עבודה זו הוקם במימון המועצה הגרמנית למחקר (DFG) דרך יוזמה מצוינות הגרמני (CellNetworks DFG-סיפורה ה 81), מימון חלקי על-ידי מרכז מחקר משותף SFB638.

<ol>
	<li>Scott, D. E., Bayly, A. R., Abell, C., Skidmore, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecules,+big+targets:+drug+discovery+faces+the+protein-protein+interaction+challenge.">Small molecules, big targets: drug discovery faces the protein-protein interaction challenge.</a> Nat Rev Drug Discov. 15 (8), 533-550 (2016).</li><li>Roux, K. J., Kim, D. I., Raida, M., Burke, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+promiscuous+biotin+ligase+fusion+protein+identifies+proximal+and+interacting+proteins+in+mammalian+cells.">A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells.</a> J Cell Biol. 196 (6), 801-810 (2012).</li><li>Lam, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+APEX2+for+electron+microscopy+and+proximity+labeling.">Directed evolution of APEX2 for electron microscopy and proximity labeling.</a> Nat Methods. 12 (1), 51-54 (2015).</li><li>Rhee, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+mapping+of+mitochondria+in+living+cells+via+spatially+restricted+enzymatic+tagging.">Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging.</a> Science. 339 (6125), 1328-1331 (2013).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+nuclear+pore+complex+architecture+with+proximity-dependent+biotinylation.">Probing nuclear pore complex architecture with proximity-dependent biotinylation.</a> P Natl Acad Sci USA. 111 (24), E2453-E2461 (2014).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+smaller+biotin+ligase+for+BioID+proximity+labeling.">An improved smaller biotin ligase for BioID proximity labeling.</a> Mol Biol Cell. 27 (8), 1188-1196 (2016).</li><li>Lambert, J. P., Tucholska, M., Go, C., Knight, J. D., Gingras, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proximity+biotinylation+and+affinity+purification+are+complementary+approaches+for+the+interactome+mapping+of+chromatin-associated+protein+complexes.">Proximity biotinylation and affinity purification are complementary approaches for the interactome mapping of chromatin-associated protein complexes.</a> J Proteomics. 118, 81-94 (2015).</li><li>Morriswood, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+bilobe+components+in+Trypanosoma+brucei+identified+using+proximity-dependent+biotinylation.">Novel bilobe components in Trypanosoma brucei identified using proximity-dependent biotinylation.</a> Eukaryot Cell. 12 (2), 356-367 (2013).</li><li>Schopp, I. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID+a+conditional+proteomics+approach+to+monitor+the+composition+of+spatiotemporally+defined+protein+complexes.">Split-BioID a conditional proteomics approach to monitor the composition of spatiotemporally defined protein complexes.</a> Nat Commun. 8, (2017).</li><li>B&#233;thune, J., Artus-Revel, C. G., Filipowicz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetic+analysis+reveals+successive+steps+leading+to+miRNA-mediated+silencing+in+mammalian+cells.">Kinetic analysis reveals successive steps leading to miRNA-mediated silencing in mammalian cells.</a> EMBO Rep. 13 (8), 716-723 (2012).</li><li>Inoue, H., Nojima, H., Okayama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+efficiency+transformation+of+Escherichia+coli+with+plasmids.">High efficiency transformation of Escherichia coli with plasmids.</a> Gene. 96 (1), 23-28 (1990).</li><li>Weidenfeld, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+expression+of+coding+and+inhibitory+RNAs+from+retargetable+genomic+loci.">Inducible expression of coding and inhibitory RNAs from retargetable genomic loci.</a> Nucleic Acids Res. 37 (7), e50 (2009).</li><li>Dyballa, N., Metzger, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+colloidal+coomassie+G-250+staining+for+proteins+in+polyacrylamide+gels.">Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels.</a> J Vis Exp. (30), (2009).</li><li>Jonas, S., Izaurralde, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+a+molecular+understanding+of+microRNA-mediated+gene+silencing.">Towards a molecular understanding of microRNA-mediated gene silencing.</a> Nat Rev Genet. 16 (7), 421-433 (2015).</li><li>MacRae, I. J., Ma, E., Zhou, M., Robinson, C. V., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reconstitution+of+the+human+RISC-loading+complex.">In vitro reconstitution of the human RISC-loading complex.</a> P Natl Acad Sci USA. 105 (2), 512-517 (2008).</li><li>Cox, J., Mann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MaxQuant+enables+high+peptide+identification+rates,+individualized+p.p.b.-range+mass+accuracies+and+proteome-wide+protein+quantification.">MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification.</a> Nat Biotechnol. 26 (12), 1367-1372 (2008).</li><li>Tyanova, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Perseus+computational+platform+for+comprehensive+analysis+of+(prote)omics+data.">The Perseus computational platform for comprehensive analysis of (prote)omics data.</a> Nat Methods. 13 (9), 731-740 (2016).</li><li>Opitz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+the+Asc1p/Receptor+for+Activated+C+Kinase+1+(RACK1)+Microenvironment+at+the+Head+Region+of+the+40S+Ribosome+with+Quantitative+BioID+in+Yeast.">Capturing the Asc1p/Receptor for Activated C Kinase 1 (RACK1) Microenvironment at the Head Region of the 40S Ribosome with Quantitative BioID in Yeast.</a> Mol Cell Proteomics. 16 (12), 2199-2218 (2017).</li><li>Mackmull, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+of+nuclear+transport+receptor+cargo+specificity.">Landscape of nuclear transport receptor cargo specificity.</a> Mol Syst Biol. 13 (12), 962 (2017).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioSITe:+A+Method+for+Direct+Detection+and+Quantitation+of+Site-Specific+Biotinylation.">BioSITe: A Method for Direct Detection and Quantitation of Site-Specific Biotinylation.</a> J Proteome Res. , (2017).</li><li>Udeshi, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibodies+to+biotin+enable+large-scale+detection+of+biotinylation+sites+on+proteins.">Antibodies to biotin enable large-scale detection of biotinylation sites on proteins.</a> Nat Methods. 14 (12), 1167-1170 (2017).</li><li>Chapat, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cap-binding+protein+4EHP+effects+translation+silencing+by+microRNAs.">Cap-binding protein 4EHP effects translation silencing by microRNAs.</a> P Natl Acad Sci USA. 114 (21), 5425-5430 (2017).</li><li>Luker, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+regulated+protein-protein+interactions+revealed+with+firefly+luciferase+complementation+imaging+in+cells+and+living+animals.">Kinetics of regulated protein-protein interactions revealed with firefly luciferase complementation imaging in cells and living animals.</a> P Natl Acad Sci USA. 101 (33), 12288-12293 (2004).</li><li>De Munter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID:+a+proximity+biotinylation+assay+for+dimerization-dependent+protein+interactions.">Split-BioID: a proximity biotinylation assay for dimerization-dependent protein interactions.</a> FEBS Lett. 591 (2), 415-424 (2017).</li><li>Xue, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+the+fragment+complementation+of+APEX2+for+detection+of+specific+protein-protein+interactions+in+live+cells.">Optimizing the fragment complementation of APEX2 for detection of specific protein-protein interactions in live cells.</a> Sci Rep. 7 (1), 12039 (2017).</li><li>Branon, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+TurboID+for+efficient+proximity+labeling+in+living+cells+and+organisms.">Directed evolution of TurboID for efficient proximity labeling in living cells and organisms.</a> bioRxiv. , (2017).</li></ol>

המחברים אין לחשוף.

ההליך מחולקת לרמות מתאר איך לשכפל את הגנים של עניין לתוך הפיצול-BioID פלסמידים, כיצד לבדוק את האינטראקציה-induced biotinylation וכיצד לבודד חלבונים biotinylated לניתוח ספקטרומטר מסה. נתאר כאן פרוצדורה המבוססת על תקנים ארעית. בעוד הביטוי של החלבונים פיוז'ן ניתן לכוונן לפי כמות dox הוסיף למדיום, תרביות תאים ארעי עלול להוביל ביטוי חלבון שאינו הומוגני עם כמה תאים בגסות overexpress את החלבונים פיוז'ן בהשוואה למצבם אנדוגני עמיתיהם. זה עלול לגרום עיוותים של interactomes המתאים וכדי PPI אינן משקפות נאמנה את אינטראקציות המערבות את החלבונים אנדוגני. רצוי לכן בדרך כלל לבנות שורות תאים יציב לאחר פיצול-BioID הוקם באמצעות מערכת ארעית. פלסמידים עולים בקנה אחד עם מערכת רקומבינציה בתיווך Flp ולמקם בשני הגנים של עניין תחת ברגולציה של אותו רכיב ט מגיב. אם יש צורך, בעת שימוש עם תאים בתרבית של תואם, הם מאפשרים יצירה קלה של שורות תאים inducible יציב. לדוגמה, אנו משתמשים הקו הלה-EM2-11 המבטאת activator מופעל טטרציקלין שעתוק rtTA וגנומית ייחודי targetable לוקוס שממנו ניתן ביטוי גנים בתיווך טטרציקלין בחוזקה מוסדר12. באמצעות תאים בטור הזה, בתיווך Flp רקומבינציה, שורות תאים יציב המכילים רק עותק אחד של transgene ניתן לקבל בתוך שבועיים-שלושה שבועות. לחלופין, אחד יכול גם להשתמש טכניקות עריכה הנוכחי של הגנום להציג שברי בירה * ב לוקוסים גנומית מקורית של הגנים של עניין.
כמו כל assay המסתמך על תיוג חלבון, צריך לשקול אם החלבונים פיוז'ן וכתוצאה מכך פועלים. נתונים זמינים ב אשר תויגו החלבונים עניין (לדוגמה עם GFP הדמיה מחקרים) והן מבחינה תפקודית נבדק שימושיים כדי להחליט אם השברים בירה * צריך להיות משובטים במעלה או במורד הגנים של עניין. אם אין נתונים זמינים, אחד צריך לבדוק N-סופני או C-סופני מתויג חלבונים ב- assay פונקציונלי. לדוגמה, הפעילות של החלבונים פיוז'ן יכול להיבדק בקו התא בו החלבון אנדוגני יש כבר הפילו-אאוט, לעומת המצב פראי סוג. אם החלבונים עניין לסבול שתי תגיות N - ו C-מסוף, שניהם צריך להיבדק. אכן, בניסויים BioID, הכיוון של החלבון פיוז'ן יכול להשפיע את היעילות של תיוג22. בנוסף, הבחנו כי בעת החלת פיצול-BioID זוג של חלבונים, אשר של שני החלבונים מצורף לשם גם NBirA * או CBirA * קטע גם השפעה את היעילות של תיוג9. ב פלסמידים פיצול-BioID, חומצת אמינו 16 ארוך גליצין/סרין linkers עשירה צימוד החלבונים עניין כדי השברים בירה * היו שנלקחו PCA עוד23 , עבדה בשבילנו כל החלבונים שמעצבת בדקנו עד כה. עם זאת, ניתן לשקול כמה זוגות חלבון יכול לעבוד טוב יותר עם linkers ארוכה או קצרה יותר. ראוי לציין הסופי, וזמינותו אחר תוארה על ידי קבוצת Bollen24. ב הזה assay, בירה * מפוצל באתר אחר (E140/Q141) משלנו (E256/G257). לנו יש שני פיצול-BioID טעמים-לצד נבדק ונמצא כי E256/G257, שמתואר פרוטוקול זה, מוביל חזק הפעלה מחדש כאשר מצמידים שני חלבונים שמעצבת9.
חסרון אחד כללי של שיטה זו הוא המהירות האיטית של תיוג. בדרך כלל, זמן הדגירה 6 עד 24 h עם ביוטין יש צורך להשיג ניכר biotinylation6, מסלק את השימוש בטכניקה זו ללמוד שיפוץ דינמי של מתחמי חלבון. בזמן הזה assay כתובות חלקית זו אזהרה כמו זה מופעל רק כאשר שני חלבונים אינטראקציה, מהירות איטית של תיוג למנוע השימוש ללמוד מענה לתהליכים מאוד דינמי או לנתח חלבונים קצרת ימים. Peroxidase מהונדסים APEX2 ידוע לקדם תיוג יעיל של חלבונים proximal תוך מינימום 13. PCA בהתבסס על APEX2 ובכך אולי כתובת המגבלות של מהירות תיוג איטי מבחני נגזר BioID. מחקר הוכחה של עקרון תיאר כזה של פיצול-APEX2 assay25. עם זאת, למרות חלבון homodimerizing היה בהצלחה biotinylated, אם וזמינותו יכול לשמש גם תווית ולזהות חלבונים להרכיב סביב זוג של חלבונים שמעצבת נשאר להדגים. ממש לאחרונה, אבולוציה מכוונת שימש ליצירת TurboID, miniTurbo, שתי גרסאות של בירה * עם פעילות משופרת לאפשר חלונות זמן תיוג הרבה יותר קצר, עד 10 דקות26. התאמת פיצול-BioID אלה גרסאות חדשות נוספות תרחיב את השימוש בטכניקה זו לשדה רחבה של יישומים.

כפי ביותר תאיים מבוצעות על ידי חלבונים באופן דינאמי קומפלקסים macromolecular, הזיהוי של אינטראקציות חלבון (PPI) היא מאמץ גדול במחקר ביו-רפואי. אכן, PPI הם לעתים קרובות deregulated במחלה, מייצגים מטרות אפשריות עבור הרפוי1. הנפוצים ביותר שיטת הזיהוי של PPI הוא הגישה טיהור (AP) זיקה שבו, בעקבות פירוק תאים, חלבון עניין מטוהר במיוחד על מטריצה, חלבונים הקשורים לאחר מכן מזוהים באמצעות ספקטרומטר מסה (MS). בעוד AP-MS זה בגישה רב-עוצמה, זה בדרך כלל אינו מבצע גם על מתחמי מסיסות חלבון, האינטראקציות מאוד ארעי או PPI הדורשים מבנה subcellular ללא פגע. יתר על כן, הפרשנות של הנתונים יכול להיות מסובך באופי הדינמי של רשתות PPI, כמו חלבון יחיד היא לעתים קרובות חלק מספר מתחמי חלבון ברורים.
תיוג-קרבה טכניקות כגון BioID2 או3,APEX24 פותחו לאחרונה כדי להתמודד עם המגבלות של הגישות AP-MS. ב- BioID, האנזים בירה * (תואם ל- variant G115R של האנזים e. coli פראי סוג) מזרז היווצרות יציב biotinyl-AMP (ביו-AMP) זה יכול להגיב עם ראשי אמינים. בניגוד האנזים פראי סוג, זה שומר על ביו-AMP במרכזו פעיל, בירה * משחררת ביו-AMP ומאפשר שלה דיפוזיה לסביבת השכנה שלה. לפיכך, כאשר דבוקה חלבון עניין והביע בתאים, חלבונים צינתור יכול להיות biotinylated בתוך טווח משוער של 10 nm5. אלה מסומנים proximal חלבונים הם מבודדים על ידי הנפתח streptavidin ואז המזוהה על-ידי MS. בניגוד AP-MS, BioID דורש את הביטוי של חלבון פיוז'ן. זה ובכך ניתן להחיל רק חלבונים שתפקידם היא לא הקשו על-ידי תיוג. יתר על כן, מהירות תיוג היא איטית, בדרך כלל 6-24 h2,6, ביצוע זיהוי חלבונים קצרת ימים מאתגרים. ובכל זאת, בהשוואה ל- AP-MS, BioID-MS מציע מספר יתרונות מרכזיים: הראשון, שלה לוכדת האינטראקציות בסביבה התאית הטבעית שלהם; שנית, שכותרתו חלבונים מאשר מתחמי שהורכב מבודדים בעקבות פירוק התא; שלישית, streptavidin pulldowns מאפשרות שימוש denaturing מאגרי ותנאים קשים כביסה. לכן, השיטה היא יותר רגיש כדי לזהות ארעי או אינטראקציות חלשות7 או האינטראקציות המתרחשות על ספציפי, קשה לבודד את מבנה subcellular8.
עם זאת, רוב החלבונים בדרך כלל מהווים חלק מתחמים גדולים יותר ניתן לשפץ על פי רמזים הסלולר או לפונקציה צריך להתבצע. ומכאן, חלבון יחיד הוא בדרך כלל חלק מספר מתחמי, המייצגים יחידות פונקציונליות נפרדים, הקשורים ברורים ו/או חופפים PPI. שתי הגישות לתת סקירה כללית של כל שיוכי שחלבון נתון ייתכן, אך הם נכשלים להתייחס בהקשר של הפרט PPI. כדי להגדיל את הרזולוציה של האחרון, עיצבנו של חלבון-שברי קומפלמנטציה assay (PCA) יכולים אילו שני קטעים לא פעיל של בירה * (NBirA *, המכיל את התחום קטליטי, ו CBirA * שניתן להציג בתור התחום הפעלה מחדש.) לכנס שוב לתוך אנזים פעיל כאשר הביא בסמיכות על ידי שניים אינטראקציה חלבונים9. וזמינותו פיצול-BioID וכתוצאה מכך מתמקד biotinylation תלויי-הקרבה של חלבונים להרכיב סביב זוג שמעצבת חלבונים, ובכך מאפשרת זיהוי הקשר מכלולים התלויים חלבון. לאחרונה להדגים את הכוח רזולוציה יוצאת דופן של פיצול-BioID על-ידי פענוח כשני מתחמים נפרדים חלבון מעורב בתיווך miRNA ג'ין להחרשת מסלול9.
בסך הכל, assay יחיד ופשוט, פיצול-BioID מאפשרת גילוי והקצאת במיוחד PPI ליחידות פונקציונלי מוגדר שבו חלבון נתון הוא מעורב, בתנאי שחלבון אינטראקציה נוספת של החלבון המתאים מורכבים ידוע.

<table>
	<tbody>
		<tr>
			<td>Acetic acid (glacial)</td>
			<td>VWR</td>
			<td>20104.298</td>
			<td>To make TAE buffer</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma</td>
			<td>A9539</td>
			<td>Take TAE-agarose gels for DNA analysis and extraction</td>
		</tr>
		<tr>
			<td>Ammonia solution 25% NH3</td>
			<td>Bernd Kraft</td>
			<td>6012</td>
			<td>To dissolve biotin</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma</td>
			<td>A9518</td>
			<td>To select transformed bacteria</td>
		</tr>
		<tr>
			<td>Bioruptor plus sonification device</td>
			<td>Diagenode</td>
			<td>B01020001</td>
			<td>Other sonification devices are also ok</td>
		</tr>
		<tr>
			<td>Biotin</td>
			<td>Sigma</td>
			<td>B4639</td>
			<td>To be added to the growth medium to stimulate efficient biotinylation</td>
		</tr>
		<tr>
			<td>Bovine serum albumin fraction V</td>
			<td>Carl Roth</td>
			<td>8076</td>
			<td>Used in Western blot buffers and a protein standard in Bradford assays</td>
		</tr>
		<tr>
			<td>Bradford Ultra reagent</td>
			<td>Expedeon</td>
			<td>BFU05L</td>
			<td>Any other method/kit for protein determination is fine, this particular reagent is more tolerant to detergent than other Bradford reagents</td>
		</tr>
		<tr>
			<td>Cell scrappers</td>
			<td>TPP</td>
			<td>99002</td>
			<td>Any other model is also fine</td>
		</tr>
		<tr>
			<td>ClaI</td>
			<td>New England Biolabs</td>
			<td>R0197</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td>
		</tr>
		<tr>
			<td>DMEM medium</td>
			<td>Sigma</td>
			<td>D6046</td>
			<td>If using another cell line, use the corresponding optimal growth medium</td>
		</tr>
		<tr>
			<td>DNA miniprep kit</td>
			<td>Sigma</td>
			<td>PLN350</td>
			<td>Any other kit is also fine</td>
		</tr>
		<tr>
			<td>Doxycycline</td>
			<td>Applichem</td>
			<td>A2951</td>
			<td>Dox is light sensitive</td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>Applichem</td>
			<td>A2948</td>
			<td>Make 1M stock solution, store at -20 &#176;C and always use fresh</td>
		</tr>
		<tr>
			<td>DyLight 680-conjugated streptavidin</td>
			<td>Thermo scientific</td>
			<td>21848</td>
			<td>to use with a LiCor Western blot scanning device</td>
		</tr>
		<tr>
			<td>Dynabeads MyOne Streptavidin C1</td>
			<td>Invitrogen</td>
			<td>65002</td>
			<td>The C1 beads are not BSA coated which is preferable for downstream MS applications (no leakthrough of BSA in the final elution)</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Applichem</td>
			<td>A5097</td>
			<td>Make a 500 mM stock, adjust pH to 8 while dissolving the EDTA powder</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Sigma</td>
			<td>32205</td>
			<td>Make a 70% stock solution in which Doxycycline can be dissolved at 10 mg.mL-1</td>
		</tr>
		<tr>
			<td>Fastgene Gel/PCR DNA Extraction Kit</td>
			<td>Nippon Genetics</td>
			<td>FG-91302</td>
			<td>Any other kit is also fine</td>
		</tr>
		<tr>
			<td>HCl 37%</td>
			<td>Merck</td>
			<td>1.00317.1000</td>
			<td>To adjust pH of biotin stock solution</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Carl Roth</td>
			<td>6763</td>
			<td>Make a 500 mM stock solution, adjust the pH to 7.4</td>
		</tr>
		<tr>
			<td>Immobilon-FL PVDF membrane, 0.45&#160;&#181;m</td>
			<td>Millipore</td>
			<td>IPFL00010</td>
			<td>This membrane shows minimal autofluorescence when used with a LiCor Western blot scanning device</td>
		</tr>
		<tr>
			<td>LiCl</td>
			<td>Gr&#252;ssing GmbH</td>
			<td>12083</td>
			<td>Make a 5M stock solution</td>
		</tr>
		<tr>
			<td>Odyssey CLx imaging system</td>
			<td>LI-COR</td>
			<td>N/A</td>
			<td>To scan Western blot membrane decorated with fluorophore-labeled antibody</td>
		</tr>
		<tr>
			<td>Linear polyethylenimine (PEI)</td>
			<td>Polysciences</td>
			<td>23966-2</td>
			<td>Any other transfection reagent is also fine</td>
		</tr>
		<tr>
			<td>Milk powder</td>
			<td>Carl Roth</td>
			<td>T145</td>
			<td>To block Western blot membranes</td>
		</tr>
		<tr>
			<td>MluI-HF</td>
			<td>New England Biolabs</td>
			<td>R3198</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td>
		</tr>
		<tr>
			<td>Na-deoxycholate</td>
			<td>Sigma</td>
			<td>30970</td>
			<td>Make a 10% (w/v) stock solution</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma</td>
			<td>31434</td>
			<td>Make a 5M stock solution</td>
		</tr>
		<tr>
			<td>NP-40 (Nonidet P40 substitute)</td>
			<td>Sigma</td>
			<td>74385</td>
			<td>Make a 20% (v/v) stock solution</td>
		</tr>
		<tr>
			<td>PacI</td>
			<td>New England Biolabs</td>
			<td>R0547</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td>
		</tr>
		<tr>
			<td>Phosphate buffer saline (PBS)</td>
			<td>Sigma</td>
			<td>806552</td>
			<td>To wash cells before scrapping</td>
		</tr>
		<tr>
			<td>PmeI</td>
			<td>New England Biolabs</td>
			<td>R0560</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail</td>
			<td>Roche</td>
			<td>4693132001</td>
			<td>Added to the lysis buffer to prevent protein degradation</td>
		</tr>
		<tr>
			<td>pSF3-Flag-CBir-FRB_Myc-NBir-FKBP</td>
			<td>Addgene</td>
			<td>90003</td>
			<td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-CBir-FRB_FKBP-Myc-Nbir</td>
			<td>Addgene</td>
			<td>90004</td>
			<td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-FRB-Cbir_Myc-NBir-FKBP</td>
			<td>Addgene</td>
			<td>90008</td>
			<td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-FRB-Cbir_FKBP-Myc-Nbir</td>
			<td>Addgene</td>
			<td>90009</td>
			<td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>Q5 High-Fidelity PCR kit</td>
			<td>New England Biolabs</td>
			<td>E0555S</td>
			<td>To amplify the ORF coding for the proteins to be tested. Any other thermostable DNA polymerase is fine.</td>
		</tr>
		<tr>
			<td>Quick ligation kit</td>
			<td>New England Biolabs</td>
			<td>M2200S</td>
			<td>To ligate DNA fragments into the split-BioID plasmids, any other DNA ligation system is fine.</td>
		</tr>
		<tr>
			<td>RunBlue 4-20% SDS precast gels</td>
			<td>Expedeon</td>
			<td>BCG42012</td>
			<td>To use when running samples for MS analysis</td>
		</tr>
		<tr>
			<td>RunBlue LDS Sample Buffer</td>
			<td>Expedeon</td>
			<td>NXB31010</td>
			<td>Running buffer for the RunBlue precast gels</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Sigma</td>
			<td>5030</td>
			<td>Comes as a 20% stock solution</td>
		</tr>
		<tr>
			<td>tet-free serum</td>
			<td>Biowest</td>
			<td>S181T</td>
			<td>we use tet-free serum to minimize basal expression of the fusion proteins</td>
		</tr>
		<tr>
			<td>Trans-Blot Turbo Transfer system</td>
			<td>Bio-Rad</td>
			<td>1704150</td>
			<td>High speed Western blotting transfer system, any other transfer system is also fine</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Carl Roth</td>
			<td>4855</td>
			<td>Make 1M stock solutions with adequate pH (7.4 and 8)</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Applichem</td>
			<td>A4975</td>
			<td>Make a 20% (v/v) stock solution</td>
		</tr>
		<tr>
			<td>Tween-20</td>
			<td>Carl Roth</td>
			<td>9127</td>
			<td>Used in Western blot buffers, Tween 20 leads to high background fluorescence and should be omitted in the blocking and last wash step</td>
		</tr>
	</tbody>
</table>

split-bioid &#8212; proteomic analysis of context-specific protein complexes in their native cellular environment

להשלמת הזיקה הקיימת טיהור (AP) מתקרב לשם הזיהוי של אינטראקציות חלבון-חלבון (PPI), אנזימים הוכנסו המאפשרות תיוג תלויי-הקרבה של חלבונים בתאים חיים. אחד כזה האנזים, בירה * (בשימוש הגישה BioID), המעביר את biotinylation של חלבונים בטווח של 10 ננומטר. לפיכך, כאשר דבוקה חלבון עניין הביע בתאים, היא מאפשרת תיוג של proximal חלבונים בסביבתם הטבעית. בניגוד AP המסתמך על הטיהור של מתחמי חלבונים מורכבים, BioID מזהה חלבונים שסומנו בתוך התאים, לא משנה אם הם עדיין אינטראקציה עם החלבון עניין כאשר הם מבודדים. מאז זה biotinylates הפרוקסימלית חלבונים, אחד יכולים יתר על כן לנצל זיקתו יוצאת דופן של streptavidin עבור ביוטין לבודד אותם ביעילות רבה. בעוד BioID מבצע יותר טוב AP מזהים ארעי או אינטראקציות חלשות, שתי הגישות ספקטרומטר AP - ו BioID-המונית מספקים סקירה של כל האינטראקציות האפשריות שיש חלבון נתון. עם זאת, הם אינם מספקים מידע על ההקשר של כל PPI שזוהה. ואכן, רוב החלבונים הם בדרך כלל חלק מספר מתחמי, המייצגים שלבים ברורים ההבשלה או יחידות פונקציונליות שונות. כדי לטפל מגבלה זו משותפת של שתי השיטות, שתכננו assay קומפלמנטציה של חלבון-שברי בהתבסס על האנזים בירה *. ב הזה assay, שני קטעים לא פעיל של בירה * ניתן להרכיב מחדש לתוך אנזים פעיל כאשר הביא בסמיכות שני חלבונים שמעצבת שאליו הם מקובעים. וזמינותו פיצול-BioID וכתוצאה מכך ובכך מאפשר תיוג של חלבונים להרכיב סביב זוג של חלבונים אינטראקציה. בתנאי שני אלה רק אינטראקציה בהקשר נתון, פיצול-BioID מכן מאפשרת הניתוח של יחידות פונקציונליות ספציפית תלויי-ההקשר הסלולר בסביבתם הטבעית. כאן, אנו מספקים פרוטוקול שלב אחר שלב ולבחון חל פיצול-BioID זוג של חלבונים אינטראקציה.

כדי להמחיש כמה שיטה זו פועלת, מסגרות קריאה פתוחה (ORFs) של החלבונים Ago2, TNRC6C, לטעמים (הכל מעורב הגן בתיווך miRNA להשתיק לשביל) היו משובטים ב split-BioID פלסמידים. Ago2 ידוע כדי לקיים אינטראקציה עם TNRC6C בתוך miRNA-induced שתיקה קומפלקס (miRISC) represses תרגום ולעורר דעיכה של היעד mRNAs14. לפני כדי להרכיב את miRISC, Ago2 אינטראקציה עם לטעמים, האנזים שמייצר miRNAs בוגרת, בתוך מתחם שבו הוא עשוי לקבל טעון עם miRNA15. ומכאן הפיצול-BioID הוחל על הזוג Ago2/לטעמים או הזוג Ago2/TNRC6C. עבור כל זוג של חלבונים שנבדקו, Ago2 היה גם התמזגו NBirA * או CBirA * שימוש שלנו פלסמידים פיצול-BioID (איור 2), לטעמים, TNRC6C המקביל cognate בירה * קטע. בנוסף, כל חלבון הייתה דבוקה CBirA *, יחד עם NBirA *-GFP פיוז'ן כפקד שלילי. התוצאה בדיקות ארבע איטרציות עבור כל זוג של נבדק חלבון (טבלה 1).
כדי לבדוק אם פיצול-BioID מופעל על האינטראקציה של הזוג של חלבונים שנבדקו, עקבנו ערכת מתואר באיור1. פלסמידים היו transfected transiently קו ט-מערכת תואם התא הלה. הביטוי של החלבונים פיוז'ן הושרה עם דוקסיציקלין (dox), biotinylation היה מגורה על ידי הוספת ביוטין עודף מדיום הגידול. לאחר זמן הדגירה 20 h עם dox, ביוטין, התאים היו lysed, נותחו על ידי המערב סופג באמצעות streptavidin מצומדת לזהות חלבונים biotinylated. בתרבית של תאים, שתי להקות העיקריים הם בדרך כלל שזיהה את streptavidin מצומדת במדגם untransfected (איור 3, כוכבים) ומתייחסים אליהם endogenously biotinylated חלבונים (ככל הנראה מיטוכונדריאלי carboxylases). לצד להקות אלו קיימים כל דוגמאות והוא יכול לשמש בנוחות כפקדי הטעינה פנימי, לפיכך, הגילוי של חלבון משק הבית כדי לשלוט הטעינה של כמויות חלבון שווה הוא מיותר. אופייני עבור ניסוי BioID/פיצול-BioID, הלהקות הגדולות נוספים, זה יכול להיות שנצפו הם החלבונים פיוז'ן שיש העצמי-biotinylated. גם אם אין חלבונים biotinylated אחרות נתפסת, גילוי biotinylation של החלבונים פיוז'ן בשלב זה כבר מציין שני החלבונים שנבדקו תקשרתי בתאים. בניסוי המתואר באיור3, ברור כי בעל NBirA של *-חלבון כימרי Ago2 יחד עם CBirA * fusions TNRC6C או מקצץ יעיל יותר מאשר צירופי מול איזה CBirA *-Ago2 מזווג כדי NBirA * fusions של השניים האחרים חלבונים (איור 3, לוח העליון, להשוות עוצמות בשבילים 2-3 עד מסלולים 6-7). יתר על כן, ההפעלה הייתה ספציפית כמו אף אחד CBirA * fusions יכול להפעיל את NBirA *-GFP שליטה חלבון כימרי לרמות ניכר (איור 3, להשוות בין סמטאות 1, 4-5 ליין 8 שמתאים לתאים untransfected). מאז פלסמידים שלנו, NBirA * יש תג myc ו CBirA * יש תג דגל (איור 2), ניתן לנתח את רמות הביטוי של כל חלבון כימרי עם נוגדנים נגד אלה שני תגים (איור 3, החלונית התחתונה).
כאשר נוצרת אינטראקציה-induced biotinylation, הניסוי ניתן לשנות, החלבונים biotinylated מבודדת על חרוזים מצמידים streptavidin כמצוין בפסקה 4 של הפרוטוקול (איור 4). בעת ביצוע הבידוד בפעם הראשונה, כל השלבים של הטיהור עשוי להיות מנותח על ידי המערב סופג (איור 5). בדרך כלל, מחייב החרוזים צריך להיות כמותיים כמעט, כמעט אין דליפה דרך להתייחס בשוטף. ראש המנזר עיבוד הדגימות עבור ספקטרומטר מסה, אנו ממליצים פועל תספיג חלבון כדי להבטיח המושרה-biotinylation עבד כצפוי החלבונים פיוז'ן באו לידי ביטוי. העדר ביטוי החלבונים היתוך הוא עקב יעילות תרביות תאים עניים או אינדוקציה dox פגום או. אם החלבונים פיוז'ן באו לידי ביטוי, אך biotinylation לא נצפית, בדוק אם עודף ביוטין (50 μM) נוספה למעשה המדיום ביוטין מניות זה עדיין פעיל. כאשר החומר eluted ניתוח על ג'ל שהוכתמו Coomassie חלבון (איור 6), בדרך כלל, הלהקה הכי חזק להיות נצפתה בנכסיה 17 kDa, מקביל monomeric streptavidin. גם עלולים להיות שנצפו להקות התואם את החלבונים biotinylated אנדוגני וחלבונים פיוז'ן. . אנחנו נכנסים בדרך כלל האזור של השביל מדגם מעל הלהקה streptavidin עד ההעמסה טוב (איור 6). הלהקה נכרת יכול להיות מאוחסן צינור 1.5 מ ל ונשלח למתקן ספקטרומטר מסה. לחלופין, חלבונים מאוגד יכול להיות גם טריפסין-מעוכלים על החרוזים מצמידים streptavidin ויוצרים פפטידים מתעכל eluted את העמודה. אנו משתמשים באופן שגרתי את MaxQuant תוכנה16 (שימוש בעיקר ברירת המחדל בפרמטרים, תוך הוספת ליזין biotinylation post-translational שינוי אפשרי, ראה חומר עיון בנושא 9 לפרטים נוספים, לתוצאות MS טיפוסי) כדי לנתח את הנתונים הגולמיים של MS ו פרסאוס סוויטה17 עבור ניתוח סטטיסטי עוקבות, שניהם תוכנה חופשית. דוגמאות מופעלים בדרך כלל משכפל ביולוגי שלוש. באמצעות כימות ללא תווית, ניתן לזהות באופן ספציפי מועשר חלבונים על תנאי הבקרה. כדי לבצע סינון עבור endogenously biotinylated חלבונים, חלבונים המסומנות הלא ספציפית על ידי האנזים בירה *, אנו רואים רק חלבונים כי הם מועשרים באופן משמעותי על להיטים מתוך שישה datasets שנוצר עם שישה חלבונים לא קשורים. בנוסף, אנו רואים רק כניסות מועשרים מעל dataset פיצול-BioID שבו פיוז'ן החלבונים NBirA * הוחלפו על-ידי NBirA *-GFP. אסטרטגיות ניתוח נתונים אחרים הוצעו בעיקר באמצעות איזוטופ יציב תיוג עם חומצות אמינו בתרבות תא (SILAC) עבור פרוטאומיקס כמותיים18. בנוסף, אסטרטגיות שונות תוארו של בידוד ישיר של פפטידים biotinylated באמצעות משתנה streptavidin עם זיקה חלשה ביוטין18, תנאים מיוחדים • תנאי שימוש בממסים אורגניים19 או ספציפיים ביוטין נוגדנים20,21. בזמן לא בהכרח מובילים לגילוי של חלבונים נוספים, זיהוי אתרים biotinylation להוסיף יותר ביטחון לגבי יחודיות של הלהיטים, היא שימושית בעת מיעון את הטופולוגיה של אינטראקציה.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57479/57479fig1.jpg"> איור 1: סקירה של ההליך פיצול-BioID. חלבון 1 אינטראקציה עם חלבון 2 חלק א מורכבים, או עם חלבון 3 חלק ב' מורכב לחקור באופן ספציפי את ההרכב של מורכבות A, ניתן להחיל פיצול-BioID חלבונים 1 ו- 2. הצילום של ספקטרומטר מסה תחת רישיון יצירתי של מלאי ייחוס-שיתוף כאחד 3.0 לא מותאם, שהורד מן https://commons.wikimedia.org עם שם קובץ של ThermoScientificOrbitrapElite.JPG. <a href="/files/ftp_upload/57479/57479fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57479/57479fig2.jpg"> איור 2: ביטוי קלטות של פלסמידים פיצול-BioID. אנו מספקים פלסמידים ארבע כדי לאפשר בדיקה כל השילובים של NBirA *, CBirA * פיוז'ן חלבונים. פלסמידים ומפות מלא הינם זמינים addgene.org תחת המספרים המצוינים. פלסמידים יש אלמנט מגיב טט (7 x tetO), צריך לשמש קו תא התואמת המערכת ביטוי ט. גם שים לב ב פלסמידים כל ORFs של FKBP ואת FRB הם התמזגו כדי NBirA *, CBirA * קטעים בהתאמה. אלה שני חלבונים אינטראקציה רק בנוכחות rapamycin, ומכאן פלסמידים יכול לשמש כדי לבדוק במהירות את המערכת נוכחות או העדר הזה כימי9. האתרים הגבלת המצוין הם ייחודיים. <a href="/files/ftp_upload/57479/57479fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57479/57479fig3.jpg"> איור 3: כתם המערבי הטיפוסי עבור ניסוי פיצול-BioID. פאנל עליון: זיהוי של חלבונים biotinylated עם streptavidin fluorescently עם תוויות. החלונית התחתונה: זיהוי של החלבונים פיוז'ן עם נוגדנים אנטי-Myc ודגל אנטי. שני זוגות של חלבונים נבדקו: Ago2/TNRC6C ו- Ago2/לטעמים. בנתיבים 2 & 3, Ago2 היה מצורף למקטע CBirA *. בנתיבים 6 & 7, Ago2 היה מצורף למקטע NBirA *. אין אות משמעותי נצפתה כאשר כל אחד החלבונים 3 משולב עם NBirA *-GFP (מסלולים 1, 4-5). הכוכבים מציינים הלהקות המתאים endogenously חלבונים biotinylated יכול לשמש כפקדי הטעינה פנימי. נתון זה ממאמרו של איור 5B של. Schopp et al. 9 תחת רישיון יצירתי של מלאי ייחוס 4.0 הבינלאומי. <a href="/files/ftp_upload/57479/57479fig3large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57479/57479fig4.jpg"> איור 4: סקירה של ההליך טלסין (pulldown) streptavidin. מתוארים שלבים עיקריים בידוד של חלבונים biotinylated לניתוח ספקטרומטר מסה. <a href="/files/ftp_upload/57479/57479fig4large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57479/57479fig5.jpg"> איור 5: כתם המערבי הטיפוסי עבור ניסוי טלסין (pulldown) streptavidin. שווה כרכים של כל מדגם המצוין נטענו על ג'ל מרחביות-לזיהוי. בעקבות סופג המערבי, biotinylated חלבונים אותרו מצמידים HRP streptavidin. להקות המתאים NBirA *-TNRC6C ו- CBirA *-Ago2 מצוינים. <a href="/files/ftp_upload/57479/57479fig5large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57479/57479fig6.jpg"> איור 6: חלבון שהוכתמו טיפוסי Coomassie ג'ל לניתוח ספקטרומטר מסה. המדגם eluted של חרוזים מצמידים streptavidin היה טעון על ג'ל חלבון precast, לרוץ עד המדגם להעביר 2-3 ס מ. הלהקה הגדולים לראותם 17 kDa הוא streptavidin. האזור ישירות מעל הלהקה הזאת היא טוחנות ושלח למתקן ספקטרומטר מסה. להקות המתאים NBirA *-TNRC6C ו- CBirA *-Ago2 מצוינים. <a href="/files/ftp_upload/57479/57479fig6large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>תרביות תאים מדגם</td>
			<td colspan="3">תנאי נבדק</td>
		</tr>
<tr>
<td>1</td>
			<td colspan="3">NBirA *-protein1 / CBirA *-protein2</td>
		</tr>
<tr>
<td>2</td>
			<td colspan="3">CBirA *-protein1 / NBirA *-protein2</td>
		</tr>
<tr>
<td>3</td>
			<td colspan="3">NBirA *-GFP / CBirA *-protein1</td>
		</tr>
<tr>
<td>4</td>
			<td colspan="3">NBirA *-GFP / CBirA *-protein2</td>
		</tr>
<tr>
<td>5</td>
			<td colspan="3">אין תקנים</td>
		</tr>
</tbody></table>טבלה 1: בדרך כלל נבדק בתנאים בשעת החלת פיצול-BioID על שני חלבונים.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>רצף פריימר</td>
			<td>רצף</td>
		</tr>
<tr>
<td>קלטת 1 הפוך פריימר (CBirA * fusion)</td>
			<td>TATACTTTCTAGAGAATAGGAAC</td>
		</tr>
<tr>
<td>קלטת 2 פריימר הפוכה (NBirA * fusion)</td>
			<td>GTGGTTTGTCCAAACTCATC</td>
		</tr>
</tbody></table>טבלה 2: קביעת רצף צבעי יסוד פלסמידים פיצול-BioID.

Watch this Scientific Journal Video about Split-BioID Ã¢â‚¬â€ Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment at JoVE.com

Split-BioID ÃƒÆ’Ã‚Â¢ÃƒÂ¢Ã¢â‚¬Å¡Ã‚Â¬ÃƒÂ¢Ã¢â€šÂ¬Ã‚Â Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

אנו מספקים פרוטוקול צעד אחר צעד עבור פיצול-BioID, שיטת שברי-קומפלמנטציה מבוסס על טכניקת קרבה-תיוג BioID. מופעל על האינטראקציה של שני חלבונים נתונה, היא מאפשרת ניתוח פרוטאומיקס של חלבונים תלויי-ההקשר מתחמי הסלולר בסביבתם הטבעית. השיטה היא פשוטה, חסכונית ודורש רק ציוד מעבדה סטנדרטיים.

פיצול-BioID — ניתוח פרוטיאומיה מבנית של חלבון ספציפי ההקשר מתחמי הסלולר בסביבתם הטבעית

To complement existing affinity purification (AP) approaches for the identification of protein-protein interactions (PPI), enzymes have been introduced ...

Research

JoVE Journal

Biochemistry

Split-BioID &#8212; Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

Identification of Small Molecule-binding Proteins in a Native Cellular Environment by Live-cell Photoaffinity Labeling

זיהוי של חלבונים קושרי מולקולה קטנים בסביבה נייד Native ידי תיוג Live- תא Photoaffinity

Identifying the molecular target(s) of small molecules is a challenging but necessary step towards understanding their mechanism of action. While several ...

Synthesis of 1,2-Azaborines and the Preparation of Their Protein Complexes with T4 Lysozyme Mutants

סינתזה של 1,2-Azaborines ואת ההכנה של קומפלקסי החלבונים שלהם עם מוטאנטים ליזוזים T4

We describe a general synthesis of 1,2-azaborines using standard air-free techniques and protein complex preparation with T4 lysozyme mutants by vapor ...

Tandem Affinity Purification of Protein Complexes from Eukaryotic Cells

טיהור טנדם זיקה של קומפלקסי חלבונים מתאים איקריוטיים

The purification of active protein-protein and protein-nucleic acid complexes is crucial for the characterization of enzymatic activities and de novo ...

Resolving Affinity Purified Protein Complexes by Blue Native PAGE and Protein Correlation Profiling

פתרון מתחמי פרוטאין טהור זיקה לפי דף Native הכחול פרופיל מתאם חלבון

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological ...

Horizontal Gel Electrophoresis for Enhanced Detection of Protein-RNA Complexes

ג &#39;ל אופקי אלקטרופורזה לאיתור משופרת של חלבונים-רנ&quot;א קומפלקסים

Native polyacrylamide gel electrophoresis is a fundamental tool of molecular biology that has been used extensively for the biochemical analysis of ...

Dissection of Human Retina and RPE-Choroid for Proteomic Analysis

דיסקציה של הרשתית האנושית ואת RPE-Choroid לניתוח פרוטיאומיה מבנית

The human retina is composed of the sensory neuroretina and the underlying retinal pigmented epithelium (RPE), which is firmly complexed to the vascular ...

2 in 1: One-step Affinity Purification for the Parallel Analysis of Protein-Protein and Protein-Metabolite Complexes

2 ב 1: בשלב אחד טיהור זיקה לניתוח מקבילים של חלבון, מתחמי חלבון-מטבוליט

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of ...

Analysis of Thylakoid Membrane Protein Complexes by Blue Native Gel Electrophoresis

ניתוח של מתחמי חלבון ממברנה תילקואיד מאת כחול מקורי אלקטרופורזה בג'ל

Photosynthetic electron transfer chain (ETC) converts solar energy to chemical energy in the form of NADPH and ATP. Four large protein complexes embedded ...

Proteomic Analysis of Human Macrophage Polarization Under a Low Oxygen Environment

ניתוח פרוטיאומיה מבנית של קיטוב מקרופאג האנושי תחת סביבה חמצן נמוך

Macrophages are innate immune cells involved in a number of physiological functions ranging from responses to infectious pathogens to tissue homeostasis. ...

Analysis of Protein Folding, Transport, and Degradation in Living Cells by Radioactive Pulse Chase

ניתוח של קיפול חלבונים, תחבורה, והשפלה בתאים חיים על ידי הדופק רדיואקטיבי צ'ייס

Radioactive pulse-chase labeling is a powerful tool for studying the conformational maturation, the transport to their functional cellular location, and ...