Name: evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts
Uploaded: 2018-05-11T14:30:00
Description: Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

המחברים תודה ניקול McRorie להזעיק עזרה עם הניסויים. עבודה זו נתמכה על ידי אוניברסיטת אלברטה הפקולטה לרפואה, רפואת שיניים, Slipchuk SMA מחקר קרן מחקר גרנט, את קנדי מוסדות של הבריאות מחקר (CIHR), וקרנות חברים של גארט קאמינג מחקר, HM Toupin נוירולוגי וקרנות מחקר מדעי, בית קנדה ניוון שרירים, קרן קנדה חדשנות, אלברטה ארגוני חינוך מתקדם, ואת הנשים ואת לילדים הבריאות מכון המחקר (WCHRI).

1. תרבית תאים
<ol><li>תרבות SMA fibroblasts החולה במצע הגידול (של Dulbecco שונה נשר בינוני 1: 1 F-12 (Ham) עם 10% סרום שור עוברית (FBS) ו- 0.5% פניצילין/סטרפטומיצין) ב חממה2 CO ב 37 º C.</li>
	<li>לקבוע ריכוז התא באמצעות מונה הניתן תא אוטומטיות, לדלל לתאים עונה 1 פרק 105 תאים למ"ל מדיום הגידול, ואז הזרעים בצלחת המתאימה....

<ol>
	<li>Iascone, D. M., Henderson, C. E., Lee, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+muscular+atrophy:+from+tissue+specificity+to+therapeutic+strategies.">Spinal muscular atrophy: from tissue specificity to therapeutic strategies.</a> F1000Prime Rep. 7, 4 (2015).</li><li>Touznik, A., Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+developments+in+exon+skipping+and+splice+modulation+therapies+for+neuromuscular+diseases.">New developments in exon skipping and splice modulation therapies for neuromuscular diseases.</a> Expert Opin Biol Ther. 14 (6), 809-819 (2014).</li><li>Lefebvre, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+Characterization+of+a+Spinal+Muscular+Atrophy-Determining+Gene.">Identification and Characterization of a Spinal Muscular Atrophy-Determining Gene.</a> Cell. 80 (1), 155-165 (1995).</li><li>Lorson, C. L., Hahnen, E., Androphy, E. J., Wirth, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+in+the+SMN+gene+regulates+splicing+and+is+responsible+for+spinal+muscular+atrophy.">A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 96 (11), 6307-6311 (1999).</li><li>Monani, U. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+difference+that+alters+splicing+patterns+distinguishes+the+SMA+gene+SMN1+from+the+copy+gene+SMN2.">A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2.</a> Hum Mol Genet. 8 (7), 1177-1183 (1999).</li><li>Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+therapy+in+neurology.">Antisense therapy in neurology.</a> J Pers Med. 3 (3), 144-176 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Ther. 27 (2), 67-69 (2017).</li><li>Hua, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peripheral+SMN+restoration+is+essential+for+long-term+rescue+of+a+severe+spinal+muscular+atrophy+mouse+model.">Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model.</a> Nature. 478 (7367), 123-126 (2011).</li><li>Hua, Y., Vickers, T. A., Baker, B. F., Bennett, C. F., Krainer, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+SMN2+exon+7+inclusion+by+antisense+oligonucleotides+targeting+the+exon.">Enhancement of SMN2 exon 7 inclusion by antisense oligonucleotides targeting the exon.</a> PLoS Biol. 5 (4), 73 (2007).</li><li>Passini, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+oligonucleotides+delivered+to+the+mouse+CNS+ameliorate+symptoms+of+severe+spinal+muscular+atrophy.">Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy.</a> Sci Transl Med. 3 (72), (2011).</li><li>Hammond, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+peptide-mediated+oligonucleotide+therapy+improves+long-term+survival+in+spinal+muscular+atrophy.">Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 113 (39), 10962-10967 (2016).</li><li>Porensky, P. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+administration+of+morpholino+antisense+oligomer+rescues+spinal+muscular+atrophy+in+mouse.">A single administration of morpholino antisense oligomer rescues spinal muscular atrophy in mouse.</a> Hum Mol Genet. 21 (7), 1625-1638 (2012).</li><li>Touznik, A., Maruyama, R., Hosoki, K., Echigoya, Y., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA/DNA+mixmer-based+antisense+oligonucleotides+correct+alternative+splicing+of+the+SMN2+gene+and+restore+SMN+protein+expression+in+type+1+SMA+fibroblasts.">LNA/DNA mixmer-based antisense oligonucleotides correct alternative splicing of the SMN2 gene and restore SMN protein expression in type 1 SMA fibroblasts.</a> Sci Rep. 7 (1), 3672 (2017).</li><li>Obika, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2'-O,4'-C-methyleneuridine+and+-cytidine.+Novel+bicyclic+nucleosides+having+a+fixed+C-3,-endo+sugar+puckering.">Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C-3,-endo sugar puckering.</a> Tetrahedron Letters. 38 (50), 8735-8738 (1997).</li><li>Singh, S. K., Nielsen, P., Koshkin, A. A., Wengel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA+(locked+nucleic+acids):+synthesis+and+high-affinity+nucleic+acid+recognition.">LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition.</a> Chemical Communications. (4), 455-456 (1998).</li><li>Navarro, E., Serrano-Heras, G., Castano, M. J., Solera, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+detection+chemistry.">Real-time PCR detection chemistry.</a> Clin Chim Acta. 439, 231-250 (2015).</li><li>Urbanek, M. O., Nawrocka, A. U., Krzyzosiak, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+RNA+Detection+by+in+Situ+Hybridization+Methods.">Small RNA Detection by in Situ Hybridization Methods.</a> Int J Mol Sci. 16 (6), 13259-13286 (2015).</li><li>Wahlestedt, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+nontoxic+antisense+oligonucleotides+containing+locked+nucleic+acids.">Potent and nontoxic antisense oligonucleotides containing locked nucleic acids.</a> Proc Natl Acad Sci U S A. 97 (10), 5633-5638 (2000).</li><li>Rupaimoole, R., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+therapeutics:+towards+a+new+era+for+the+management+of+cancer+and+other+diseases.">MicroRNA therapeutics: towards a new era for the management of cancer and other diseases.</a> Nat Rev Drug Discov. 16 (3), 203-222 (2017).</li><li>Lanford, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+silencing+of+microRNA-122+in+primates+with+chronic+hepatitis+C+virus+infection.">Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection.</a> Science. 327 (5962), 198-201 (2010).</li><li>Shimo, T., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designing+Effective+Antisense+Oligonucleotides+for+Exon+Skipping.">Designing Effective Antisense Oligonucleotides for Exon Skipping.</a> Methods Mol Biol. 1687, 143-155 (2018).</li><li>Shimo, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+evaluation+of+locked+nucleic+acid-based+splice-switching+oligonucleotides+in+vitro.">Design and evaluation of locked nucleic acid-based splice-switching oligonucleotides in vitro.</a> Nucleic Acids Res. 42 (12), 8174-8187 (2014).</li><li>Nguyen, Q., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+Muscle+Cell+Model+to+Test+the+Exon+Skipping+Efficacy+for+Duchenne+Muscular+Dystrophy.">Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy.</a> J. Pers. Med. 7 (4), 13 (2017).</li><li>Echigoya, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+Antisense+Screening+and+Optimization+for+Exon+51+Skipping+in+Duchenne+Muscular+Dystrophy.">Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.</a> Mol Ther. , (2017).</li><li>Saito, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+PMO+found+in+dystrophic+dog+model+was+effective+in+cells+from+exon+7-deleted+DMD+patient.">Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient.</a> PLoS One. 5 (8), 12239 (2010).</li><li>Donnelly, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+murine+model+of+SMA.">Characterization of a murine model of SMA.</a> Neurobiol Dis. 45 (3), 992-998 (2012).</li><li>Lim, K. R., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eteplirsen+in+the+treatment+of+Duchenne+muscular+dystrophy.">Eteplirsen in the treatment of Duchenne muscular dystrophy.</a> Drug Des Devel Ther. 11, 533-545 (2017).</li><li>Paton, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nusinersen:+antisense+oligonucleotide+to+increase+SMN+protein+production+in+spinal+muscular+atrophy.">Nusinersen: antisense oligonucleotide to increase SMN protein production in spinal muscular atrophy.</a> Drugs Today (Barc). 53 (6), 327-337 (2017).</li><li>Prakash, T. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparing+in+vitro+and+in+vivo+activity+of+2'-O-[2-(methylamino)-2-oxoethyl]-+and+2'-O-methoxyethyl-modified+antisense+oligonucleotides.">Comparing in vitro and in vivo activity of 2'-O-[2-(methylamino)-2-oxoethyl]- and 2'-O-methoxyethyl-modified antisense oligonucleotides.</a> J Med Chem. 51 (9), 2766-2776 (2008).</li><li>Aoki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bodywide+skipping+of+exons+45-55+in+dystrophic+mdx52+mice+by+systemic+antisense+delivery.">Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery.</a> Proc Natl Acad Sci U S A. 109 (34), 13763-13768 (2012).</li></ol>

במבחנה הערכה השיטה המתוארת כאן היא מהירה, קלה, רגישים מספיק לבדיקה של AONs שונים. פרוטוקול זה חל נרחב אקסון דילוג והכללה של גנים אחרים, סוגי תאים שונים. בנוסף, בדיקות, רוב הביוכימיה און (למעט PMOs) יכול להיות transfected בשיטה זו. AONs ניתן לווסת שחבור של pre-mRNA של גנים אנדוגני והציג באופן מלאכותי, יכו...

ניוון שרירי עמוד השדרה (SMA) היא הפרעה neuromuscular קטלנית ירש בדוגמת הקרים autosomal. הוא מאופיין על ידי השפלה מוטורי לגלוקוז ואת תא המטען מתקדמת איבר שריר שיתוק1,2. רוב המופעים SMA הם עקב מוטציה homozygous של ג'ין ההישרדות של נוירון מוטורי 1 (SMN1)3. הגן ההישרדות של נוירון מוטורי 2 (SMN2) שכפול ההופכי של SMN1, יש רצף כמעט זהות שונות על ידי רק חמישה בסיסים4,5. מעבר C-ל-T ב- SMN2 ממוקם אקסון 7 הופך את הגן מתפקד כמעט כי המוטציה שמוביל חיוניות אקסון 7 מורחק כמעט 90% של SMN2 תעתיקים (איור 1). MRNAs SMN2 חסר אקסון 7 לא יכול לפצות על הפונקציה SMN1 כי המוצר שלה חלבון אינו יציב, יורד במהירות.
טיפול antisense הפך לאחרונה אסטרטגיה מבטיח מאוד לטיפול SMA6. האישור האחרון של nusinersen על ידי מינהל המזון והתרופות האמריקני (FDA) זמין זה התרופה הראשונה לטיפול SMA7. Nusinersen הוא 18-מר antisense oligonucleotide (און) עם שינוי 2 ′-O-methoxyethyl (מו), עמוד השדרה phosphorothioate. התרופה מטרות משתיק הקול splicing intronic N1 (ISS-N1) ממוקם באינטרון 7 של הגן SMN2 . איגוד של nusinersen ל ISS-N1 מקדמת את ההתאוששות של ביטוי חלבון SMN באורך מלא תפקודית מ הגן SMN2 אנדוגני ע י שימוש אקסון 7 הכללה (איור 1)8,9,10 . כיום, מחקרים רבים שכללו טיפול און עבור SMA מתמקדים חוקרים בדיקות הרומן און, הביוכימיה שעשויים להיות יותר יעיל ופחות רעיל יותר nusinersen. הוכח כי AONs עם בדיקות אחרות, הביוכימיה זירוז גם ביעילות אקסון להיכלל SMN2 אקסון 7 גם במבחנה וגם ויוו11,12,13.
חומצות גרעין נעול (LNAs) הם תחליפי RNA ששונו כימית המכילה גשר מתילן חיבור 4 ′ -פחמן עם 2 ′ -חמצן בתוך ה furanose14,של המבנה (איור 1b)15. בהשוואה DNAs או RNAs, LNAs שיש להם זיקה מוגברת מחייב רצפי RNA משלים, יש יתרון נוסף של להיות עמידים מאוד בפני nucleases אנדוגני. מגבר קדם הכימיה הוחל לשימוש כמו הגששים של קרינה פלואורסצנטית בחיי עיר הכלאה (דג),16,qPCR17. בנוסף, זה מנוצל להסדיר ביטוי גנים גם במבחנה וגם בתוך vivo. GapmeR AONs הם שילוב של מולקולות דנ א חד גדילי ולצדו מספר LNAs בקצוות יונקות ו- 3′. הם להפיל את ביטוי גנים על-ידי איגוד משלים mRNAs יישוב, גורם להם להיות מושפל על ידי RNase H מופעל18. מגבר קדם/DNA mixmers הם AONs אשר מורכבים של נוקלאוטידים DNA משולב בין LNAs. הציג בכיוון זה הם יכולים לאגד miRNA כדי לעכב את הפונקציה (מגבר קדם-antimiR)19. מגבר קדם-antimiRs כמה הגיעו הפיתוח הקליני. לקבלת דוגמאות, miravirsen (AntimiR-122) מגבר קדם-antimiR המעכב מיר-122 לטיפול הפטיטיס C זיהום, מספר מחקרים קליניים בשלב II נמצאים כרגע מתמשך19,20. . לאחרונה, זה הוכח כי מגבר קדם/DNA mixmers יכול גם לווסת RNA שחבור21. זה ניתן לאגד רצף מסוים של mRNA, זירוז אקסון דילוג ב- mRNA הדיסטרופין הכללה אקסון SMN2 mRNA במבחנה13,22.
במאמר זה, אנחנו חלוקה לרמות מתודולוגיה אינדוקציה של הכללה אקסון באמצעות AONs והערכת יעילות ברמות ה-RNA וחלבון. לצורך המחשה בשיטה זו, השתמשנו את mixmers מגבר קדם/DNA פילוח ISS-N1 אינטרון 7 של SMN2. AONs transfected לתאים חולה SMA מאת lipotransfection המושרה אקסון 7 להיכלל התעתיק SMN2 הסופי של קולטנים upregulation לייצור חלבון SMN. אחד היתרונות של שימוש מגבר קדם/DNA mixmers לזירוז ההכללה אקסון הוא ריכוז אפקטיבי עבור תרביות תאים הוא נמוך באופן משמעותי אחר בדיקות, הביוכימיה13. שיטה זו יכולה לשמש עבור רבים AONs אחרים חוץ oligomers מורפולינו phosphorodiamidate (PMOs), אשר, עקב תשלום נייטרלי שלהם, צריך להזין את התאים דרך אנדוציטוזה שנגזרות הכימית תרביות תאים שותף אנדו-פורטר.

<table border="0" cellpadding="0" cellspacing="0" style="width:655px;" width="655">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">SMA Fibroblasts</td>
			<td style="width:153px;">Coriell NIGMS human genetic cell repository</td>
			<td style="width:119px;">GM03813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">11320033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">F1051</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Penicillin-Streptomycin (10,000 U/mL)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15140122</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.05%), phenol red</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">25300062</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Serum-deprived media</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">31985070</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Transfection reagent</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15338100</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">guanidinium thiocyanate-phenol-chloroform (TRIzol)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15596-018</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">RT-PCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>Sequence 5&#39; to 3&#39;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTGCCTCCATTTCCTTCTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TGGTGTCATTTAGTGCTGCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCCCTGAGCTGAACGGGAAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GGAGGAGTTTGGTCGCTGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">qPCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCTATCATACTGGCTATTATATGGGTTTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTCTATGCCAGCATTTCTCCTTAAT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCTGGACCACCAATAATTCCCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>ATGCCAGCATTTCCATATAATAGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCAAATTCCATGGCACCGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>AGGGATCTCGCTCCTGGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chloroform</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">P3803</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glycogen, RNA grade</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">R0551</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">ImageJ Software</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Protease cocktail inhibitor&#160;</td>
			<td style="width:153px;">Roche</td>
			<td style="width:119px;">11836153001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cathode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.025 M Tris base + 40&#160;mM 6-aminocaproic acid + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.03 M Tris Base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Concentred Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.3 M Tris base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Beta Mercaptoethanol&#160;</td>
			<td style="width:153px;">Millipore</td>
			<td style="width:119px;">ES-007-E</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PVDF membrane&#160;</td>
			<td style="width:153px;">GE</td>
			<td style="width:119px;">10600021</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Loading/sample buffer for Western blotting</td>
			<td style="width:153px;">NuPage Invitrogen</td>
			<td style="width:119px;">NP007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">One-Step RT-PCR kit&#160;</td>
			<td style="width:153px;">Qiagen&#160;</td>
			<td style="width:119px;">210210</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">dNTPs</td>
			<td style="width:153px;">Clontech</td>
			<td style="width:119px;">3040</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts

ניוון שרירי עמוד השדרה (SMA), מחלה נוירולוגית קטלנית הנגרמת על ידי האובדן של SMN1, מציג מקרה מיוחד בשטח של oligonucleotide antisense (און)-מתווכת טיפול. בעוד SMN1 מוטציות אחראים על המחלה, AONs מיקוד אחוי intronic משתיק (ISS) באתרים SMN2, כולל שאושרו על-ידי ה-FDA nusinersen, הוכחו לשחזר SMN ביטוי, דהוא הסימפטומים. כיום, מחקרים רבים שכללו טיפול און עבור SMA מתמקדים חוקרים הרומן בדיקות, הביוכימיה און מיקוד SMN2 שעשויים להיות יותר יעיל ופחות רעיל יותר nusinersen. כאן, אנו מתארים את פרוטוקול להערכה במבחנה של הכללה אקסון באמצעות lipotransfection של AONs ואחריו תגובת שרשרת של פולימראז שעתוק במהופך (RT-PCR), תגובת שרשרת של פולימראז כמותית (qPCR), סופג המערבי. שיטה זו יכולה להיות מועסק עבור סוגים שונים של בדיקות, הביוכימיה און. באמצעות שיטה זו, נדגים כי AONs המורכבת לסירוגין חומצות גרעין נעול (LNAs), ה-DNA נוקלאוטידים (מגבר קדם/DNA mixmers) להוביל יעיל SMN2 אקסון הכללה ושיקום של חלבון SMN-ריכוז נמוך מאוד, ולכן, מגבר קדם / מבוסס על mixmer oligonucleotides antisense דנ א ייתכן אסטרטגיית טיפולית אטרקטיבי לטיפול splicing ליקויים שנגרמו על ידי מחלות גנטיות. במבחנה הערכה השיטה המתוארת כאן היא מהירה, קלה, רגישים מספיק לבדיקה של AONs רומן שונים.

באמצעות fibroblasts חולה SMA, שסימנו האזור משתיק ISS-N1 אינטרון 7 של הגן SMN2 עם שמונה שונים antisense מגבר קדם/DNA mixmers זה היו transfected ב 5 nM ריכוז (איור 3). כל אחד mixmers הכילה שדרה phosphorothioated ששונה שאיפשר להם להתנגד נוקלאז השפלה. כדי להעריך את היעילות של mixmers, הקצב של אקסון SMN2<...

Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

הערכה של הכללה אקסון שנגזרות אחוי Oligonucleotides Antisense מיתוג ב SMA החולה Fibroblasts

Oligonucleotides antisense שונים (AONs) הוכחו לגרום אקסון הכללה (splice אפנון) והצלה SMN ביטוי עבור ניוון שרירי עמוד השדרה (SMA). כאן, אנו מתארים את פרוטוקול עבור און lipotransfection לזירוז אקסון להיכלל הגן SMN2 ואת שיטות ההערכה כדי לקבוע את יעילות fibroblasts חולה SMA.

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide ...

Research

JoVE Journal

Medicine

Vascular Occlusion Training for Inclusion Body Myositis: A Novel Therapeutic Approach

דם הדרכה ספיגה עבור שררת גוף הכללה: גישה טיפולית חדשנית

Inclusion body myositis (IBM) is a rare idiopathic inflammatory myopathy. It is known to produces remarkable muscle weakness and to greatly compromise ...

Experimental Generation of Carcinoma-Associated Fibroblasts (CAFs) from Human Mammary Fibroblasts

Experimental Generation of Carcinoma-Associated Fibroblasts CAFs from Human Mammary Fibroblasts

הדור ניסויית של קרצינומה-Associated Fibroblasts (CAFs) מ Fibroblasts החלב אנוש

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of ...

Mouse Model of Intraluminal MCAO: Cerebral Infarct Evaluation by Cresyl Violet Staining

מודל עכבר של MCAO intraluminal: הערכת אוטם מוחית על ידי כתמים סגולים Cresyl

Stroke is the third  cause of mortality and the leading cause of disability in the World. Ischemic  stroke accounts for approximately 80% of all strokes. ...

Cardiac Stress Test Induced by Dobutamine and Monitored by Cardiac Catheterization in Mice

בדיקת מאמץ לב הנגרמת על ידי Dobutamine ופיקוח על ידי צנתור בעכברים

Dobutamine is a &beta;-adrenergic agonist with an affinity higher for receptor expressed in the heart (&beta;1) than for receptors expressed in the ...

Evaluation of Lung Metastasis in Mouse Mammary Tumor Models by Quantitative Real-time PCR

הערכה של ריאות גרורה במודלי גידול עכבר החלב על ידי בזמן אמת כמותי PCR

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated ...

Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy

Multi-אקסון דילוג שימוש אנטיסנס קוקטייל של ניוון השרירים הצמוד X לכלבים

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon ...

A Model of Glaucoma Induced by Circumlimbal Suture in Rats and Mice

דגם של גלאוקומה המושרה על ידי תפרים Circumlimbal אצל חולדות ועכברים

The circumlimbal suture is a technique for inducing experimental glaucoma in rodents by chronically elevating intraocular pressure (IOP), a well-known ...

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

כמותי [18F]-NAF-PET-MRI ניתוח להערכת מחזור עצם דינמי במטופל עם Facetogenic כאבי גב תחתון

Imaging techniques that reflect dynamic bone turnover may aid in characterizing a wide range of bone pathologies. Bone is a dynamic tissue undergoing ...

Invasive Hemodynamic Assessment for the Right Ventricular System and Hypoxia-Induced Pulmonary Arterial Hypertension in Mice

פולשנית הערכה היפודינמית עבור מערכת המוח הימני ואת ההיפוקסיה המושרה לחץ דם ריאתי בעכברים

Pulmonary arterial hypertension (PAH) is a chronic and severe cardiopulmonary disorder. Mice are a popular animal model used to mimic this disease. ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

אפיון Exon דילוג יעילות בדגימות החולה DMD בניסויים קליניים של אנטיסנס אוליגונוקליאוטידים

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...