
		</tr>
		<tr>
			<td>Color camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRc</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Concave slide</td>
			<td>VWR</td>
			<td>48336-001</td>
			<td>For holding fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>Disposable transfer pipette 3.4 ml</td>
			<td>Thermo Scientific</td>
			<td>13-711-9AM</td>
			<td>Fish embryos and water transfer</td>
		</tr>
		<tr>
			<td>Endonuclease enzyme, Not I</td>
			<td>NEB</td>
			<td>R0189L</td>
			<td>For linearizing plasmid DNA</td>
		</tr>
		<tr>
			<td>Epifuorescent compound scope</td>
			<td>Zeiss</td>
			<td>Axio Imager.A2</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Epifuorescent stereo dissection scope</td>
			<td>Zeiss</td>
			<td>Stereo Discovery.V12</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Fluorescent light source</td>
			<td>Lumen dynamics</td>
			<td>X-cite seris 120</td>
			<td>Light source for fluorescence microscopes</td>
		</tr>
		<tr>
			<td>Forceps #5</td>
			<td>WPI</td>
			<td>500342</td>
			<td>Dechorionation and needle breaking</td>
		</tr>
		<tr>
			<td>Gateway BP Clonase II Enzyme mix</td>
			<td>Thermo Scientific</td>
			<td>11789020</td>
			<td>Gateway BP recombination cloning</td>
		</tr>
		<tr>
			<td>Gateway LR Clonase II Plus enzyme</td>
			<td>Thermo Scientific</td>
			<td>12538120</td>
			<td>Gateway LR recombination cloning</td>
		</tr>
		<tr>
			<td>Gel DNA Recovery Kit</td>
			<td>Zymo Research</td>
			<td>D4002</td>
			<td>DNA gel purification</td>
		</tr>
		<tr>
			<td>Loading tip</td>
			<td>Eppendorf</td>
			<td>930001007</td>
			<td>For loading injection solution into capilary needles</td>
		</tr>
		<tr>
			<td>Methylcellulose (1600cPs)</td>
			<td>Alfa Aesar</td>
			<td>43146</td>
			<td>Fish embryo mounting</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Sigma-Aldrich</td>
			<td>M9140</td>
			<td>Suppresses fungal outbreaks in Petri dishes</td>
		</tr>
		<tr>
			<td>Microinjection mold</td>
			<td>Adaptive Science Tools</td>
			<td>TU-1</td>
			<td>To prepare agaorse mold tray for holding fish embryos during injection</td>
		</tr>
		<tr>
			<td>Microinjector</td>
			<td>WPI</td>
			<td>Pneumatic Picopump PV820</td>
			<td>Microinjection injector</td>
		</tr>
		<tr>
			<td>Micro-manipulator</td>
			<td>WPI</td>
			<td>Microinjector mm33 rechts</td>
			<td>Microinjection operation</td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Sutter instrument</td>
			<td>P-1000</td>
			<td>For preparing capillary needle</td>
		</tr>
		<tr>
			<td>Mineral oil</td>
			<td>Amresco</td>
			<td>J217-500ml</td>
			<td>For calibrating injection volume</td>
		</tr>
		<tr>
			<td>mMESSAGE mMACHINE SP6 Transcription Kit</td>
			<td>Thermo Scientific</td>
			<td>AM1340</td>
			<td>mRNA in vitro transcription</td>
		</tr>
		<tr>
			<td>Monocolor camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRm</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4020</td>
			<td>Prepare small amount of plasmid DNA</td>
		</tr>
		<tr>
			<td>Plastic Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td>For holding fish or fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>RNA Clean &#38; Concentrator-5</td>
			<td>Zymo Research</td>
			<td>R1015</td>
			<td>mRNA cleaning after in vitro transcription</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>NanoDrop 2000</td>
			<td>For measuring DNA and RNA concentrations</td>
		</tr>
		<tr>
			<td>Stage Micrometer</td>
			<td>Am Scope</td>
			<td>MR100</td>
			<td>Microinjection volume calibration</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>Bio-Rad</td>
			<td>T100</td>
			<td>DNA amplification for gene cloning</td>
		</tr>
		<tr>
			<td>Thin wall glass capillaries</td>
			<td>WPI</td>
			<td>TW100F-4</td>
			<td>Raw glass for making cappilary needle</td>
		</tr>
		<tr>
			<td>Tol2-exL1 primer</td>
			<td>IDT DNA</td>
			<td>GCACAACACCAGAAATGCCCTC</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>Tol2-exR primer</td>
			<td>IDT DNA</td>
			<td>ACCCTCACTAAAGGGAACAAAAG</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>TOP10 Chemically Competent E. coli</td>
			<td>Thermo Scientific</td>
			<td>C404006</td>
			<td>Used for transformation during gene cloning</td>
		</tr>
		<tr>
			<td>Tricaine mesylate</td>
			<td>Sigma-Aldrich</td>
			<td>A5040</td>
			<td>For anesthetizing fish or fish embryos</td>
		</tr>
		<tr>
			<td>UV trans-illuminator 302nm</td>
			<td>UVP</td>
			<td>M-20V</td>
			<td>DNA visualization</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Thermo Scientific</td>
			<td>2853</td>
			<td>For transformation process of gene cloning</td>
		</tr>
	</tbody>
</table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

Шапкой, эндогенного электрической сигнализации при посредничестве ионных каналов и насосы расположены на клеточной мембраны, играет важную роль в сигнализации процессов возбудимых нейронов и мышечных клеток и многие другие биологические процессы, такие как эмбриональные развития кучность. Однако существует необходимость в естественных условиях мониторинг электрической активности в позвоночных эмбриогенеза. Достижения генетически закодированный напряжение люминесцентных индикаторов (Гевиш) сделали возможным предоставить решение для этой проблемы. Здесь мы опишем, как для создания трансгенных напряжения Индикатор данио рерио, используя установленные напряжения Индикатор, ASAP1 (ускорения датчик потенциалы действия 1), в качестве примера. Комплект Tol2 и вездесущие данио рерио промоутер, ubi, были выбраны в этом исследовании. Мы также объяснить процессы шлюза сайта клонирования, Tol2 на основе transposon данио рерио трансгенез и процесс обработки изображений для ранней стадии рыбы эмбрионов и рыбы опухоли с помощью регулярных epifluorescent микроскопы. С помощью этой линии рыб, мы обнаружили, что есть изменения клеточного электрического напряжения во время эмбриогенеза у рыбок данио и движение личинок рыб. Кроме того было отмечено, что в несколько данио рерио злокачественные периферических нервов оболочки опухоли, опухоль, которую клетки были обычно поляризованных по сравнению с окружающих нормальных тканей.

В успешных инъекции, больше, чем эмбрионы вводят 50% рыбы будет отображать определенную степень зеленый флуоресценции в соматических клетках, и большинство из них будет положительным, Tol2 transposon акцизных пробирного (рис. 2). После 2-4 поколения исходящей кре...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Визуализация сотовой электрической активности в Zebrafish ранних эмбрионов и опухоли

Здесь мы покажем процесс создания строки данио рерио репортер сотовой электрического напряжения для визуализации эмбриональное развитие, движение, и рыбы опухолевых клеток в естественных условиях.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

Research

JoVE Journal

Developmental Biology

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion (FDAP)

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion FDAP

Измерение белка стабильности в жизни у эмбрионов данио рерио с помощью флуоресцентной упадок после фотопреобразования (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological ...

Mechanical Vessel Injury in Zebrafish Embryos

Механическая судно Травмы у эмбрионов данио рерио

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes.  External development ...

Loss- and Gain-of-function Approach to Investigate Early Cell Fate Determinants in Preimplantation Mouse Embryos

Убыт- и Gain-оф-функции подход к расследованию Early Cell Судьба определителям предимплантационной эмбрионов мыши

 Gene silencing and overexpression techniques are instrumental for the identification of genes involved in embryonic development. Direct target gene ...

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Транскриптом профилирование<em&gt; In-Vivo</em&gt; Производимые Бычьи Эмбрионы предимплантационной Использование Двухцветный Microarray платформы

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo ...

Isolation and Characterization of Single Cells from Zebrafish Embryos

Выделение и характеристика отдельных клеток из эмбрионов данио рерио

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

Мембранный потенциал монокристалла монокристалла в живых эмбрионах данио

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Индукция гипоксии у живых лягушек и эмбрионов рыбок данио

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Multi-Photon Time Lapse Imaging to Visualize Development in Real-time: Visualization of Migrating Neural Crest Cells in Zebrafish Embryos

Мульти Фотон время Замедленная съемка изображений для визуализации в режиме реального времени разработки: Визуализация миграции клеток нервной гребень в Zebrafish эмбриона

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

Визуализация узлов и Notochordal пластины в Gastrulating эмбрионов мыши, используя растровая электронная микроскопия и вся гора иммунофлуоресценции

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Whole Mount Immunohistochemistry in Zebrafish Embryos and Larvae

Целая гора иммуногистохимия в зебрафиш эмбрионов и ларьков

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. ...