Name: evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts
Uploaded: 2018-05-11T14:30:00
Description: Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

Yazarlar Nicole McRorie deneyler ile yardım için teşekkür. Bu eser tıp ve diş hekimliği, Slipchuk SMA Araştırma Vakfı araştırma hibe, Kanada kurumları, Sağlık Araştırma (CIHR), arkadaş Garrett Cumming araştırma fonları, HM Toupin Nöroloji Alberta Üniversitesi fakülte tarafından desteklenmiştir Bilim araştırma fonları, kas distrofisi Kanada, Kanada Vakfı için yenilik, Alberta kurumsal ve gelişmiş eğitim ve kadın ve çocuk sağlığı Araştırma Enstitüsü (WCHRI).

1. hücre kültürü
<ol><li>Kültür SMA hastanın fibroblast (değiştirilmiş Dulbecco'nın, kartal orta 1: 1 F-12 (Ham) ile % 10 fetal sığır serum (FBS) ve % 0,5 penisilin/streptomisin) büyüme orta 37 ° C'de CO2 kuluçka</li>
	<li>Bir otomatik hücre sayaç kullanarak hücre konsantrasyonu belirlemek ve 1 x 105 hücre/ml büyüme orta ve ardından uygun plaka üzerinde tohum hücreleri oranında seyreltin. 12-şey tabak (iyi başına 1 mL) RT-PCR veya qPCR için kullanın.</li>
	<li>Taba...

<ol>
	<li>Iascone, D. M., Henderson, C. E., Lee, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+muscular+atrophy:+from+tissue+specificity+to+therapeutic+strategies.">Spinal muscular atrophy: from tissue specificity to therapeutic strategies.</a> F1000Prime Rep. 7, 4 (2015).</li><li>Touznik, A., Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+developments+in+exon+skipping+and+splice+modulation+therapies+for+neuromuscular+diseases.">New developments in exon skipping and splice modulation therapies for neuromuscular diseases.</a> Expert Opin Biol Ther. 14 (6), 809-819 (2014).</li><li>Lefebvre, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+Characterization+of+a+Spinal+Muscular+Atrophy-Determining+Gene.">Identification and Characterization of a Spinal Muscular Atrophy-Determining Gene.</a> Cell. 80 (1), 155-165 (1995).</li><li>Lorson, C. L., Hahnen, E., Androphy, E. J., Wirth, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+in+the+SMN+gene+regulates+splicing+and+is+responsible+for+spinal+muscular+atrophy.">A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 96 (11), 6307-6311 (1999).</li><li>Monani, U. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+difference+that+alters+splicing+patterns+distinguishes+the+SMA+gene+SMN1+from+the+copy+gene+SMN2.">A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2.</a> Hum Mol Genet. 8 (7), 1177-1183 (1999).</li><li>Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+therapy+in+neurology.">Antisense therapy in neurology.</a> J Pers Med. 3 (3), 144-176 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Ther. 27 (2), 67-69 (2017).</li><li>Hua, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peripheral+SMN+restoration+is+essential+for+long-term+rescue+of+a+severe+spinal+muscular+atrophy+mouse+model.">Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model.</a> Nature. 478 (7367), 123-126 (2011).</li><li>Hua, Y., Vickers, T. A., Baker, B. F., Bennett, C. F., Krainer, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+SMN2+exon+7+inclusion+by+antisense+oligonucleotides+targeting+the+exon.">Enhancement of SMN2 exon 7 inclusion by antisense oligonucleotides targeting the exon.</a> PLoS Biol. 5 (4), 73 (2007).</li><li>Passini, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+oligonucleotides+delivered+to+the+mouse+CNS+ameliorate+symptoms+of+severe+spinal+muscular+atrophy.">Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy.</a> Sci Transl Med. 3 (72), (2011).</li><li>Hammond, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+peptide-mediated+oligonucleotide+therapy+improves+long-term+survival+in+spinal+muscular+atrophy.">Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 113 (39), 10962-10967 (2016).</li><li>Porensky, P. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+administration+of+morpholino+antisense+oligomer+rescues+spinal+muscular+atrophy+in+mouse.">A single administration of morpholino antisense oligomer rescues spinal muscular atrophy in mouse.</a> Hum Mol Genet. 21 (7), 1625-1638 (2012).</li><li>Touznik, A., Maruyama, R., Hosoki, K., Echigoya, Y., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA/DNA+mixmer-based+antisense+oligonucleotides+correct+alternative+splicing+of+the+SMN2+gene+and+restore+SMN+protein+expression+in+type+1+SMA+fibroblasts.">LNA/DNA mixmer-based antisense oligonucleotides correct alternative splicing of the SMN2 gene and restore SMN protein expression in type 1 SMA fibroblasts.</a> Sci Rep. 7 (1), 3672 (2017).</li><li>Obika, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2'-O,4'-C-methyleneuridine+and+-cytidine.+Novel+bicyclic+nucleosides+having+a+fixed+C-3,-endo+sugar+puckering.">Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C-3,-endo sugar puckering.</a> Tetrahedron Letters. 38 (50), 8735-8738 (1997).</li><li>Singh, S. K., Nielsen, P., Koshkin, A. A., Wengel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA+(locked+nucleic+acids):+synthesis+and+high-affinity+nucleic+acid+recognition.">LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition.</a> Chemical Communications. (4), 455-456 (1998).</li><li>Navarro, E., Serrano-Heras, G., Castano, M. J., Solera, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+detection+chemistry.">Real-time PCR detection chemistry.</a> Clin Chim Acta. 439, 231-250 (2015).</li><li>Urbanek, M. O., Nawrocka, A. U., Krzyzosiak, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+RNA+Detection+by+in+Situ+Hybridization+Methods.">Small RNA Detection by in Situ Hybridization Methods.</a> Int J Mol Sci. 16 (6), 13259-13286 (2015).</li><li>Wahlestedt, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+nontoxic+antisense+oligonucleotides+containing+locked+nucleic+acids.">Potent and nontoxic antisense oligonucleotides containing locked nucleic acids.</a> Proc Natl Acad Sci U S A. 97 (10), 5633-5638 (2000).</li><li>Rupaimoole, R., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+therapeutics:+towards+a+new+era+for+the+management+of+cancer+and+other+diseases.">MicroRNA therapeutics: towards a new era for the management of cancer and other diseases.</a> Nat Rev Drug Discov. 16 (3), 203-222 (2017).</li><li>Lanford, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+silencing+of+microRNA-122+in+primates+with+chronic+hepatitis+C+virus+infection.">Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection.</a> Science. 327 (5962), 198-201 (2010).</li><li>Shimo, T., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designing+Effective+Antisense+Oligonucleotides+for+Exon+Skipping.">Designing Effective Antisense Oligonucleotides for Exon Skipping.</a> Methods Mol Biol. 1687, 143-155 (2018).</li><li>Shimo, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+evaluation+of+locked+nucleic+acid-based+splice-switching+oligonucleotides+in+vitro.">Design and evaluation of locked nucleic acid-based splice-switching oligonucleotides in vitro.</a> Nucleic Acids Res. 42 (12), 8174-8187 (2014).</li><li>Nguyen, Q., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+Muscle+Cell+Model+to+Test+the+Exon+Skipping+Efficacy+for+Duchenne+Muscular+Dystrophy.">Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy.</a> J. Pers. Med. 7 (4), 13 (2017).</li><li>Echigoya, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+Antisense+Screening+and+Optimization+for+Exon+51+Skipping+in+Duchenne+Muscular+Dystrophy.">Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.</a> Mol Ther. , (2017).</li><li>Saito, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+PMO+found+in+dystrophic+dog+model+was+effective+in+cells+from+exon+7-deleted+DMD+patient.">Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient.</a> PLoS One. 5 (8), 12239 (2010).</li><li>Donnelly, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+murine+model+of+SMA.">Characterization of a murine model of SMA.</a> Neurobiol Dis. 45 (3), 992-998 (2012).</li><li>Lim, K. R., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eteplirsen+in+the+treatment+of+Duchenne+muscular+dystrophy.">Eteplirsen in the treatment of Duchenne muscular dystrophy.</a> Drug Des Devel Ther. 11, 533-545 (2017).</li><li>Paton, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nusinersen:+antisense+oligonucleotide+to+increase+SMN+protein+production+in+spinal+muscular+atrophy.">Nusinersen: antisense oligonucleotide to increase SMN protein production in spinal muscular atrophy.</a> Drugs Today (Barc). 53 (6), 327-337 (2017).</li><li>Prakash, T. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparing+in+vitro+and+in+vivo+activity+of+2'-O-[2-(methylamino)-2-oxoethyl]-+and+2'-O-methoxyethyl-modified+antisense+oligonucleotides.">Comparing in vitro and in vivo activity of 2'-O-[2-(methylamino)-2-oxoethyl]- and 2'-O-methoxyethyl-modified antisense oligonucleotides.</a> J Med Chem. 51 (9), 2766-2776 (2008).</li><li>Aoki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bodywide+skipping+of+exons+45-55+in+dystrophic+mdx52+mice+by+systemic+antisense+delivery.">Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery.</a> Proc Natl Acad Sci U S A. 109 (34), 13763-13768 (2012).</li></ol>

Burada açıklanan vitro değerlendirme yöntemi hızlı, kolay ve çeşitli AONs test etmek için yeterince duyarlı. Bu protokol atlama exon ve diğer genler ve çeşitli hücre tiplerinin dahil edilmesi için yaygın olarak uygulanmaktadır. Buna ek olarak, çoğu AON kimyaları (PMOs dışında) bu yöntemi kullanarak transfected. AONs pre-mRNA endojen ile yapay olarak tanıtılan gen üzerinden Uçbirleştirme düzenleyen ve hedeflenen genleri taşıyan plazmid vektörleri ile ortak transfected olabilir.</p...

Spinal kas atrofisi (SMA) bir otozomal resesif desen miras ölümcül bir nöromüsküler hastalığıdır. Bu motor nöronlar ve ilerici gövde ve bacak kas felci1,2bozulması ile karakterizedir. SMA oluşum motor nöron 1 yaşama (SMN1) gen3homozigoz bir mutasyon nedeniyle çoğu. Motor nöron 2 yaşama (SMN2) gen SMN1ters bir kopyası ve sadece beş üsleri4,5tarafından farklı hemen hemen aynı sırası vardır. Mutasyon temel exon SMN2 transkript (şekil 1bir) neredeyse % 90 hariç 7 yol açar, çünkü exon 7 bulunan SMN2 bir C T geçmesini gen neredeyse işlevsiz yapar. Protein ürün kararsız ve hızla düşer çünkü exon 7 eksik SMN2 mRNA'ların SMN1 işlevi için telafi edemez.
Antianlamlı terapisi son zamanlarda SMA6tedavisi için çok umut verici bir strateji olarak ortaya çıktı. Son nusinersen ABD Gıda ve İlaç Dairesi (FDA) tarafından onaylanması ilk ilaç SMA7tedavisi için kullanılabilir hale. Nusinersen 2 '-O-metoksietil değişiklik (MOE) ve bir phosphorothioate omurga ile bir 18-mer antianlamlı Oligonükleotid (AON) olduğunu. Uyuşturucu intronic dikişi susturucu N1 hedefler (ISS-N1) bulunan intron 7 SMN2 gen. ISS-N1 nusinersen bağlama fonksiyonel tam uzunlukta SMN protein ifadeden endojen SMN2 gen kurtarılması exon 7 dahil (şekil 1bir)8,9,10 inducing tarafından teşvik . Şu anda, AON terapi için SMA içeren birçok çalışma daha nusinersen daha etkili ve daha az toksik olabilir roman AON kimyaları soruşturma üzerinde odaklanın. AONs diğer kimyaları ile SMN2 exon 7 exon eklenmesi de verimli bir şekilde ikna etmek kanıtlanmıştır vitro ve in vivo11,12,13.
Kilitli nükleik asitler (eskimiş) kimyasal olarak değiştirilmiş RNA analogları Metilen köprü 2 ' - ileoksijen furanose yapısı (şekil 1b)14,15içinde 4 ' -karbon bağlayan içeren vardır. DNA'lar ya da RNA'ları ile karşılaştırıldığında, eskimiş tamamlayıcı RNA dizileri bağlama için artan bir ilgi ve endojen enzimler için son derece dirençli olmanın yararı vardır. LNA kimya kullanım için probları Floresans in situ hibridizasyon (balık) ve qPCR16,17olarak uygulanmıştır. Ayrıca, gen ekspresyonu düzenlemek için kullanılan vitro ve içinde vivo. GapmeR AONs 5've 3'ucunda birkaç eskimiş çevrili iki tek iplikçikli DNA molekülün bir bileşimidir. Onlar gen ekspresyonu bağlama tarafından hedeflenen mRNA'ların onları harekete geçirmek RNase H18tarafından bozulmuş neden, tamamlayıcı knock down. LNA/DNA mixmers eskimiş arasında entegre DNA nükleotit oluşan AONs vardır. Bu yönde sunulan Onlar onun işlevi (LNA-antimiR)19inhibe miRNA bağlayabilirsiniz. Bazı LNA antimiRs klinik geliştirme ulaştınız. Örnekler için miravirsen (AntimiR-122) Hepatit C enfeksiyonu tedavi etmek için miR-122 engeller bir LNA-antimiR ve birkaç Aşama II klinik şu anda devam eden19,20. Son zamanlarda, LNA/DNA mixmers da21Uçbirleştirme RNA modüle kanıtlanmıştır. Bu mRNA belirli bir dizi bağlamak ve SMN2 mRNA vitro13,22. dystrophin mRNA ve exon eklenmesi atlama exon teşvik
Bu makalede, indüksiyon AONs ve etkinliğinin değerlendirilmesi RNA ve protein düzeylerinde kullanarak exon katılım için bir metodoloji anahat. Bu yöntem örneklemek için ISS-N1 SMN2intron 7 hedefleme LNA/DNA mixmers kullanılır. SMA hasta hücrelere lipotransfection tarafından transfected AONs son SMN2 transkript ve upregulation SMN protein üretiminin exon 7 eklenmesi indüklenen. Exon dahil neden LNA/DNA mixmers kullanmanın avantajları etkili konsantrasyon transfection için diğer kimyaları13önemli ölçüde daha düşük olmasıdır. Bu yöntem birçok diğer AONs phosphorodiamidate morpholino reaksiyonlar (PMOs), hangi, tarafsız onların ücret nedeniyle, Endo-Porter co transfection reaktif tarafından indüklenen endositoz ile hücreleri girmeniz gerekir hariç için kullanılabilir.

<table border="0" cellpadding="0" cellspacing="0" style="width:655px;" width="655">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">SMA Fibroblasts</td>
			<td style="width:153px;">Coriell NIGMS human genetic cell repository</td>
			<td style="width:119px;">GM03813</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">11320033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Fetal Bovine Serum</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">F1051</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Penicillin-Streptomycin (10,000 U/mL)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15140122</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.05%), phenol red</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">25300062</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Serum-deprived media</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">31985070</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Transfection reagent</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15338100</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">guanidinium thiocyanate-phenol-chloroform (TRIzol)</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">15596-018</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">RT-PCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>Sequence 5&#39; to 3&#39;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTGCCTCCATTTCCTTCTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TGGTGTCATTTAGTGCTGCTC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCCCTGAGCTGAACGGGAAG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GGAGGAGTTTGGTCGCTGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">qPCR Primers</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCTATCATACTGGCTATTATATGGGTTTT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">full-length SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>CTCTATGCCAGCATTTCTCCTTAAT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 forward:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>TCTGGACCACCAATAATTCCCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">&#8710;7&#160;SMN2 reverse:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>ATGCCAGCATTTCCATATAATAGCC</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH forward:&#160;</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>GCAAATTCCATGGCACCGT</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">GAPDH reverse:</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>AGGGATCTCGCTCCTGGAA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chloroform</td>
			<td style="width:153px;">Sigma-Aldrich</td>
			<td style="width:119px;">P3803</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Glycogen, RNA grade</td>
			<td style="width:153px;">Thermo Fisher</td>
			<td style="width:119px;">R0551</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">ImageJ Software</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Protease cocktail inhibitor&#160;</td>
			<td style="width:153px;">Roche</td>
			<td style="width:119px;">11836153001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cathode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.025 M Tris base + 40&#160;mM 6-aminocaproic acid + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.03 M Tris Base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Concentred Anode Buffer</td>
			<td style="width:153px;"></td>
			<td style="width:119px;"></td>
			<td>0.3 M Tris base + 20% Methanol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Beta Mercaptoethanol&#160;</td>
			<td style="width:153px;">Millipore</td>
			<td style="width:119px;">ES-007-E</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PVDF membrane&#160;</td>
			<td style="width:153px;">GE</td>
			<td style="width:119px;">10600021</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Loading/sample buffer for Western blotting</td>
			<td style="width:153px;">NuPage Invitrogen</td>
			<td style="width:119px;">NP007</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">One-Step RT-PCR kit&#160;</td>
			<td style="width:153px;">Qiagen&#160;</td>
			<td style="width:119px;">210210</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">dNTPs</td>
			<td style="width:153px;">Clontech</td>
			<td style="width:119px;">3040</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts

Spinal kas atrofisi (SMA) SMN1, kaybına neden ölümcül bir nörolojik hastalık antianlamlı Oligonükleotid (AON) alanında benzersiz bir olgu sunar-terapi aracılı. SMN1 mutasyonlar hastalık için sorumlu olmakla birlikte, SMN2, intronic splice susturucu (ISS) siteleri hedefleme AONs nusinersen, FDA onaylı dahil olmak üzere gösterilmiştir SMN ifade geri yüklemek ve semptomları iyileştirmek için. Şu anda, AON terapi için SMA içeren birçok çalışma daha nusinersen daha etkili ve daha az toksik olabilir SMN2 hedefleme roman AON kimyaları soruşturma üzerinde odaklanın. Burada, exon dahil ters transkripsiyon Polimeraz zincir reaksiyonu (RT-PCR), nicel Polimeraz zincir reaksiyonu (qPCR) ve Western Blot takip AONs lipotransfection kullanarak vitro değerlendirilmesi için bir protokol açıklayın. Bu yöntem AON kimyaları çeşitli türleri için istihdam edilebilir. Bu yöntemi kullanarak, biz AONs oluşan alternatif kilitli nükleik asitleri (eskimiş) ve DNA nükleotit (LNA/DNA mixmers) kurşun verimli SMN2 exon eklenmesi ve bir çok düşük konsantrasyon ve bu nedenle, LNA SMN protein restorasyonu için göstermek / DNA mixmer tabanlı antianlamlı oligonucleotides genetik hastalıklar kaynaklanan alışılageldik kusurlar tedavisi için çekici bir tedavi stratejisi olabilir. Burada açıklanan vitro değerlendirme yöntemi hızlı, kolay ve çeşitli roman AONs test etmek için yeterince duyarlı.

SMA hasta fibroblastlar kullanarak, intron 7 SMN2 gen bir 5 nM konsantrasyonu (şekil 3) transfected antianlamlı sekiz farklı LNA/DNA mixmers ile ISS-N1 susturucu bölgede hedef aldı. Her mixmers biri onları nükleaz bozulması direnmeye etkin bir değiştirilmiş phosphorothioated omurga yer. Mixmers, SMN2 exon oranı etkinliğini değerlendirmek için 7 dahil RT-PCR ve SMN2için belirli primerler kullanılarak qPCR sayısal. H...

Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

Tarafından indüklenen Exon dahil değerlendirilmesi Splice SMA hasta fibroblastlar anahtarlama antianlamlı Oligonucleotides

Çeşitli antianlamlı oligonucleotides (AONs) exon eklenmesi (splice modülasyon) teşvik ve spinal kas atrofisi (SMA) için SMN ifade kurtarma gösterilmiştir. Burada, biz AON lipotransfection SMN2 gen ve SMA hasta fibroblastlar etkinliğini belirlemek için değerlendirme yöntemleri exon eklenmesi ikna etmek için bir iletişim kuralı tanımlamak.

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide ...

Research

JoVE Journal

Medicine

Vascular Occlusion Training for Inclusion Body Myositis: A Novel Therapeutic Approach

Damar Tıkanıklığı Eğitim İçerme Vücut Miyozit: Yeni Bir Tedavi Yaklaşımı

Inclusion body myositis (IBM) is a rare idiopathic inflammatory myopathy. It is known to produces remarkable muscle weakness and to greatly compromise ...

Experimental Generation of Carcinoma-Associated Fibroblasts (CAFs) from Human Mammary Fibroblasts

Experimental Generation of Carcinoma-Associated Fibroblasts CAFs from Human Mammary Fibroblasts

İnsan Meme Fibroblastlar Karsinom İlişkili Fibroblastlar Deneysel Nesil (CAFs)

Carcinomas are complex tissues comprised of neoplastic cells and a non-cancerous compartment referred to as the 'stroma'. The stroma consists of ...

Mouse Model of Intraluminal MCAO: Cerebral Infarct Evaluation by Cresyl Violet Staining

Intraluminar MCAO Mouse Model: kresil Violet Boyama tarafından Serebral İnfarktı Değerlendirilmesi

Stroke is the third  cause of mortality and the leading cause of disability in the World. Ischemic  stroke accounts for approximately 80% of all strokes. ...

Cardiac Stress Test Induced by Dobutamine and Monitored by Cardiac Catheterization in Mice

Kardiyak Stres Testi Dobutamin İndüklemiş ve Farelerde Kalp Kateterizasyonu tarafından İzlenen

Dobutamine is a &beta;-adrenergic agonist with an affinity higher for receptor expressed in the heart (&beta;1) than for receptors expressed in the ...

Evaluation of Lung Metastasis in Mouse Mammary Tumor Models by Quantitative Real-time PCR

Kantitatif gerçek zamanlı PCR ile fare meme tümör modellerinde akciğer metastazı Değerlendirilmesi

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated ...

Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy

Köpek X-bağlantılı Musküler Distrofi Kokteyl Antisens oligonükleotidleri kullanılarak atlanıyor Çok ekson

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon ...

A Model of Glaucoma Induced by Circumlimbal Suture in Rats and Mice

Manken Circumlimbal dikiş sıçanlar ve fareler tarafından indüklenen glokom

The circumlimbal suture is a technique for inducing experimental glaucoma in rodents by chronically elevating intraocular pressure (IOP), a well-known ...

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Quantitative [18F]-Naf-PET-MRI Analysis for the Evaluation of Dynamic Bone Turnover in a Patient with Facetogenic Low Back Pain

Nicel [18F]-Facetogenic alçak sırt ağrısı olan bir hastada dinamik kemik cirosunun değerlendirilmesi Için NAF-Pet-MRI Analizi

Imaging techniques that reflect dynamic bone turnover may aid in characterizing a wide range of bone pathologies. Bone is a dynamic tissue undergoing ...

Invasive Hemodynamic Assessment for the Right Ventricular System and Hypoxia-Induced Pulmonary Arterial Hypertension in Mice

Farelerde Sağ Ventrikül Sistemi ve Hipoksiye Bağlı Pulmoner Arteriyel Hipertansiyon için İnvaziv Hemodinamik Değerlendirme

Pulmonary arterial hypertension (PAH) is a chronic and severe cardiopulmonary disorder. Mice are a popular animal model used to mimic this disease. ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

Antisense Oligonükleotidlerin Klinik Çalışmalarında DMD Hasta Örneklerinde Exon Atlama Etkinliğinin Karakterize Edilmesi

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...