Name: evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts
Uploaded: 2018-05-11T14:30:00
Description: Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

लेखकों के प्रयोगों के साथ मदद के लिए निकोल McRorie धंयवाद । यह काम चिकित्सा और दंत चिकित्सा के अलबर्टा संकाय के विश्वविद्यालय द्वारा समर्थित किया गया था, Slipchuk SMA अनुसंधान फाउंडेशन अनुसंधान अनुदान, स्वास्थ्य अनुसंधान के कनाडाई संस्थानों (CIHR), गैरेट कमिंग रिसर्च फंड के दोस्तों, एचएम Toupin स्नायविक विज्ञान अनुसंधान कोष, पेशी Dystrophy कनाडा, नवाचार के लिए कनाडा फाउंडेशन, अलबर्टा उद्यम और उंनत शिक्षा, और महिलाओं और बच्चों के स्वास्थ्य अनुसंधान संस्थान (WCHRI) ।

1. सेल संस्कृति
<ol><li>संस्कृति SMA रोगी fibroblasts में वृद्धि मध्यम (Dulbecco के संशोधित ईगल मध्यम 1:1 एफ 12 (हैम) के साथ 10% भ्रूण गोजातीय सीरम (FBS) और ३७ डिग्री सेल्सियस पर एक सह2 मशीन में ०.५% पेनिसिलिन/</li>
	<li>सेल एकाग्रता का नि...

<ol>
	<li>Iascone, D. M., Henderson, C. E., Lee, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+muscular+atrophy:+from+tissue+specificity+to+therapeutic+strategies.">Spinal muscular atrophy: from tissue specificity to therapeutic strategies.</a> F1000Prime Rep. 7, 4 (2015).</li><li>Touznik, A., Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+developments+in+exon+skipping+and+splice+modulation+therapies+for+neuromuscular+diseases.">New developments in exon skipping and splice modulation therapies for neuromuscular diseases.</a> Expert Opin Biol Ther. 14 (6), 809-819 (2014).</li><li>Lefebvre, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+Characterization+of+a+Spinal+Muscular+Atrophy-Determining+Gene.">Identification and Characterization of a Spinal Muscular Atrophy-Determining Gene.</a> Cell. 80 (1), 155-165 (1995).</li><li>Lorson, C. L., Hahnen, E., Androphy, E. J., Wirth, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+in+the+SMN+gene+regulates+splicing+and+is+responsible+for+spinal+muscular+atrophy.">A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 96 (11), 6307-6311 (1999).</li><li>Monani, U. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+difference+that+alters+splicing+patterns+distinguishes+the+SMA+gene+SMN1+from+the+copy+gene+SMN2.">A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2.</a> Hum Mol Genet. 8 (7), 1177-1183 (1999).</li><li>Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+therapy+in+neurology.">Antisense therapy in neurology.</a> J Pers Med. 3 (3), 144-176 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Ther. 27 (2), 67-69 (2017).</li><li>Hua, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peripheral+SMN+restoration+is+essential+for+long-term+rescue+of+a+severe+spinal+muscular+atrophy+mouse+model.">Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model.</a> Nature. 478 (7367), 123-126 (2011).</li><li>Hua, Y., Vickers, T. A., Baker, B. F., Bennett, C. F., Krainer, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+SMN2+exon+7+inclusion+by+antisense+oligonucleotides+targeting+the+exon.">Enhancement of SMN2 exon 7 inclusion by antisense oligonucleotides targeting the exon.</a> PLoS Biol. 5 (4), 73 (2007).</li><li>Passini, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+oligonucleotides+delivered+to+the+mouse+CNS+ameliorate+symptoms+of+severe+spinal+muscular+atrophy.">Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy.</a> Sci Transl Med. 3 (72), (2011).</li><li>Hammond, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+peptide-mediated+oligonucleotide+therapy+improves+long-term+survival+in+spinal+muscular+atrophy.">Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 113 (39), 10962-10967 (2016).</li><li>Porensky, P. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+administration+of+morpholino+antisense+oligomer+rescues+spinal+muscular+atrophy+in+mouse.">A single administration of morpholino antisense oligomer rescues spinal muscular atrophy in mouse.</a> Hum Mol Genet. 21 (7), 1625-1638 (2012).</li><li>Touznik, A., Maruyama, R., Hosoki, K., Echigoya, Y., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA/DNA+mixmer-based+antisense+oligonucleotides+correct+alternative+splicing+of+the+SMN2+gene+and+restore+SMN+protein+expression+in+type+1+SMA+fibroblasts.">LNA/DNA mixmer-based antisense oligonucleotides correct alternative splicing of the SMN2 gene and restore SMN protein expression in type 1 SMA fibroblasts.</a> Sci Rep. 7 (1), 3672 (2017).</li><li>Obika, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2'-O,4'-C-methyleneuridine+and+-cytidine.+Novel+bicyclic+nucleosides+having+a+fixed+C-3,-endo+sugar+puckering.">Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C-3,-endo sugar puckering.</a> Tetrahedron Letters. 38 (50), 8735-8738 (1997).</li><li>Singh, S. K., Nielsen, P., Koshkin, A. A., Wengel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA+(locked+nucleic+acids):+synthesis+and+high-affinity+nucleic+acid+recognition.">LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition.</a> Chemical Communications. (4), 455-456 (1998).</li><li>Navarro, E., Serrano-Heras, G., Castano, M. J., Solera, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+detection+chemistry.">Real-time PCR detection chemistry.</a> Clin Chim Acta. 439, 231-250 (2015).</li><li>Urbanek, M. O., Nawrocka, A. U., Krzyzosiak, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+RNA+Detection+by+in+Situ+Hybridization+Methods.">Small RNA Detection by in Situ Hybridization Methods.</a> Int J Mol Sci. 16 (6), 13259-13286 (2015).</li><li>Wahlestedt, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+nontoxic+antisense+oligonucleotides+containing+locked+nucleic+acids.">Potent and nontoxic antisense oligonucleotides containing locked nucleic acids.</a> Proc Natl Acad Sci U S A. 97 (10), 5633-5638 (2000).</li><li>Rupaimoole, R., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+therapeutics:+towards+a+new+era+for+the+management+of+cancer+and+other+diseases.">MicroRNA therapeutics: towards a new era for the management of cancer and other diseases.</a> Nat Rev Drug Discov. 16 (3), 203-222 (2017).</li><li>Lanford, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+silencing+of+microRNA-122+in+primates+with+chronic+hepatitis+C+virus+infection.">Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection.</a> Science. 327 (5962), 198-201 (2010).</li><li>Shimo, T., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designing+Effective+Antisense+Oligonucleotides+for+Exon+Skipping.">Designing Effective Antisense Oligonucleotides for Exon Skipping.</a> Methods Mol Biol. 1687, 143-155 (2018).</li><li>Shimo, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+evaluation+of+locked+nucleic+acid-based+splice-switching+oligonucleotides+in+vitro.">Design and evaluation of locked nucleic acid-based splice-switching oligonucleotides in vitro.</a> Nucleic Acids Res. 42 (12), 8174-8187 (2014).</li><li>Nguyen, Q., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+Muscle+Cell+Model+to+Test+the+Exon+Skipping+Efficacy+for+Duchenne+Muscular+Dystrophy.">Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy.</a> J. Pers. Med. 7 (4), 13 (2017).</li><li>Echigoya, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+Antisense+Screening+and+Optimization+for+Exon+51+Skipping+in+Duchenne+Muscular+Dystrophy.">Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.</a> Mol Ther. , (2017).</li><li>Saito, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+PMO+found+in+dystrophic+dog+model+was+effective+in+cells+from+exon+7-deleted+DMD+patient.">Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient.</a> PLoS One. 5 (8), 12239 (2010).</li><li>Donnelly, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+murine+model+of+SMA.">Characterization of a murine model of SMA.</a> Neurobiol Dis. 45 (3), 992-998 (2012).</li><li>Lim, K. R., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eteplirsen+in+the+treatment+of+Duchenne+muscular+dystrophy.">Eteplirsen in the treatment of Duchenne muscular dystrophy.</a> Drug Des Devel Ther. 11, 533-545 (2017).</li><li>Paton, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nusinersen:+antisense+oligonucleotide+to+increase+SMN+protein+production+in+spinal+muscular+atrophy.">Nusinersen: antisense oligonucleotide to increase SMN protein production in spinal muscular atrophy.</a> Drugs Today (Barc). 53 (6), 327-337 (2017).</li><li>Prakash, T. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparing+in+vitro+and+in+vivo+activity+of+2'-O-[2-(methylamino)-2-oxoethyl]-+and+2'-O-methoxyethyl-modified+antisense+oligonucleotides.">Comparing in vitro and in vivo activity of 2'-O-[2-(methylamino)-2-oxoethyl]- and 2'-O-methoxyethyl-modified antisense oligonucleotides.</a> J Med Chem. 51 (9), 2766-2776 (2008).</li><li>Aoki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bodywide+skipping+of+exons+45-55+in+dystrophic+mdx52+mice+by+systemic+antisense+delivery.">Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery.</a> Proc Natl Acad Sci U S A. 109 (34), 13763-13768 (2012).</li></ol>

यहां वर्णित इन विट्रो मूल्यांकन विधि तेजी से, आसान है, और संवेदनशील विभिंन ााुओं के परीक्षण के लिए पर्याप्त है । इस प्रोटोकॉल व्यापक रूप से एक्सॉन लंघन और अंय जीन और विभिंन प्रकार के सेल के शामिल किए...

रीढ़ की हड्डी में पेशी शोष (SMA) एक घातक neuromuscular विकार एक autosomal अवकाश पैटर्न में विरासत में मिला है । यह मोटर न्यूरॉन्स और प्रगतिशील ट्रंक और अंग मांसपेशी पक्षाघात1,2के क्षरण की विशेषता है । SMA घटनाओं के बहुमत मोटर ंयूरॉन 1 (SMN1) जीन3के अस्तित्व में एक homozygous उत्परिवर्तन के कारण हैं । मोटर ंयूरॉन 2 के अस्तित्व (SMN2) जीन SMN1के एक व्युत्क्रम डुप्लिकेट है, और एक लगभग समान अनुक्रम केवल पांच कुर्सियां4,5से भिंन है । एक सी के लिए SMN2 में एक्सॉन 7 में स्थित टी संक्रमण जीन लगभग गैर कार्यात्मक बनाता है क्योंकि उत्परिवर्तन आवश्यक एक्सॉन 7 की ओर जाता है SMN2 टेप के लगभग ९०% में शामिल किया जा रहा है (चित्रा 1एक) । SMN2 mRNAs लापता एक्सॉन 7 SMN1 समारोह के लिए क्षतिपूर्ति नहीं कर सकते क्योंकि इसके प्रोटीन उत्पाद अस्थिर है और तेजी से नीचा है ।
Antisense चिकित्सा हाल ही में SMA6के इलाज के लिए एक बहुत ही होनहार रणनीति के रूप में उभरा । अमेरिकी खाद्य एवं औषधि प्रशासन (एफडीए) द्वारा nusinersen के हाल ही में अनुमोदन यह पहला SMA7के इलाज के लिए उपलब्ध दवा बना दिया । Nusinersen एक 2 '-O-methoxyethyl संशोधन (मो) और एक phosphorothioate रीढ़ के साथ एक 18-मेर antisense oligonucleotide (ाओं) है । दवा intronic ब्याह साइलेंसर N1 (आईएसएस-N1) intron जीन के SMN2 7 में स्थित लक्ष्य । आईएसएस के लिए nusinersen के बंधन-N1 कार्यात्मक पूर्ण लंबाई SMN प्रोटीन अभिव्यक्ति की वसूली को बढ़ावा देने के द्वारा अंतर्जात SMN2 जीन से प्रेरित एक्सॉन 7 शामिल किए जाने (चित्रा 1ए)8,9,10 . वर्तमान में, कई अध्ययनों के उपंयास ाओं chemistries कि अधिक प्रभावी और कम nusinersen से विषाक्त हो सकता है जांच पर SMA ध्यान के लिए ाओं थेरेपी शामिल । यह प्रदर्शित किया गया है कि अंय chemistries के साथ ााुओं भी कुशलता से SMN2 एक्सॉन में शामिल एक्सॉन को प्रेरित 7 दोनों इन विट्रो में और vivo11,12,13में ।
बंद न्यूक्लिक एसिड (LNAs) रासायनिक संशोधित आरएनए एक methylene ' 2 '-furanose संरचना के भीतरऑक्सीजन (चित्रा 1बी)14,15के साथ 4 '-कार्बन को जोड़ने पुल युक्त अनुरूप हैं । DNAs या RNAs की तुलना में, LNAs पूरक आरएनए दृश्यों के लिए बाध्यकारी के लिए एक बढ़ा अपनत्व है और अंतर्जात nucleases के लिए अत्यधिक प्रतिरोधी होने का जोड़ा लाभ है. LNA रसायन विज्ञान में सीटू संकरण (मछली) और qPCR16,17में प्रतिदीप्ति के लिए जांच के रूप में उपयोग के लिए आवेदन किया गया है । इसके अलावा, यह दोनों विट्रो में और vivo मेंजीन अभिव्यक्ति को विनियमित करने के लिए उपयोग किया जाता है । GapmeR ााुओं एकल-असहाय डीएनए में कई LNAs द्वारा पार्श्व अणुओं का एक संयोजन कर रहे है ' 5 और 3 ' समाप्त होता है । वे लक्षित mRNAs के पूरक बाध्यकारी द्वारा जीन अभिव्यक्ति नीचे दस्तक, उंहें सक्रिय RNase एच18द्वारा नीचा किया जा करने के लिए कारण । LNA/डीएनए mixmers ााुओं है जो डीएनए न्यूक्लियोटाइड के बीच में एकीकृत LNAs से बना रहे हैं । इस अभिविन्यास में प्रस्तुत वे अपने कार्य को बाधित करने के लिए miRNA बाँध सकते हैं (LNA-antimiR)19. कुछ LNA-antimiRs नैदानिक विकास पर पहुँच गए हैं. उदाहरण के लिए, miravirsen (AntimiR-१२२) एक LNA-AntimiR कि रोकता मीर-१२२ हेपेटाइटिस सी संक्रमण और कई चरण द्वितीय नैदानिक परीक्षणों के इलाज के लिए वर्तमान में19,20चल रहे हैं । हाल ही में, यह प्रदर्शित किया गया है कि LNA/डीएनए mixmers भी आरएनए ब्याह21मिलाना कर सकते हैं । यह mRNA के एक विशिष्ट अनुक्रम को बाइंड कर सकते हैं और प्रेरित एक्सॉन dystrophin mRNA में लंघन और एक्सॉन शामिल करने में SMN2 mRNA इन विट्रो13,22.
इस अनुच्छेद में, हम ााुओं और आरएनए और प्रोटीन के स्तर पर प्रभावकारिता के मूल्यांकन का उपयोग एक्सॉन शामिल किए जाने की प्रेरण के लिए एक पद्धति रूपरेखा । इस विधि को उदाहरण देना करने के लिए हमने आईएसएस-N1 के intron 7 में LNA/डीएनए mixmers लक्ष्यीकरण का प्रयोग किया था । ााुओं lipotransfection प्रेरित एक्सॉन 7 अंतिम SMN2 प्रतिलिपि में शामिल किए जाने और SMN प्रोटीन उत्पादन के ऊपर विनियमन द्वारा SMA रोगी कोशिकाओं में transfected । एक्सॉन समावेशन को प्रेरित करने के लिए LNA/डीएनए mixmers का उपयोग करने के फायदों में से एक यह है कि अभिकर्मक के लिए प्रभावी एकाग्रता अन्य chemistries13की तुलना में काफी कम है । इस विधि phosphorodiamidate morpholino oligomers (PMOs), जो, उनके तटस्थ प्रभार के कारण के अलावा कई अंय ााुओं के लिए इस्तेमाल किया जा सकता है endocytosis-पोर्टर सह इंडो एजेंट द्वारा प्रेरित अभिकर्मक के माध्यम से कोशिकाओं को दर्ज करने की जरूरत है ।

<table border="0" cellpadding="0" cellspacing="0" style="width:655px;" width="655">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">SMA Fibroblasts</td>
			<td style="width:153px;">Coriell NIGMS human genetic cell repository</td>
			<td style="width:119px;">GM03813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">11320033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">F1051</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Penicillin-Streptomycin (10,000 U/mL)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15140122</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.05%), phenol red</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">25300062</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Serum-deprived media</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">31985070</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Transfection reagent</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15338100</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">guanidinium thiocyanate-phenol-chloroform (TRIzol)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15596-018</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">RT-PCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>Sequence 5&#39; to 3&#39;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTGCCTCCATTTCCTTCTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TGGTGTCATTTAGTGCTGCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCCCTGAGCTGAACGGGAAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GGAGGAGTTTGGTCGCTGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">qPCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCTATCATACTGGCTATTATATGGGTTTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTCTATGCCAGCATTTCTCCTTAAT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCTGGACCACCAATAATTCCCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>ATGCCAGCATTTCCATATAATAGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCAAATTCCATGGCACCGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>AGGGATCTCGCTCCTGGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chloroform</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">P3803</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glycogen, RNA grade</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">R0551</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">ImageJ Software</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Protease cocktail inhibitor&#160;</td>
			<td style="width:153px;">Roche</td>
			<td style="width:119px;">11836153001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cathode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.025 M Tris base + 40&#160;mM 6-aminocaproic acid + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.03 M Tris Base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Concentred Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.3 M Tris base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Beta Mercaptoethanol&#160;</td>
			<td style="width:153px;">Millipore</td>
			<td style="width:119px;">ES-007-E</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PVDF membrane&#160;</td>
			<td style="width:153px;">GE</td>
			<td style="width:119px;">10600021</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Loading/sample buffer for Western blotting</td>
			<td style="width:153px;">NuPage Invitrogen</td>
			<td style="width:119px;">NP007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">One-Step RT-PCR kit&#160;</td>
			<td style="width:153px;">Qiagen&#160;</td>
			<td style="width:119px;">210210</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">dNTPs</td>
			<td style="width:153px;">Clontech</td>
			<td style="width:119px;">3040</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts

रीढ़ की हड्डी में पेशी शोष (SMA), एक घातक स्नायविक SMN1के नुकसान की वजह से रोग, antisense oligonucleotide (ाओं) के क्षेत्र में एक अनूठा मामला प्रस्तुत करता है-मध्यस्थता चिकित्सा. जबकि SMN1 उत्परिवर्तनों रोग के लिए जिंमेदार हैं, ााुओं लक्ष्यीकरण intronic ब्याह साइलेंसर (आईएसएस) SMN2में साइटों, एफडीए अनुमोदित nusinersen सहित, SMN अभिव्यक्ति बहाल करने के लिए और लक्षण उंनति दिखाया गया है । वर्तमान में, कई अध्ययन के उपंयास ाओं chemistries लक्ष्यीकरण SMN2 है कि अधिक प्रभावी और कम nusinersen से विषाक्त हो सकता है की जांच पर SMA ध्यान केंद्रित के लिए चिकित्सा शामिल है । यहां, हम के लिए एक प्रोटोकॉल का वर्णन इन विट्रो में एक्सॉन शामिल किए जाने का मूल्यांकन ााुओं के lipotransfection का उपयोग रिवर्स प्रतिलेखन पोलीमरेज़ श्रृंखला प्रतिक्रिया (आरटी-पीसीआर), मात्रात्मक पोलीमरेज़ श्रृंखला प्रतिक्रिया (qPCR), और पश्चिमी सोख्ता द्वारा पीछा किया । इस विधि से विभिन्न प्रकार के ाओं chemistries को नियोजित किया जा सकता है. इस विधि का प्रयोग करते हुए हम यह दर्शाते हैं कि ााुओं से बना न्यूक्लिक एसिड (LNAs) और डीएनए न्यूक्लियोटाइड (LNA/डीएनए mixmers) का नेतृत्व कुशल SMN2 एक्सॉन समावेश और SMN प्रोटीन की बहाली के लिए बहुत कम एकाग्रता में होता है, और इसलिए, LNA/ डीएनए mixmer-आधारित antisense oligonucleotides एक आकर्षक चिकित्सीय रणनीति हो सकती है जो कि अनुवांशिक रोगों के कारण होने वाले दोषों का इलाज करती है । यहां वर्णित इन विट्रो मूल्यांकन विधि तेजी से, आसान है, और संवेदनशील विभिंन उपंयास ााुओं के परीक्षण के लिए पर्याप्त है ।

SMA रोगी fibroblasts का उपयोग कर, हम intron 7 में आईएसएस-N1 साइलेंसर क्षेत्र को लक्षित आठ अलग SMN2 antisense/डीएनए LNA कि एक 5 एनएम एकाग्रता में mixmers थे के साथ transfected जीन (चित्रा 3) । mixmers के प्रत्येक एक संशोधित phospho...

Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

ब्याह द्वारा प्रेरित एक्सॉन शामिल करने का मूल्यांकन स्विचिंग Antisense Oligonucleotides में SMA रोगी Fibroblasts

विभिन्न antisense oligonucleotides (ााुओं) रीढ़ की हड्डी में पेशी शोष (SMA) के लिए एक्सॉन समावेश (ब्याह मॉडुलन) और बचाव SMN अभिव्यक्ति प्रेरित करने के लिए दिखाया गया है । यहां, हम ाओं lipotransfection के लिए एक प्रोटोकॉल का वर्णन करने के लिए SMN2 जीन और मूल्यांकन के तरीकों में शामिल एक्सॉन को प्रेरित करने के लिए SMA रोगी fibroblasts में प्रभावकारिता का निर्धारण ।

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide ...

Research

JoVE Journal

Medicine

Vascular Occlusion Training for Inclusion Body Myositis: A Novel Therapeutic Approach

संवहनी समावेशन शारीरिक Myositis के लिए आड़ प्रशिक्षण: एक उपन्यास चिकित्सात्मक दृष्टिकोण

Inclusion body myositis (IBM) is a rare idiopathic inflammatory myopathy. It is known to produces remarkable muscle weakness and to greatly compromise ...

Experimental Generation of Carcinoma-Associated Fibroblasts (CAFs) from Human Mammary Fibroblasts

Experimental Generation of Carcinoma-Associated Fibroblasts CAFs from Human Mammary Fibroblasts

कार्सिनोमा - एसोसिएटेड Fibroblasts के प्रायोगिक मानव स्तन Fibroblasts से जनरेशन (CAFs)

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of ...

Mouse Model of Intraluminal MCAO: Cerebral Infarct Evaluation by Cresyl Violet Staining

माउस मॉडल: intraluminal MCAO Cresyl वायलेट धुंधला द्वारा सेरेब्रल रोधगलितांश मूल्यांकन

Stroke is the third  cause of mortality and the leading cause of disability in the World. Ischemic  stroke accounts for approximately 80% of all strokes. ...

Cardiac Stress Test Induced by Dobutamine and Monitored by Cardiac Catheterization in Mice

कार्डियक तनाव परीक्षण Dobutamine द्वारा प्रेरित और चूहे में कार्डियक कैथीटेराइजेशन द्वारा निगरानी

Dobutamine is a &beta;-adrenergic agonist with an affinity higher for receptor expressed in the heart (&beta;1) than for receptors expressed in the ...

Evaluation of Lung Metastasis in Mouse Mammary Tumor Models by Quantitative Real-time PCR

मात्रात्मक वास्तविक समय पीसीआर द्वारा माउस स्तन ट्यूमर मॉडल में फेफड़ों मेटास्टेसिस का मूल्यांकन

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated ...

Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy

मल्टी एक्सॉन कुत्ते एक्स से जुड़े पेशी Dystrophy में कॉकटेल antisense oligonucleotides का प्रयोग लंघन

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon ...

A Model of Glaucoma Induced by Circumlimbal Suture in Rats and Mice

चूहों और चूहों में Circumlimbal सीवन द्वारा प्रेरित मोतियाबिंद का एक मॉडल

The circumlimbal suture is a technique for inducing experimental glaucoma in rodents by chronically elevating intraocular pressure (IOP), a well-known ...

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

मात्रात्मक [18एफ]-Naf-PET-MRI विश्लेषण Facetogenic कम पीठ दर्द के साथ एक रोगी में गतिशील हड्डी टर्नओवर के मूल्यांकन के लिए

Imaging techniques that reflect dynamic bone turnover may aid in characterizing a wide range of bone pathologies. Bone is a dynamic tissue undergoing ...

Invasive Hemodynamic Assessment for the Right Ventricular System and Hypoxia-Induced Pulmonary Arterial Hypertension in Mice

चूहे में सही वेंट्रिकुलर सिस्टम और हाइपोक्सिया-प्रेरित पल्मोनरी धमनी उच्च रक्तचाप के लिए आक्रामक हेमोडायनामिक आकलन

Pulmonary arterial hypertension (PAH) is a chronic and severe cardiopulmonary disorder. Mice are a popular animal model used to mimic this disease. ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

एंटीसेंस ओलिगोन्यूक्लियोटाइड्स के नैदानिक परीक्षणों में डीएमडी रोगी नमूनों में एक्सोन लंघन दक्षता की विशेषता

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...