Name: evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts
Uploaded: 2018-05-11T14:30:00
Description: Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

Авторы благодарят Николь Макрори за помощь с экспериментов. Эта работа была поддержана университета Альберты факультета медицины и стоматологии, Slipchuk SMA исследований фонда исследовательский грант, канадский институтов здравоохранения исследований (КНИИЗ), друзей Гарретт Камминг исследований фонды, HM Toupin неврологические Научно исследовательские фонды, мышечная дистрофия Канада, Канадский фонд для инноваций, Альберта предприятия и высшего образования, женщин и детей в области здравоохранения научно-исследовательский институт (WCHRI).

1. клеточная культура
<ol><li>Пациент фибробластов SMA культуры в рост среднего (Дульбекко изменение орел средних 1: 1 F-12 (Ham) с 10% плода бычьим сывороточным (ФБС) и 0,5% пенициллина/стрептомицина) в инкубатор CO2 при 37 ° C.</li>
	<li>Определения концентрации клеток, используя счетчик автоматизиро?...

<ol>
	<li>Iascone, D. M., Henderson, C. E., Lee, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+muscular+atrophy:+from+tissue+specificity+to+therapeutic+strategies.">Spinal muscular atrophy: from tissue specificity to therapeutic strategies.</a> F1000Prime Rep. 7, 4 (2015).</li><li>Touznik, A., Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+developments+in+exon+skipping+and+splice+modulation+therapies+for+neuromuscular+diseases.">New developments in exon skipping and splice modulation therapies for neuromuscular diseases.</a> Expert Opin Biol Ther. 14 (6), 809-819 (2014).</li><li>Lefebvre, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+Characterization+of+a+Spinal+Muscular+Atrophy-Determining+Gene.">Identification and Characterization of a Spinal Muscular Atrophy-Determining Gene.</a> Cell. 80 (1), 155-165 (1995).</li><li>Lorson, C. L., Hahnen, E., Androphy, E. J., Wirth, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+in+the+SMN+gene+regulates+splicing+and+is+responsible+for+spinal+muscular+atrophy.">A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 96 (11), 6307-6311 (1999).</li><li>Monani, U. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+difference+that+alters+splicing+patterns+distinguishes+the+SMA+gene+SMN1+from+the+copy+gene+SMN2.">A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2.</a> Hum Mol Genet. 8 (7), 1177-1183 (1999).</li><li>Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+therapy+in+neurology.">Antisense therapy in neurology.</a> J Pers Med. 3 (3), 144-176 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Ther. 27 (2), 67-69 (2017).</li><li>Hua, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peripheral+SMN+restoration+is+essential+for+long-term+rescue+of+a+severe+spinal+muscular+atrophy+mouse+model.">Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model.</a> Nature. 478 (7367), 123-126 (2011).</li><li>Hua, Y., Vickers, T. A., Baker, B. F., Bennett, C. F., Krainer, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+SMN2+exon+7+inclusion+by+antisense+oligonucleotides+targeting+the+exon.">Enhancement of SMN2 exon 7 inclusion by antisense oligonucleotides targeting the exon.</a> PLoS Biol. 5 (4), 73 (2007).</li><li>Passini, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+oligonucleotides+delivered+to+the+mouse+CNS+ameliorate+symptoms+of+severe+spinal+muscular+atrophy.">Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy.</a> Sci Transl Med. 3 (72), (2011).</li><li>Hammond, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+peptide-mediated+oligonucleotide+therapy+improves+long-term+survival+in+spinal+muscular+atrophy.">Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 113 (39), 10962-10967 (2016).</li><li>Porensky, P. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+administration+of+morpholino+antisense+oligomer+rescues+spinal+muscular+atrophy+in+mouse.">A single administration of morpholino antisense oligomer rescues spinal muscular atrophy in mouse.</a> Hum Mol Genet. 21 (7), 1625-1638 (2012).</li><li>Touznik, A., Maruyama, R., Hosoki, K., Echigoya, Y., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA/DNA+mixmer-based+antisense+oligonucleotides+correct+alternative+splicing+of+the+SMN2+gene+and+restore+SMN+protein+expression+in+type+1+SMA+fibroblasts.">LNA/DNA mixmer-based antisense oligonucleotides correct alternative splicing of the SMN2 gene and restore SMN protein expression in type 1 SMA fibroblasts.</a> Sci Rep. 7 (1), 3672 (2017).</li><li>Obika, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2'-O,4'-C-methyleneuridine+and+-cytidine.+Novel+bicyclic+nucleosides+having+a+fixed+C-3,-endo+sugar+puckering.">Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C-3,-endo sugar puckering.</a> Tetrahedron Letters. 38 (50), 8735-8738 (1997).</li><li>Singh, S. K., Nielsen, P., Koshkin, A. A., Wengel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA+(locked+nucleic+acids):+synthesis+and+high-affinity+nucleic+acid+recognition.">LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition.</a> Chemical Communications. (4), 455-456 (1998).</li><li>Navarro, E., Serrano-Heras, G., Castano, M. J., Solera, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+detection+chemistry.">Real-time PCR detection chemistry.</a> Clin Chim Acta. 439, 231-250 (2015).</li><li>Urbanek, M. O., Nawrocka, A. U., Krzyzosiak, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+RNA+Detection+by+in+Situ+Hybridization+Methods.">Small RNA Detection by in Situ Hybridization Methods.</a> Int J Mol Sci. 16 (6), 13259-13286 (2015).</li><li>Wahlestedt, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+nontoxic+antisense+oligonucleotides+containing+locked+nucleic+acids.">Potent and nontoxic antisense oligonucleotides containing locked nucleic acids.</a> Proc Natl Acad Sci U S A. 97 (10), 5633-5638 (2000).</li><li>Rupaimoole, R., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+therapeutics:+towards+a+new+era+for+the+management+of+cancer+and+other+diseases.">MicroRNA therapeutics: towards a new era for the management of cancer and other diseases.</a> Nat Rev Drug Discov. 16 (3), 203-222 (2017).</li><li>Lanford, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+silencing+of+microRNA-122+in+primates+with+chronic+hepatitis+C+virus+infection.">Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection.</a> Science. 327 (5962), 198-201 (2010).</li><li>Shimo, T., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designing+Effective+Antisense+Oligonucleotides+for+Exon+Skipping.">Designing Effective Antisense Oligonucleotides for Exon Skipping.</a> Methods Mol Biol. 1687, 143-155 (2018).</li><li>Shimo, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+evaluation+of+locked+nucleic+acid-based+splice-switching+oligonucleotides+in+vitro.">Design and evaluation of locked nucleic acid-based splice-switching oligonucleotides in vitro.</a> Nucleic Acids Res. 42 (12), 8174-8187 (2014).</li><li>Nguyen, Q., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+Muscle+Cell+Model+to+Test+the+Exon+Skipping+Efficacy+for+Duchenne+Muscular+Dystrophy.">Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy.</a> J. Pers. Med. 7 (4), 13 (2017).</li><li>Echigoya, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+Antisense+Screening+and+Optimization+for+Exon+51+Skipping+in+Duchenne+Muscular+Dystrophy.">Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.</a> Mol Ther. , (2017).</li><li>Saito, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+PMO+found+in+dystrophic+dog+model+was+effective+in+cells+from+exon+7-deleted+DMD+patient.">Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient.</a> PLoS One. 5 (8), 12239 (2010).</li><li>Donnelly, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+murine+model+of+SMA.">Characterization of a murine model of SMA.</a> Neurobiol Dis. 45 (3), 992-998 (2012).</li><li>Lim, K. R., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eteplirsen+in+the+treatment+of+Duchenne+muscular+dystrophy.">Eteplirsen in the treatment of Duchenne muscular dystrophy.</a> Drug Des Devel Ther. 11, 533-545 (2017).</li><li>Paton, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nusinersen:+antisense+oligonucleotide+to+increase+SMN+protein+production+in+spinal+muscular+atrophy.">Nusinersen: antisense oligonucleotide to increase SMN protein production in spinal muscular atrophy.</a> Drugs Today (Barc). 53 (6), 327-337 (2017).</li><li>Prakash, T. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparing+in+vitro+and+in+vivo+activity+of+2'-O-[2-(methylamino)-2-oxoethyl]-+and+2'-O-methoxyethyl-modified+antisense+oligonucleotides.">Comparing in vitro and in vivo activity of 2'-O-[2-(methylamino)-2-oxoethyl]- and 2'-O-methoxyethyl-modified antisense oligonucleotides.</a> J Med Chem. 51 (9), 2766-2776 (2008).</li><li>Aoki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bodywide+skipping+of+exons+45-55+in+dystrophic+mdx52+mice+by+systemic+antisense+delivery.">Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery.</a> Proc Natl Acad Sci U S A. 109 (34), 13763-13768 (2012).</li></ol>

В vitro оценки метода, описанного здесь быстро, легко и достаточно чувствительным для тестирования различных AONs. Этот протокол является широко применимые к экзона пропуск и включение других генов и различных типов клеток. Кроме того большинство AON химия (за исключением PMOs) может transfect...

Спинальной мышечной атрофии (SMA) является фатальной нервно расстройства наследуется аутосомно-рецессивный шаблона. Он характеризуется деградацией двигательных нейронов и прогрессивного туловища и конечностей мышцы паралич1,2. Большинство залежей SMA вызваны гомозиготных мутация в гене выживания мотонейрона 1 (SMN1)3. Ген выживания мотонейрона 2 (SMN2) обратная копию SMN1и имеет практически идентичные последовательности, отличающихся только пять баз4,5. C-к Т переходной SMN2 расположен в экзона 7 делает гена почти нефункциональным потому что мутация приводит к важным экзона 7 исключаются в почти 90% SMN2 стенограммы(рисунок 1). SMN2 mRNAs отсутствует экзона 7 не может компенсировать SMN1 функции, потому что белковый продукт является неустойчивым и быстро разлагается.
Антисмысловые терапии недавно стала весьма перспективной стратегии для лечения SMA6. Недавнее одобрение nusinersen США продовольствия и медикаментов (FDA) сделал это первый препарат для лечения SMA7. Nusinersen является 18-mer антисмысловых олигонуклеотидов (АОН) с модификацией 2′-O-метоксиэтиловый (МО) и фосфоротиоат позвоночника. Препарат предназначен intronic сращивания глушителя N1 (МКС-N1) расположен в Интрон 7 SMN2 ген. Привязка nusinersen к МКС-N1 способствует восстановлению функциональных полнометражного SMN белка выражения от эндогенных SMN2 ген, вызывая экзона 7 Включение (рис. 1)8,9,10 . В настоящее время многие исследования с участием AON терапии для SMA сосредоточиться на расследование Роман химия AON, которые могут быть более эффективным и менее токсичен, чем nusinersen. Было продемонстрировано, что AONs с другими химия также эффективно стимулировать включение экзона в SMN2 экзона 7 как in vitro и in vivo11,12,13.
Заблокированные нуклеиновые кислоты (МШУ) являются химически модифицированных аналогов РНК, содержащие метиленовой мост, соединяющий 4′ -углерода с 2′ -кислорода в течение Фуранозы14,структуру (рис. 1б)15. По сравнению с ДНК или РНК, МШУ имеют увеличение сродство для привязки дополнительных РНК последовательности и имеют дополнительное преимущество быть устойчива к эндогенной nucleases. МШУ химии был применен для использования как зонды для флуоресценции в situ гибридизация (рыба) и ПЦР16,17. Кроме того, она используется для регулирования экспрессии генов в пробирке и в естественных условиях. GapmeR AONs представляют собой сочетание молекул одноцепочечной ДНК, в окружении нескольких МШУ на 5 ' и 3 ' концах. Они сбить экспрессии генов путем привязки дополнительных целевых мРНК, заставляя их деградации, активированного H РНКазы18. МШУ/ДНК mixmers являются AONs, которые состоят из нуклеотидов ДНК, интегрированы между МШУ. Представленные в этой ориентации они можно привязать Мирна препятствовать ее функции (LNA-antimiR)19. Некоторые МШУ antimiRs достигли клинические разработки. Для примеров miravirsen (AntimiR-122) МШУ antimiR, который подавляет мир-122 для лечения гепатита с и несколько фазы II клинических испытаний в настоящее время19,20. Недавно было продемонстрировано, что LNA/ДНК mixmers также может модулировать РНК сплайсинга21. Он может связать определенную последовательность мРНК и побудить экзона пропуск в мРНК и экзона включение делеций в SMN2 мРНК в vitro13,22.
В этой статье мы приводим методологию для индукции экзона включение с помощью AONs и оценки эффективности на уровне РНК и белка. Чтобы проиллюстрировать этот метод, мы использовали mixmers LNA/ДНК, ориентации МКС-N1 в Интрон 7 SMN2. AONs transfected в клетки пациентов SMA по lipotransfection индуцированных экзона 7 включение в окончательный SMN2 Стенограмма и upregulation производства белка SMN. Одним из преимуществ использования LNA/ДНК mixmers побудить экзона включение является эффективная концентрация для transfection значительно ниже, чем другие химия13. Этот метод может использоваться для многих других AONs, за исключением phosphorodiamidate Морфолино олигомеров (PMOs), которые, благодаря их нейтральный заряд, необходимо ввести клетки путем эндоцитоза индуцированных Эндо-Портер Сопредседатель трансфекции реагента.

<table border="0" cellpadding="0" cellspacing="0" style="width:655px;" width="655">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">SMA Fibroblasts</td>
			<td style="width:153px;">Coriell NIGMS human genetic cell repository</td>
			<td style="width:119px;">GM03813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">11320033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">F1051</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Penicillin-Streptomycin (10,000 U/mL)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15140122</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.05%), phenol red</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">25300062</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Serum-deprived media</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">31985070</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Transfection reagent</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15338100</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">guanidinium thiocyanate-phenol-chloroform (TRIzol)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15596-018</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">RT-PCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>Sequence 5&#39; to 3&#39;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTGCCTCCATTTCCTTCTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TGGTGTCATTTAGTGCTGCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCCCTGAGCTGAACGGGAAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GGAGGAGTTTGGTCGCTGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">qPCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCTATCATACTGGCTATTATATGGGTTTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTCTATGCCAGCATTTCTCCTTAAT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCTGGACCACCAATAATTCCCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>ATGCCAGCATTTCCATATAATAGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCAAATTCCATGGCACCGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>AGGGATCTCGCTCCTGGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chloroform</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">P3803</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glycogen, RNA grade</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">R0551</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">ImageJ Software</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Protease cocktail inhibitor&#160;</td>
			<td style="width:153px;">Roche</td>
			<td style="width:119px;">11836153001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cathode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.025 M Tris base + 40&#160;mM 6-aminocaproic acid + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.03 M Tris Base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Concentred Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.3 M Tris base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Beta Mercaptoethanol&#160;</td>
			<td style="width:153px;">Millipore</td>
			<td style="width:119px;">ES-007-E</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PVDF membrane&#160;</td>
			<td style="width:153px;">GE</td>
			<td style="width:119px;">10600021</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Loading/sample buffer for Western blotting</td>
			<td style="width:153px;">NuPage Invitrogen</td>
			<td style="width:119px;">NP007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">One-Step RT-PCR kit&#160;</td>
			<td style="width:153px;">Qiagen&#160;</td>
			<td style="width:119px;">210210</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">dNTPs</td>
			<td style="width:153px;">Clontech</td>
			<td style="width:119px;">3040</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts

Спинальной мышечной атрофии (SMA), смертельной неврологических заболеваний, вызванных потерей SMN1, представляет собой уникальный случай в области антисмысловых олигонуклеотидов (АОН)-опосредованной терапии. В то время как SMN1 мутации отвечают за болезни, включая FDA утвержденных nusinersen, показано AONs ориентации intronic сращивания глушителя (МКС) сайты в SMN2, восстановить SMN выражение и улучшить симптомы. В настоящее время многие исследования с участием AON терапии для SMA сосредоточиться на расследование Роман AON химия ориентации SMN2 , что может быть более эффективным и менее токсичен, чем nusinersen. Здесь мы описываем протокол для оценки в vitro экзона включение с помощью lipotransfection AONs, после чего обратной транскрипции полимеразной цепной реакции (ПЦР), количественные полимеразной цепной реакции (ПЦР) и Западный blotting. Этот метод может использоваться для различных типов AON химия. С помощью этого метода, мы показываем, что AONs состоит из чередующихся заблокированных нуклеиновых кислот (МШУ) и нуклеотидов ДНК (LNA/ДНК mixmers) приводят к эффективным SMN2 экзона включение и восстановление SMN белка в очень низкой концентрации и, следовательно, LNA / ДНК, на основе mixmer антисмысловых олигонуклеотидов может быть привлекательным терапевтические стратегии для лечения сплайсинга дефекты, вызванные генетических заболеваний. В vitro оценки метода, описанного здесь быстро, легко и достаточно чувствительным для тестирования различных Роман AONs.

С помощью пациента фибробластов SMA, мы ориентированы регионе глушителя МКС-N1 в Интрон 7 SMN2 ген с восьми различных mixmers антисмысловых LNA/ДНК, которые были transfected в концентрации 5 Нм (рис. 3). Каждый из mixmers содержал измененный phosphorothioated позвоночника, кото?...

Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

Оценка экзона включение индуцированных сращивания переключения антисмысловых олигонуклеотидов в фибробластов SMA пациента

Различные антисмысловых олигонуклеотидов (AONs) было показано, чтобы побудить экзона включение (соединитель модуляции) и спасти SMN выражение для спинальной мышечной атрофии (SMA). Здесь мы описываем протокол для AON lipotransfection побудить включение экзона гена SMN2 и методы оценки для определения эффективности в пациента фибробластов SMA.

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide ...

Research

JoVE Journal

Medicine

Vascular Occlusion Training for Inclusion Body Myositis: A Novel Therapeutic Approach

Сосудистые Occlusion тренинг для включения миозит Корпус: новый терапевтический подход

Inclusion body myositis (IBM) is a rare idiopathic inflammatory myopathy. It is known to produces remarkable muscle weakness and to greatly compromise ...

Experimental Generation of Carcinoma-Associated Fibroblasts (CAFs) from Human Mammary Fibroblasts

Experimental Generation of Carcinoma-Associated Fibroblasts CAFs from Human Mammary Fibroblasts

Экспериментальные Генерация Карцинома-Associated Фибробласты (CAFS) из молочной железы человека Фибробласты

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of ...

Mouse Model of Intraluminal MCAO: Cerebral Infarct Evaluation by Cresyl Violet Staining

Мыши Модель внутрипросветного MCAO: церебральный Оценка инфаркта на Cresyl Окрашивание Фиолетовый

Stroke is the third  cause of mortality and the leading cause of disability in the World. Ischemic  stroke accounts for approximately 80% of all strokes. ...

Cardiac Stress Test Induced by Dobutamine and Monitored by Cardiac Catheterization in Mice

Сердечная стресс-тест индуцированный Dobutamine и контролируется катетеризации сердца у мышей

Dobutamine is a &beta;-adrenergic agonist with an affinity higher for receptor expressed in the heart (&beta;1) than for receptors expressed in the ...

Evaluation of Lung Metastasis in Mouse Mammary Tumor Models by Quantitative Real-time PCR

Оценка метастазов в легких у мыши опухоли молочной Модели количественными ПЦР в реальном времени

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated ...

Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy

Multi-пропуск экзонов Использование Коктейль антисмысловые олигонуклеотиды в собачьих Х-хромосомой мышечной дистрофии

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon ...

A Model of Glaucoma Induced by Circumlimbal Suture in Rats and Mice

Модель глаукомы, индуцированных Circumlimbal шва у крыс и мышей

The circumlimbal suture is a technique for inducing experimental glaucoma in rodents by chronically elevating intraocular pressure (IOP), a well-known ...

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Количественный :18F-Naf-PET-МРТ Анализ для оценки динамического оборота костей у пациента с facetogenic Низкая боль в спине

Imaging techniques that reflect dynamic bone turnover may aid in characterizing a wide range of bone pathologies. Bone is a dynamic tissue undergoing ...

Invasive Hemodynamic Assessment for the Right Ventricular System and Hypoxia-Induced Pulmonary Arterial Hypertension in Mice

Инвазивная гемодинамическая оценка правой желудочковой системы и гипоксия-индуцированной легочной артериальной гипертензии у мышей

Pulmonary arterial hypertension (PAH) is a chronic and severe cardiopulmonary disorder. Mice are a popular animal model used to mimic this disease. ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

Характеристика Exon Пропуск эффективность в DMD пациент образцов в клинических испытаниях антисенс олигонуклеотидов

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...