Name: evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts
Uploaded: 2018-05-11T14:30:00
Description: Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

Les auteurs remercient Nicole McRorie pour aider avec les expériences. Ce travail a été soutenu par la faculté de l’Université de l’Alberta de médecine et dentisterie, Slipchuk SMA subvention de recherche de recherche Fondation, les instituts de recherche en santé du Canada (IRSC), les amis du Fonds de recherche de Cumming de Garrett, HM Toupin neurologique Fonds de la recherche scientifique, la dystrophie musculaire Canada, la Fondation canadienne pour l’Innovation, entreprise de l’Alberta et l’enseignement postsecondaire et les femmes et les enfants Health Research Institute (WCHRI).

1. culture cellulaire
<ol><li>Fibroblastes patients de SMA de la culture dans le milieu (Dulbecco modifié Eagle moyen 1:1-12 (jambon) avec 10 % sérum fœtal (SVF) et 0,5 % pénicilline/streptomycine) dans un incubateur à CO2 à 37 ° C.</li>
	<li>Déterminer la concentration de cellules à l’aide d’un compteur de cellules automatisées et diluer les cellules à 1 x 105 cellules/mL dans le milieu de croissance, puis les semences sur la plaque appropriée. Utiliser 12 plats (1 mL / puits) pou...

<ol>
	<li>Iascone, D. M., Henderson, C. E., Lee, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+muscular+atrophy:+from+tissue+specificity+to+therapeutic+strategies.">Spinal muscular atrophy: from tissue specificity to therapeutic strategies.</a> F1000Prime Rep. 7, 4 (2015).</li><li>Touznik, A., Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+developments+in+exon+skipping+and+splice+modulation+therapies+for+neuromuscular+diseases.">New developments in exon skipping and splice modulation therapies for neuromuscular diseases.</a> Expert Opin Biol Ther. 14 (6), 809-819 (2014).</li><li>Lefebvre, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+Characterization+of+a+Spinal+Muscular+Atrophy-Determining+Gene.">Identification and Characterization of a Spinal Muscular Atrophy-Determining Gene.</a> Cell. 80 (1), 155-165 (1995).</li><li>Lorson, C. L., Hahnen, E., Androphy, E. J., Wirth, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+in+the+SMN+gene+regulates+splicing+and+is+responsible+for+spinal+muscular+atrophy.">A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 96 (11), 6307-6311 (1999).</li><li>Monani, U. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+difference+that+alters+splicing+patterns+distinguishes+the+SMA+gene+SMN1+from+the+copy+gene+SMN2.">A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2.</a> Hum Mol Genet. 8 (7), 1177-1183 (1999).</li><li>Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+therapy+in+neurology.">Antisense therapy in neurology.</a> J Pers Med. 3 (3), 144-176 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Ther. 27 (2), 67-69 (2017).</li><li>Hua, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peripheral+SMN+restoration+is+essential+for+long-term+rescue+of+a+severe+spinal+muscular+atrophy+mouse+model.">Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model.</a> Nature. 478 (7367), 123-126 (2011).</li><li>Hua, Y., Vickers, T. A., Baker, B. F., Bennett, C. F., Krainer, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+SMN2+exon+7+inclusion+by+antisense+oligonucleotides+targeting+the+exon.">Enhancement of SMN2 exon 7 inclusion by antisense oligonucleotides targeting the exon.</a> PLoS Biol. 5 (4), 73 (2007).</li><li>Passini, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+oligonucleotides+delivered+to+the+mouse+CNS+ameliorate+symptoms+of+severe+spinal+muscular+atrophy.">Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy.</a> Sci Transl Med. 3 (72), (2011).</li><li>Hammond, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+peptide-mediated+oligonucleotide+therapy+improves+long-term+survival+in+spinal+muscular+atrophy.">Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 113 (39), 10962-10967 (2016).</li><li>Porensky, P. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+administration+of+morpholino+antisense+oligomer+rescues+spinal+muscular+atrophy+in+mouse.">A single administration of morpholino antisense oligomer rescues spinal muscular atrophy in mouse.</a> Hum Mol Genet. 21 (7), 1625-1638 (2012).</li><li>Touznik, A., Maruyama, R., Hosoki, K., Echigoya, Y., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA/DNA+mixmer-based+antisense+oligonucleotides+correct+alternative+splicing+of+the+SMN2+gene+and+restore+SMN+protein+expression+in+type+1+SMA+fibroblasts.">LNA/DNA mixmer-based antisense oligonucleotides correct alternative splicing of the SMN2 gene and restore SMN protein expression in type 1 SMA fibroblasts.</a> Sci Rep. 7 (1), 3672 (2017).</li><li>Obika, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2'-O,4'-C-methyleneuridine+and+-cytidine.+Novel+bicyclic+nucleosides+having+a+fixed+C-3,-endo+sugar+puckering.">Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C-3,-endo sugar puckering.</a> Tetrahedron Letters. 38 (50), 8735-8738 (1997).</li><li>Singh, S. K., Nielsen, P., Koshkin, A. A., Wengel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA+(locked+nucleic+acids):+synthesis+and+high-affinity+nucleic+acid+recognition.">LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition.</a> Chemical Communications. (4), 455-456 (1998).</li><li>Navarro, E., Serrano-Heras, G., Castano, M. J., Solera, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+detection+chemistry.">Real-time PCR detection chemistry.</a> Clin Chim Acta. 439, 231-250 (2015).</li><li>Urbanek, M. O., Nawrocka, A. U., Krzyzosiak, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+RNA+Detection+by+in+Situ+Hybridization+Methods.">Small RNA Detection by in Situ Hybridization Methods.</a> Int J Mol Sci. 16 (6), 13259-13286 (2015).</li><li>Wahlestedt, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+nontoxic+antisense+oligonucleotides+containing+locked+nucleic+acids.">Potent and nontoxic antisense oligonucleotides containing locked nucleic acids.</a> Proc Natl Acad Sci U S A. 97 (10), 5633-5638 (2000).</li><li>Rupaimoole, R., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+therapeutics:+towards+a+new+era+for+the+management+of+cancer+and+other+diseases.">MicroRNA therapeutics: towards a new era for the management of cancer and other diseases.</a> Nat Rev Drug Discov. 16 (3), 203-222 (2017).</li><li>Lanford, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+silencing+of+microRNA-122+in+primates+with+chronic+hepatitis+C+virus+infection.">Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection.</a> Science. 327 (5962), 198-201 (2010).</li><li>Shimo, T., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designing+Effective+Antisense+Oligonucleotides+for+Exon+Skipping.">Designing Effective Antisense Oligonucleotides for Exon Skipping.</a> Methods Mol Biol. 1687, 143-155 (2018).</li><li>Shimo, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+evaluation+of+locked+nucleic+acid-based+splice-switching+oligonucleotides+in+vitro.">Design and evaluation of locked nucleic acid-based splice-switching oligonucleotides in vitro.</a> Nucleic Acids Res. 42 (12), 8174-8187 (2014).</li><li>Nguyen, Q., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+Muscle+Cell+Model+to+Test+the+Exon+Skipping+Efficacy+for+Duchenne+Muscular+Dystrophy.">Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy.</a> J. Pers. Med. 7 (4), 13 (2017).</li><li>Echigoya, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+Antisense+Screening+and+Optimization+for+Exon+51+Skipping+in+Duchenne+Muscular+Dystrophy.">Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.</a> Mol Ther. , (2017).</li><li>Saito, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+PMO+found+in+dystrophic+dog+model+was+effective+in+cells+from+exon+7-deleted+DMD+patient.">Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient.</a> PLoS One. 5 (8), 12239 (2010).</li><li>Donnelly, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+murine+model+of+SMA.">Characterization of a murine model of SMA.</a> Neurobiol Dis. 45 (3), 992-998 (2012).</li><li>Lim, K. R., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eteplirsen+in+the+treatment+of+Duchenne+muscular+dystrophy.">Eteplirsen in the treatment of Duchenne muscular dystrophy.</a> Drug Des Devel Ther. 11, 533-545 (2017).</li><li>Paton, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nusinersen:+antisense+oligonucleotide+to+increase+SMN+protein+production+in+spinal+muscular+atrophy.">Nusinersen: antisense oligonucleotide to increase SMN protein production in spinal muscular atrophy.</a> Drugs Today (Barc). 53 (6), 327-337 (2017).</li><li>Prakash, T. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparing+in+vitro+and+in+vivo+activity+of+2'-O-[2-(methylamino)-2-oxoethyl]-+and+2'-O-methoxyethyl-modified+antisense+oligonucleotides.">Comparing in vitro and in vivo activity of 2'-O-[2-(methylamino)-2-oxoethyl]- and 2'-O-methoxyethyl-modified antisense oligonucleotides.</a> J Med Chem. 51 (9), 2766-2776 (2008).</li><li>Aoki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bodywide+skipping+of+exons+45-55+in+dystrophic+mdx52+mice+by+systemic+antisense+delivery.">Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery.</a> Proc Natl Acad Sci U S A. 109 (34), 13763-13768 (2012).</li></ol>

La méthode évaluation in vitro décrite ici est rapide, facile et assez sensible pour l’essai des plus diverses. Ce protocole est largement applicable à exon skipping et l’inclusion d’autres gènes et divers types de cellules. En outre, la plupart chimies AON (sauf PMOs) peuvent transfecter à l’aide de cette méthode. Nao peut réglementer l’épissage d’un pré-ARNm des gènes endogènes et artificiellement introduits et peut être co-transfectées avec des vecteurs de plasmide porteur de gènes ...

Atrophie musculaire spinale (SMA) est un trouble neuromusculaire mortels hérité dans une transmission autosomique récessive. Elle est caractérisée par la dégradation des neurones moteurs et tronc progressive et branche musculaire paralysie1,2. La majorité des événements de SMA est due à une mutation homozygote dans le gène de la survie des neurones moteurs 1 (SMN1)3. Le gène de la survie des neurones moteurs 2 (SMN2) est un doublon inverse du SMN1et a une séquence presque identique différant par seulement cinq bases4,5. Une transition de C-à-T en SMN2 situé dans l’exon 7 rend le gène presque ne fonctionne pas parce que la mutation conduit à l’essentiel exon 7 étant exclu dans près de 90 % des transcriptions de SMN2 (Figure 1a). MRNA SMN2 manquant exon 7 ne peut pas compenser la fonction SMN1 parce que son produit protéique est instable et se dégrade rapidement.
La thérapie antisense a récemment émergé comme une stratégie prometteuse pour le traitement des SMA6. La récente approbation de nusinersen par la U.S. Food et pharmaceutiques (FDA) en fait le premier médicament disponible pour traiter la SMA7. Nusinersen est un oligonucléotide antisens 18-mer (AON) avec une modification de la 2 '-O-methoxyethyl (MOE) et une colonne vertébrale phosphorothioate. Le médicament cible le silencieux épissage intronic N1 (ISS-N1) situé dans l’intron 7 du gène SMN2 . Liaison de la nusinersen à ISS-N1 favorise la récupération de l’expression des protéines SMN pleine longueur fonctionnelle du gène SMN2 endogène en induisant l’exon 7 inclusion (Figure 1a)8,9,10 . Actuellement, de nombreuses études portant sur la thérapie AON pour SMA se concentrent sur l’étude des chimies AON roman qui peuvent être plus efficace et moins toxique que nusinersen. Il a été démontré que Nao avec autres chimies induire aussi efficacement inclusion exon dans l’exon SMN2 7 fois in vitro et in vivo11,12,13.
Acides nucléiques verrouillés (LNA) sont des analogues de RNA chimiquement modifiés contenant un pont méthylène reliant le 4′ -carbone avec la 2′ -oxygène dans les furanoses structure (Figure 1b)14,15. Comparé à l’ADN ou d’ARN, LNA ont une affinité accrue pour la liaison aux séquences d’ARN complémentaires et ont l’avantage d’être très résistant aux nucléases endogènes. La chimie de la LNA a été appliquée pour une utilisation comme sondes d’hybridation in situ par fluorescence (FISH) et qPCR16,17. Par ailleurs, il est utilisé pour réguler l’expression génique in vitro et in vivo. GapmeR Nao sont une combinaison de molécules d’ADN simple brin flanqué de LNA plusieurs extrémités 5′ et 3′. Ils démantèlent l’expression des gènes en se liant complémentaires de l’ARNm ciblés, obligeant à être dégradé par les activés de la RNase H18. Mixmers LNA/ADN sont Nao qui se composent de nucléotides d’ADN intégrés entre LNA. Présenté dans cette orientation ils peuvent lier miRNA inhibe sa fonction (LNA-antimiR)19. Certains LNA-antimiRs ont atteint le développement clinique. Pour obtenir des exemples, miravirsen (AntimiR-122) est un LNA-antimiR qui inhibe miR-122 pour traiter l’infection par le virus de l’hépatite C et plusieurs essais cliniques de Phase II sont actuellement en cours de19,20. Récemment, il a été démontré que LNA/ADN mixmers peut aussi moduler RNA épissage21. Il peut lier une séquence spécifique d’ADN messagère et induire exon skipping en dystrophine ARNm et exon inclusion dans SMN2 mRNA in vitro13,22.
Dans cet article, nous décrivons une méthodologie pour l’induction de l’inclusion d’exon à l’aide de la NAO et l’évaluation de l’efficacité au niveau de l’ARN et de protéine. Pour illustrer cette méthode, nous avons utilisé le mixmers LNA/ADN ciblage ISS-N1 dans l’intron 7 de SMN2. Nao transfectés dans des cellules de patients de SMA par lipotransfection induite par l’inclusion d’exon 7 dans la transcription finale de SMN2 et l’augmentation de la production de protéine SMN. Un des avantages d’à l’aide de LNA/ADN mixmers pour induire l’inclusion de l’exon est que la concentration effective pour la transfection est significativement plus faible que les autres chimies13. Cette méthode peut être utilisée pour de nombreux autres Nao sauf phosphorodiamidate morpholino oligomères (OMP), qui, en raison de leur charge neutre, doivent entrer dans les cellules par endocytose induite par le réactif de transfection co Endo-Porter.

<table border="0" cellpadding="0" cellspacing="0" style="width:655px;" width="655">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">SMA Fibroblasts</td>
			<td style="width:153px;">Coriell NIGMS human genetic cell repository</td>
			<td style="width:119px;">GM03813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">11320033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">F1051</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Penicillin-Streptomycin (10,000 U/mL)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15140122</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.05%), phenol red</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">25300062</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Serum-deprived media</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">31985070</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Transfection reagent</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15338100</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">guanidinium thiocyanate-phenol-chloroform (TRIzol)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15596-018</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">RT-PCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>Sequence 5&#39; to 3&#39;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTGCCTCCATTTCCTTCTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TGGTGTCATTTAGTGCTGCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCCCTGAGCTGAACGGGAAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GGAGGAGTTTGGTCGCTGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">qPCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCTATCATACTGGCTATTATATGGGTTTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTCTATGCCAGCATTTCTCCTTAAT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCTGGACCACCAATAATTCCCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>ATGCCAGCATTTCCATATAATAGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCAAATTCCATGGCACCGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>AGGGATCTCGCTCCTGGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chloroform</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">P3803</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glycogen, RNA grade</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">R0551</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">ImageJ Software</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Protease cocktail inhibitor&#160;</td>
			<td style="width:153px;">Roche</td>
			<td style="width:119px;">11836153001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cathode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.025 M Tris base + 40&#160;mM 6-aminocaproic acid + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.03 M Tris Base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Concentred Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.3 M Tris base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Beta Mercaptoethanol&#160;</td>
			<td style="width:153px;">Millipore</td>
			<td style="width:119px;">ES-007-E</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PVDF membrane&#160;</td>
			<td style="width:153px;">GE</td>
			<td style="width:119px;">10600021</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Loading/sample buffer for Western blotting</td>
			<td style="width:153px;">NuPage Invitrogen</td>
			<td style="width:119px;">NP007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">One-Step RT-PCR kit&#160;</td>
			<td style="width:153px;">Qiagen&#160;</td>
			<td style="width:119px;">210210</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">dNTPs</td>
			<td style="width:153px;">Clontech</td>
			<td style="width:119px;">3040</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts

Atrophie musculaire spinale (SMA), une maladie neurologique mortelle causée par la perte du SMN1, présente un cas unique dans le domaine des oligonucléotides antisens (AON)-médiation thérapeutique. Tandis que SMN1 mutations sont responsables de la maladie, Nao ciblant les sites d’épissage intronic silencieux (ISS) SMN2, y compris nusinersen approuvé par la FDA, a été démontré pour restaurer expression SMN et atténuer les symptômes. Actuellement, de nombreuses études portant sur la thérapie AON pour SMA se concentrent sur l’étude des nouvelles chimies AON ciblage SMN2 qui peut être plus efficace et moins toxique que nusinersen. Nous décrivons ici un protocole pour l’évaluation de in vitro de l’inclusion d’exon à l’aide de lipotransfection de Nao, suivie de la chaîne par polymérase transcription inverse (RT-PCR), PCR quantitative (qPCR) et Western Blot. Cette méthode peut être utilisée pour différents types de chimies AON. En utilisant cette méthode, nous démontrons que Nao composé d’alternance des acides nucléiques verrouillés (LNA) et nucléotides de l’ADN (LNA/ADN mixmers) conduisent à efficace de SMN2 exon inclusion et de restauration des protéines SMN à une concentration très faible et par conséquent, LNA / Oligonucléotides antisens axée sur les mixmer de l’ADN peuvent être une stratégie thérapeutique séduisante pour traiter l’épissage défauts causés par des maladies génétiques. La méthode évaluation in vitro décrite ici est rapide, facile et assez sensible à l’essai de divers nouveaux NAO.

À l’aide de fibroblastes de patients SMA, nous avons ciblé la région ISS-N1 de silencieux dans l’intron 7 du gène SMN2 avec huit mixmers LNA/ADN antisens différents qui ont été transfectées à une concentration de nM 5 (Figure 3). Chacun de la mixmers contenait un squelette mis à jour le phosphorothioated qui leur a permis de résister à la détérioration de la nucléase. Pour évaluer l’efficacité de le mixmers, le taux de SMN2...

Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

Évaluation de l’Inclusion d’Exon induite par Splice commutation oligonucléotides antisens de fibroblastes de patients de SMA

Induire l’inclusion exon (modulation d’épissure) et expression de SMN pour l’atrophie musculaire spinale (SMA) de sauvetage ont démontré différents oligonucléotides antisens (NAO). Nous décrivons ici un protocole pour lipotransfection AON induire l’inclusion d’exon du gène SMN2 et les méthodes d’évaluation pour déterminer l’efficacité chez les patients fibroblastes SMA.

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide ...

Research

JoVE Journal

Medicine

Vascular Occlusion Training for Inclusion Body Myositis: A Novel Therapeutic Approach

Formation occlusion vasculaire des myosites à inclusions: une nouvelle approche thérapeutique

Inclusion body myositis (IBM) is a rare idiopathic inflammatory myopathy. It is known to produces remarkable muscle weakness and to greatly compromise ...

Recherche

Médecine

Experimental Generation of Carcinoma-Associated Fibroblasts (CAFs) from Human Mammary Fibroblasts

Experimental Generation of Carcinoma-Associated Fibroblasts CAFs from Human Mammary Fibroblasts

Génération expérimentale de carcinome Associated fibroblastes (CAF) à partir des fibroblastes mammaires

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of ...

Mouse Model of Intraluminal MCAO: Cerebral Infarct Evaluation by Cresyl Violet Staining

Modèle murin d&#39;MCAO intraluminale: Évaluation infarctus cérébral par coloration au violet de crésyl

Stroke is the third  cause of mortality and the leading cause of disability in the World. Ischemic  stroke accounts for approximately 80% of all strokes. ...

Cardiac Stress Test Induced by Dobutamine and Monitored by Cardiac Catheterization in Mice

Test de stress cardiaque induite par la dobutamine et surveillé par cathétérisme cardiaque chez la souris

Dobutamine is a &beta;-adrenergic agonist with an affinity higher for receptor expressed in the heart (&beta;1) than for receptors expressed in the ...

Evaluation of Lung Metastasis in Mouse Mammary Tumor Models by Quantitative Real-time PCR

Évaluation des métastases pulmonaires chez la souris tumeur mammaire modèles par PCR quantitative en temps réel

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated ...

Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy

Multi-exon Sauter Utilisation Oligonucleotides Cocktail antisens dans la dystrophie musculaire Canine liée à l&#39;X

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon ...

A Model of Glaucoma Induced by Circumlimbal Suture in Rats and Mice

Un modèle de glaucome induit par la Suture Circumlimbal chez le rat et la souris

The circumlimbal suture is a technique for inducing experimental glaucoma in rodents by chronically elevating intraocular pressure (IOP), a well-known ...

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Analyse quantitative [18F]-Naf-PET-MRI pour l'évaluation du chiffre d'affaires dynamique d'os dans un patient présentant la douleur lombaire facetogenic

Imaging techniques that reflect dynamic bone turnover may aid in characterizing a wide range of bone pathologies. Bone is a dynamic tissue undergoing ...

Invasive Hemodynamic Assessment for the Right Ventricular System and Hypoxia-Induced Pulmonary Arterial Hypertension in Mice

Évaluation hémodynamique invasive pour le système ventriculaire droit et l'hypertension artérielle pulmonaire induite par l'hypoxie chez les souris

Pulmonary arterial hypertension (PAH) is a chronic and severe cardiopulmonary disorder. Mice are a popular animal model used to mimic this disease. ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

Caractérisation de l’efficacité de saut d’Exon dans les échantillons de patients de DMD dans les essais cliniques d’oligonucléotides d’Antisense

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...