Name: visualization of cellular electrical activity in zebrafish early embryos and tumors
Uploaded: 2018-04-25T14:00:00
Description: Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

El trabajo de investigación en esta publicación fue apoyado por el Instituto Nacional de General médica Ciencias de los institutos nacionales de salud bajo la concesión número R35GM124913, programa de incentivos de la Universidad de Purdue PI4D y PVM interno competitivo Programa de fondos de investigación básica. El contenido es responsabilidad exclusiva de los autores y no representan necesariamente las opiniones oficiales de los agentes de financiación. Agradecemos a Koichi Kawakami para la construcción de Tol2, Michael Lin para la construcción de ASAP1, y Leonard Zon para el promotor ubi construir a través de Addgene.

El pez cebra se encuentran en un centro de animales aprobados por AAALAC, y todos los experimentos se llevaron a cabo según los protocolos aprobados por el cuidado de animales de Purdue y uso Comité (PACUC).
1. Tol2 Transposon plásmido construcción preparación
Nota: Tol2, un transposón que fue descubierto en los peces medaka, ha sido ampliamente utilizado en el pez cebra investigación comunidad8,9. Ha s...

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

Aunque las actividades eléctricas nivel celular y tejidos durante el desarrollo embrionario y la enfermedad humana fueron descubiertas hace mucho tiempo, los en vivo eléctrica cambios dinámicos y sus papeles biológicos siguen siendo en gran parte desconocidos. Uno de los mayores retos es visualizar y cuantificar los cambios eléctricos. Tecnología de abrazadera del remiendo es una brecha para el seguimiento de las células, pero su aplicación en embriones vertebrados es limitada porque se componen de mucha...

Bioelectricidad se refiere a señalización eléctrica endógena mediada por canales iónicos y bombas situadas en la membrana de la célula1. Intercambio iónico a través de la membrana celular y el acoplado cambios actuales y potenciales eléctricos, es esencial para la señalización de los procesos de las células neuronales y musculares excitables. Además, la bioelectricidad y los gradientes de iones tienen una variedad de otras funciones biológicas importantes como almacenamiento de energía, biosíntesis y transporte de metabolitos. Señalización bioeléctrica también fue descubierto como un regulador de la formación embrionaria, como ejes del cuerpo, el ciclo celular y diferenciación de células1. Por lo tanto, es fundamental para la comprensión de muchas enfermedades congénitas humanas que resultan de la mala regulación de este tipo de señalización. Aunque abrazadera del remiendo ha sido ampliamente utilizada para la grabación de las células, está todavía lejos de ser ideal para el control simultáneo de múltiples células durante el desarrollo embrionario en vivo. Además, moléculas pequeñas sensibles de tensión no son también ideales para aplicaciones en vivo debido a su toxicidad, especificidades y sensibilidades.
La creación de una variedad de genéticamente codificado voltaje fluorescente indicadores (GEVIs) ofrece un nuevo mecanismo para resolver este problema y permite la fácil aplicación para el estudio de desarrollo embrionario, a pesar de que originalmente estaban destinados para el control neural células de2,3. Uno de los GEVIs actualmente disponibles es el Sensor acelerado de potenciales de acción 1 (ASAP1)4. Se compone de un lazo extracelular de un dominio de detección de tensión de voltaje sensibles fosfatasa y una proteína fluorescente verde permutada circularmente. Por lo tanto, ASAP1 permite la visualización de los cambios de potencial eléctricos celulares (polarización: verde brillante, despolarización: verde oscuro). ASAP1 tiene 2 ms on y off cinética y puede realizar un seguimiento de cambio potencial subliminal4. Así, esta herramienta genética permite un nuevo nivel de eficacia en bioeléctrica de la supervisión en tiempo real en células vivas. Mayor comprensión de los roles de la bioelectricidad en muchas enfermedades humanas, como el cáncer y el desarrollo embrionario se arroja nueva luz sobre los mecanismos subyacentes, que es fundamental para la prevención y tratamiento de la enfermedad.
Pez cebra se ha demostrado un potente modelo animal para estudiar la biología del desarrollo y enfermedades humanas incluyendo cáncer5,6. Comparten el 70% orthologous genes con los seres humanos, y tienen Biología vertebrado similar7. Pez cebra proporcionan cuidado relativamente fácil, un tamaño grande de huevos, manejable genética, transgénesis fácil y desarrollo embrionario externo transparente, que las hacen un sistema superior en vivo imagen5,6. Con una fuente grande de líneas de peces mutantes ya presentes y un genoma completamente secuenciado, pez cebra ofrecerá una gama relativamente ilimitada de los descubrimientos científicos.
Para investigar la en vivo en tiempo real actividad eléctrica de las células, aprovechamos el sistema de modelo de pez cebra y ASAP1. En este papel, describimos cómo incorporar el biosensor fluorescente tensión ASAP1 en el genoma del pez cebra con Tol2 transposon transgénesis y visualizar actividad eléctrica celular durante el desarrollo embrionario, larval de peces movimiento y el tumor vivo .

<table>
	<tbody>
		<tr>
			<td>14mL cell culture tubes</td>
			<td>VWR</td>
			<td>60818-725</td>
			<td>E.Coli culture</td>
		</tr>
		<tr>
			<td>Agarose electrophoresis tank</td>
			<td>Thermo Scientific</td>
			<td>Owl B2</td>
			<td>DNA eletrophoresis</td>
		</tr>
		<tr>
			<td>Agarose RA</td>
			<td>Amresco</td>
			<td>N605-500G</td>
			<td>For making the injection gels</td>
		</tr>
		<tr>
			<td>Attb1-ASAP1-F primer</td>
			<td>IDT DNA</td>
			<td>GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGACGACTGTGAGGTATGAACA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Attb2-ASAP1-R primer</td>
			<td>IDT DNA</td>
			<td>GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGGTTACCACTTCAAGTTGTTTCTTCTGTGAAGCCA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Bright field dissection scope</td>
			<td>Nikon</td>
			<td>SMZ 745</td>
			<td>Dechorionation, microinjection, mounting</td>
		</tr>
		<tr>
			<td>Color camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRc</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Concave slide</td>
			<td>VWR</td>
			<td>48336-001</td>
			<td>For holding fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>Disposable transfer pipette 3.4 ml</td>
			<td>Thermo Scientific</td>
			<td>13-711-9AM</td>
			<td>Fish embryos and water transfer</td>
		</tr>
		<tr>
			<td>Endonuclease enzyme, Not I</td>
			<td>NEB</td>
			<td>R0189L</td>
			<td>For linearizing plasmid DNA</td>
		</tr>
		<tr>
			<td>Epifuorescent compound scope</td>
			<td>Zeiss</td>
			<td>Axio Imager.A2</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Epifuorescent stereo dissection scope</td>
			<td>Zeiss</td>
			<td>Stereo Discovery.V12</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Fluorescent light source</td>
			<td>Lumen dynamics</td>
			<td>X-cite seris 120</td>
			<td>Light source for fluorescence microscopes</td>
		</tr>
		<tr>
			<td>Forceps #5</td>
			<td>WPI</td>
			<td>500342</td>
			<td>Dechorionation and needle breaking</td>
		</tr>
		<tr>
			<td>Gateway BP Clonase II Enzyme mix</td>
			<td>Thermo Scientific</td>
			<td>11789020</td>
			<td>Gateway BP recombination cloning</td>
		</tr>
		<tr>
			<td>Gateway LR Clonase II Plus enzyme</td>
			<td>Thermo Scientific</td>
			<td>12538120</td>
			<td>Gateway LR recombination cloning</td>
		</tr>
		<tr>
			<td>Gel DNA Recovery Kit</td>
			<td>Zymo Research</td>
			<td>D4002</td>
			<td>DNA gel purification</td>
		</tr>
		<tr>
			<td>Loading tip</td>
			<td>Eppendorf</td>
			<td>930001007</td>
			<td>For loading injection solution into capilary needles</td>
		</tr>
		<tr>
			<td>Methylcellulose (1600cPs)</td>
			<td>Alfa Aesar</td>
			<td>43146</td>
			<td>Fish embryo mounting</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Sigma-Aldrich</td>
			<td>M9140</td>
			<td>Suppresses fungal outbreaks in Petri dishes</td>
		</tr>
		<tr>
			<td>Microinjection mold</td>
			<td>Adaptive Science Tools</td>
			<td>TU-1</td>
			<td>To prepare agaorse mold tray for holding fish embryos during injection</td>
		</tr>
		<tr>
			<td>Microinjector</td>
			<td>WPI</td>
			<td>Pneumatic Picopump PV820</td>
			<td>Microinjection injector</td>
		</tr>
		<tr>
			<td>Micro-manipulator</td>
			<td>WPI</td>
			<td>Microinjector mm33 rechts</td>
			<td>Microinjection operation</td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Sutter instrument</td>
			<td>P-1000</td>
			<td>For preparing capillary needle</td>
		</tr>
		<tr>
			<td>Mineral oil</td>
			<td>Amresco</td>
			<td>J217-500ml</td>
			<td>For calibrating injection volume</td>
		</tr>
		<tr>
			<td>mMESSAGE mMACHINE SP6 Transcription Kit</td>
			<td>Thermo Scientific</td>
			<td>AM1340</td>
			<td>mRNA in vitro transcription</td>
		</tr>
		<tr>
			<td>Monocolor camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRm</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4020</td>
			<td>Prepare small amount of plasmid DNA</td>
		</tr>
		<tr>
			<td>Plastic Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td>For holding fish or fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>RNA Clean &#38; Concentrator-5</td>
			<td>Zymo Research</td>
			<td>R1015</td>
			<td>mRNA cleaning after in vitro transcription</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>NanoDrop 2000</td>
			<td>For measuring DNA and RNA concentrations</td>
		</tr>
		<tr>
			<td>Stage Micrometer</td>
			<td>Am Scope</td>
			<td>MR100</td>
			<td>Microinjection volume calibration</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>Bio-Rad</td>
			<td>T100</td>
			<td>DNA amplification for gene cloning</td>
		</tr>
		<tr>
			<td>Thin wall glass capillaries</td>
			<td>WPI</td>
			<td>TW100F-4</td>
			<td>Raw glass for making cappilary needle</td>
		</tr>
		<tr>
			<td>Tol2-exL1 primer</td>
			<td>IDT DNA</td>
			<td>GCACAACACCAGAAATGCCCTC</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>Tol2-exR primer</td>
			<td>IDT DNA</td>
			<td>ACCCTCACTAAAGGGAACAAAAG</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>TOP10 Chemically Competent E. coli</td>
			<td>Thermo Scientific</td>
			<td>C404006</td>
			<td>Used for transformation during gene cloning</td>
		</tr>
		<tr>
			<td>Tricaine mesylate</td>
			<td>Sigma-Aldrich</td>
			<td>A5040</td>
			<td>For anesthetizing fish or fish embryos</td>
		</tr>
		<tr>
			<td>UV trans-illuminator 302nm</td>
			<td>UVP</td>
			<td>M-20V</td>
			<td>DNA visualization</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Thermo Scientific</td>
			<td>2853</td>
			<td>For transformation process of gene cloning</td>
		</tr>
	</tbody>
</table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

Bioelectricidad, señalización eléctrica endógena mediada por canales iónicos y bombas situadas en la membrana celular, juega un papel importante en la señalización de los procesos de las células neuronales y musculares excitables y muchos otros procesos biológicos, tales como embrionarias patrones del desarrollo. Sin embargo, es necesario para en vivo monitoreo de la actividad eléctrica en la embriogénesis vertebrados. Los avances de los indicadores de voltaje fluorescente genéticamente codificados (GEVIs) han hecho posible dar una solución para este desafío. Aquí, describimos cómo crear un indicador de voltaje transgénicos pez cebra utilizando el indicador de tensión establecido, ASAP1 (acelerado Sensor de potenciales de acción 1), por ejemplo. El kit de Tol2 y un promotor de pez cebra ubicuo, ubi, fueron escogidos en este estudio. También explicamos los procesos de clonación de puerta de enlace específica, Tol2 pez cebra basada en transposon transgénesis y el proceso de proyección de imagen de incipiente peces peces y embriones los tumores utilizando microscopios regulares epifluorescente. Usando esta línea de peces, encontramos que hay cambios de voltaje eléctrico celular durante la embriogénesis de pez cebra y movimiento de larvas de peces. Además, se observó que en unos tumores de la vaina del nervio periférico maligno de pez cebra, el tumor de células generalmente fueron polarizadas en comparación con los tejidos normales circundantes.

En una inyección exitosa, más que embriones de pescado 50% inyectado mostrará cierta fluorescencia verde en las células somáticas, y la mayoría de ellos será positiva por análisis de impuestos sobre el consumo de transposon de Tol2 (figura 2). Después de 2-4 generaciones de hacia fuera-Cruz con peces de tipo salvaje (hasta que los peces fluorescentes alcanzan 50%, la proporción mendeliana esperada), los peces transgénicos se utilizaron para el expe...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Visualización de la actividad eléctrica celular en embriones tempranos de pez cebra y tumores

Aquí, mostramos el proceso de crear una línea de pez cebra de reportero de tensión eléctrica celular para visualizar el desarrollo embrionario, movimiento, y las células de tumor de peces en vivo.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

Research

JoVE Journal

Developmental Biology

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion (FDAP)

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion FDAP

Medición de la estabilidad de proteínas en la sala de embriones de pez cebra Utilizando fluorescencia Decay Después Fotoconversión (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological ...

Investigación

Biología del Desarrollo

Mechanical Vessel Injury in Zebrafish Embryos

Lesiones Embarcaciones mecánica en embriones de pez cebra

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes.  External development ...

Loss- and Gain-of-function Approach to Investigate Early Cell Fate Determinants in Preimplantation Mouse Embryos

Deficitaria y en el enfoque de ganancia de función de investigar la célula destino temprano Determinantes de preimplantación embriones de ratón

 Gene silencing and overexpression techniques are instrumental for the identification of genes involved in embryonic development. Direct target gene ...

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Transcriptoma de perfiles de<em&gt; In-Vivo</em&gt; Productos fabricados preimplantación de embriones bovinos mediante plataforma de microarrays de dos colores

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo ...

Isolation and Characterization of Single Cells from Zebrafish Embryos

Aislamiento y caracterización de células individuales a partir de embriones de pez cebra

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

Potencial de membrana de la neurona motora de Biosensing en los embriones vivos de pez cebra

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Inducción de la hipoxia en los sapos vivos y los embriones de pez cebra

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Multi-Photon Time Lapse Imaging to Visualize Development in Real-time: Visualization of Migrating Neural Crest Cells in Zebrafish Embryos

La proyección de imagen de lapso tiempo multi-Photon para visualizar el desarrollo en tiempo real: visualización de la migración de las células de cresta Neural en embriones de pez cebra

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

Visualización de la placa notocordal en embriones de ratón Gastrulating con microscopía electrónica e inmunofluorescencia de Monte todo y nodo

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Whole Mount Immunohistochemistry in Zebrafish Embryos and Larvae

Inmunohistoquímica de montaje completo en embriones y larvas de pez cebra

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. ...