Name: identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis
Uploaded: 2018-04-16T14:00:00
Description: Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃŽÂ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

JQW, XD, RCDD og YY blev støttet af tilskud fra de nationale institutter for sundhed R01 NS088353; NIH grant 1R21AR071583-01; den Staman Ogilvie fond-Hermann Mindefond; UTHealth HJERNEN initiativ og CTSA UL1 TR000371; og et tilskud fra University of Texas System neurovidenskab og Neurotechnology Research Institute (Grant #362469).

Alle animalske forbrug og eksperimenterende protokoller blev udført i overensstemmelse med retningslinjer for pleje og anvendelse af forsøgsdyr og godkendt af den institutionelle biosikkerhed og dyrs Velfærdsudvalg på University of Texas Health Science Center i Houston.
1. rensning af PDGFRα Positive Oligodendrocyte slægt celler fra mus hjernen (modificeret fra tidligere beskrevne immunopanning protokoller5,6,<sup class=...

<ol>
	<li>Wu, J. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tcf7+is+an+important+regulator+of+the+switch+of+self-renewal+and+differentiation+in+a+multipotential+hematopoietic+cell+line.">Tcf7 is an important regulator of the switch of self-renewal and differentiation in a multipotential hematopoietic cell line.</a> PLoS Genet. 8 (3), e1002565 (2012).</li><li>Zuchero, J. B., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+and+extrinsic+control+of+oligodendrocyte+development.">Intrinsic and extrinsic control of oligodendrocyte development.</a> Curr Opin Neurobiol. 23 (6), 914-920 (2013).</li><li>Liu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+oligodendrocyte+differentiation+by+Olig2+and+Sox10:+evidence+for+reciprocal+interactions+and+dosage-dependent+mechanisms.">Induction of oligodendrocyte differentiation by Olig2 and Sox10: evidence for reciprocal interactions and dosage-dependent mechanisms.</a> Dev Biol. 302 (2), 683-693 (2007).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+Identification+of+Long+Non-coding+RNAs+in+Purified+Cell+Types+from+the+Brain+Reveals+Functional+LncRNA+in+OPC+Fate+Determination.">Comprehensive Identification of Long Non-coding RNAs in Purified Cell Types from the Brain Reveals Functional LncRNA in OPC Fate Determination.</a> PLoS Genet. 11 (12), e1005669 (2015).</li><li>Hilgenberg, L. G., Smith, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+dissociated+mouse+cortical+neuron+cultures.">Preparation of dissociated mouse cortical neuron cultures.</a> J Vis Exp. (10), e562 (2007).</li><li>Emery, B., Dugas, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+oligodendrocyte+lineage+cells+from+mouse+cortices+by+immunopanning.">Purification of oligodendrocyte lineage cells from mouse cortices by immunopanning.</a> Cold Spring Harb Protoc. 2013 (9), 854-868 (2013).</li><li>Cahoy, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptome+database+for+astrocytes,+neurons,+and+oligodendrocytes:+a+new+resource+for+understanding+brain+development+and+function.">A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function.</a> J Neurosci. 28 (1), 264-278 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> J Neurosci. 34 (36), 11929-11947 (2014).</li><li>Cheng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+protein+signaling+and+olig1/2+interact+to+regulate+the+differentiation+and+maturation+of+adult+oligodendrocyte+precursor+cells.">Bone morphogenetic protein signaling and olig1/2 interact to regulate the differentiation and maturation of adult oligodendrocyte precursor cells.</a> Stem Cells. 25 (12), 3204-3214 (2007).</li><li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimmomatic:+a+flexible+trimmer+for+Illumina+sequence+data.">Trimmomatic: a flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30 (15), 2114-2120 (2014).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Team, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+language+and+environment+for+statistical+computing.">A language and environment for statistical computing.</a> R Foundation for Statistical Computing. , (2015).</li><li>Kharchenko, P. V., Tolstorukov, M. Y., Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+analysis+of+ChIP-seq+experiments+for+DNA-binding+proteins.">Design and analysis of ChIP-seq experiments for DNA-binding proteins.</a> Nat Biotechnol. 26 (12), 1351-1359 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucleic Acids Res. 37 (Web Server issue), W202-W208 (2009).</li><li>Sims, D., Sudbery, I., Ilott, N. E., Heger, A., Ponting, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+depth+and+coverage:+key+considerations+in+genomic+analyses.">Sequencing depth and coverage: key considerations in genomic analyses.</a> Nat Rev Genet. 15 (2), 121-132 (2014).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Consortium, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Kheradpour, P., Kellis, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+discovery+and+characterization+of+regulatory+motifs+in+ENCODE+TF+binding+experiments.">Systematic discovery and characterization of regulatory motifs in ENCODE TF binding experiments.</a> Nucleic Acids Res. 42 (5), 2976-2987 (2014).</li><li>Dugas, J. C., Tai, Y. C., Speed, T. P., Ngai, J., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+analysis+of+oligodendrocyte+differentiation.">Functional genomic analysis of oligodendrocyte differentiation.</a> J Neurosci. 26 (43), 10967-10983 (2006).</li><li>Gilfillan, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limitations+and+possibilities+of+low+cell+number+ChIP-seq.">Limitations and possibilities of low cell number ChIP-seq.</a> BMC Genomics. 13, 645 (2012).</li><li>Raskatov, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+NF-kappaB-dependent+gene+transcription+using+programmable+DNA+minor+groove+binders.">Modulation of NF-kappaB-dependent gene transcription using programmable DNA minor groove binders.</a> Proc Natl Acad Sci U S A. 109 (4), 1023-1028 (2012).</li><li>Cheneby, J., Gheorghe, M., Artufel, M., Mathelier, A., Ballester, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ReMap+2018:+an+updated+atlas+of+regulatory+regions+from+an+integrative+analysis+of+DNA-binding+ChIP-seq+experiments.">ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments.</a> Nucleic Acids Res. , (2017).</li><li>Yevshin, I., Sharipov, R., Valeev, T., Kel, A., Kolpakov, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTRD:+a+database+of+transcription+factor+binding+sites+identified+by+ChIP-seq+experiments.">GTRD: a database of transcription factor binding sites identified by ChIP-seq experiments.</a> Nucleic Acids Res. 45 (D1), D61-D67 (2017).</li><li>Kulakovskiy, I. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HOCOMOCO:+a+comprehensive+collection+of+human+transcription+factor+binding+sites+models.">HOCOMOCO: a comprehensive collection of human transcription factor binding sites models.</a> Nucleic Acids Res. 41 (Database issue), D195-D202 (2013).</li><li>Jain, D., Baldi, S., Zabel, A., Straub, T., Becker, P. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+promoters+give+rise+to+false+positive+'Phantom+Peaks'+in+ChIP-seq+experiments.">Active promoters give rise to false positive 'Phantom Peaks' in ChIP-seq experiments.</a> Nucleic Acids Res. 43 (14), 6959-6968 (2015).</li><li>Gerstein, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+the+human+regulatory+network+derived+from+ENCODE+data.">Architecture of the human regulatory network derived from ENCODE data.</a> Nature. 489 (7414), 91-100 (2012).</li></ol>

Pattedyr gen forordning netværk er meget komplekse. ChIP-seq er en kraftfuld metode til at undersøge genome-wide protein-DNA interaktioner. Denne protokol omfatter Sådan udføres Olig2 ChIP-seq ved hjælp af et lavt antal renset OPCs fra mus hjerner (så lavt som 20 tusind celler pr. reaktion). Det første vigtige skridt for denne protokol er rensning af OPCs fra mus hjerner af immunopanning med PDGFRα antistof. Til positiv udvælgelse af OPCs med PDGFRα belagt plader belagt OPCs ofte svagt binder sig til PDGFRα pl...

Det er vigtigt at undersøge protein (eller protein kompleks) DNA bindinger og de epigenetiske mærker at bygge transcriptional regulerende net involveret i forskellige biologiske processer. Især kan bindingerne af transkriptionsfaktorer til genomisk DNA spille en vigtig rolle i genregulering, Celledifferentiering og væv-udvikling. Et kraftfuldt værktøj til at studere transkriptionel regulering og epigenetiske mekanismer er kromatin immunoprecipitation (ChIP). På grund af de hurtige fremskridt i den næste generation sequencing technology anvendes ChIP kombineret med høj overførselshastighed DNA-sekventering (ChIP-seq) til analyser af protein-DNA bindinger og epigenetiske mærker1. En standardprotokol, der ChIP-seq kræver dog omkring 20 millioner celler pr. reaktion, hvilket vanskeliggør anvendelsen af denne teknik, når cellen er begrænset, som isolerede primærelementer og sjældne cellepopulationer.
Oligodendrocyte slægt celler herunder oligodendrocyte forløber celler (OPCs) og oligodendrocytes distribueres bredt i hele hjernen og er afgørende for udvikling og funktion af hjernen. Som en slags forløber celler er OPCs i stand til selvfornyelse og differentiering. OPCs ikke kun tjene som stamfaderen til oligodendrocytes men også spille en vigtig rolle i udbredelsen af neuronal signalering ved at kommunikere med andre typer af hjernen celler2. Tidligere undersøgelser har antydet, at oligodendrocyte udvikling er reguleret af afstamning-specifikke transskriptionsfaktorer såsom Olig2 og Sox103,4. Disse transkriptionsfaktorer fandtes for at binde til regionerne promotor eller forstærker i nogle afgørende gener til at påvirke deres udtryk under oligodendrocyte specifikation og differentiering. Men det er udfordrende at identificere DNA bindende protein (eller protein kompleks) interesse for akut renset primære OPCs med et meget begrænset antal celler.
Denne protokol beskriver hvordan man systematisk undersøge den genomisk DNA immunoprecipitated af Olig2 i renset mus OPCs på genom-plan ved hjælp af ChIP-seq teknik. OPCs fra mus hjerner blev akut renset af immunopanning og bruges i en ChIP eksperiment uden spredning in vitro. Et begrænset antal OPCs kan opnås ved immunopanning og er utilstrækkelig til standard ChIP-seq eksperimenter. Heri, er en lav-celle ChIP-seq protokol med så lavt som 20 tusind celler pr. ChIP reaktion for transkriptionsfaktorer beskrevet. Kort sagt, blev tværbundet celler mængden og sonicated af en sonikering enhed til at vride kromatin. Den vredne kromatin blev inkuberet med Olig2 antistof samt protein A-belagte perler for at faelde Olig2 antistof bundet genomisk DNA. Efter eluering fra protein A-belagte perler og omvendt cross-linking, blev genomisk DNA udfældes ved Olig2 antistof renset ved phenol-chloroform ekstraktion. Det resulterende produkt var kvantificeres og udsat for T-hale, primer udglødning skabelon skifter og udvidelse, tilsætning af adaptere og forstærkning, bibliotek størrelse udvælgelse og rensning skridt for ChIP-seq bibliotek konstruktion.
Efter sekvensering, blev kvaliteten af de rå læsninger fra både den prøve, der tilberedes med Olig2 transskription faktor antistof og stikprøven, der analyseret. Lav kvalitet basepar og adapter indeholdende læse fragmenter blev trimmet. Næste, klippede læser blev justeret til musen reference genom. Genomisk regioner, der var betydeligt beriget for ChIP læser, i forhold til kontrolprøve, blev opdaget som toppe. Væsentlig tinder, der repræsenterer potentielle transskription faktor bindingssteder, blev filtreret og visualiseret i en genom-browser.
Navnlig, kan i denne protokol beskrevne metode anvendes bredt for ChIP-FF. i andre transkriptionsfaktorer med enhver celletype i begrænset antal.

<table>
	<tbody>
		<tr>
			<td>Reagent/ Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Banderiaea simplicifolia lectin 1</td>
			<td>Vector Laboratories</td>
			<td># L-1100</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat anti-PDGFRa antibody</td>
			<td>BD Bioscience</td>
			<td># 558774</td>
			<td></td>
		</tr>
		<tr>
			<td>Neural tissue dissociation Kit (P)</td>
			<td>MACS Miltenyi Biotec</td>
			<td># 130-092-628</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>STEMCELL technologies</td>
			<td># 07920</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Thermo Fisher</td>
			<td># 15596026</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody</td>
			<td>Millipore</td>
			<td># AB5320</td>
			<td></td>
		</tr>
		<tr>
			<td>Bioruptor Pico sonication device</td>
			<td>Diagenode</td>
			<td># B01060001</td>
			<td></td>
		</tr>
		<tr>
			<td>True MicroChIP kit</td>
			<td>Diagenode</td>
			<td># C01010130</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v)</td>
			<td>Thermo Fisher</td>
			<td># 15593031</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-Up kit</td>
			<td>MACHEREY-NAGEL</td>
			<td># 740609</td>
			<td></td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Assay Kit</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA SMART ChIP-Seq kit</td>
			<td>Clontech Laboratories</td>
			<td># 634865</td>
			<td></td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP</td>
			<td>Beckman Voulter</td>
			<td># A63880</td>
			<td></td>
		</tr>
		<tr>
			<td>GlycoBlue</td>
			<td>Thermo Fisher</td>
			<td># AM9516</td>
			<td></td>
		</tr>
		<tr>
			<td>pico-green</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>D-PBS</td>
			<td>Thermo Fisher</td>
			<td># 14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green master mix</td>
			<td>Bio-Rad Laboratories</td>
			<td># 1725124</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Fisher Scientific</td>
			<td># 11-320-033</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (P/S)</td>
			<td>Fisher Scientific</td>
			<td># 15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>N-2 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17502048</td>
			<td></td>
		</tr>
		<tr>
			<td>B-27 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17504044</td>
			<td></td>
		</tr>
		<tr>
			<td>insulin</td>
			<td>Sigma</td>
			<td># I6634</td>
			<td>Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 &#956;l of 1 N HCl.</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin, suitable for cell culture (BSA)</td>
			<td>Sigma</td>
			<td># A4161</td>
			<td>Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4</td>
		</tr>
		<tr>
			<td>Fibroblast Growth Factor basic Protein, Human recombinant (bFGF)</td>
			<td>EMD Millipore</td>
			<td># GF003</td>
			<td></td>
		</tr>
		<tr>
			<td>HUMAN PDGF-AA</td>
			<td>VWR</td>
			<td># 102061-188</td>
			<td></td>
		</tr>
		<tr>
			<td>poly-D-lysine</td>
			<td>VWR</td>
			<td># IC15017510</td>
			<td>Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using.</td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mm</td>
			<td>VWR</td>
			<td># 25373-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mm</td>
			<td>VWR</td>
			<td># 25373-187</td>
			<td></td>
		</tr>
		<tr>
			<td>HBSS, 10X, no Calcium, no Magnesium, no Phenol Red</td>
			<td>Fisher Scientific</td>
			<td># 14185-052</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue</td>
			<td>Stemcell Technologies</td>
			<td># 07050</td>
			<td></td>
		</tr>
		<tr>
			<td>protease inhibitor cocktail</td>
			<td>Sigma</td>
			<td># 11697498001</td>
			<td></td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>FastQC</td>
			<td>[10] http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td>
			<td></td>
			<td>Obtaining quality control metrics of raw and trimmed reads</td>
		</tr>
		<tr>
			<td>Trimmomatic 0.33</td>
			<td>[11] http://www.usadellab.org/cms/?page=trimmomatic</td>
			<td></td>
			<td>Trimming and filtering raw reads</td>
		</tr>
		<tr>
			<td>GENCODE mm10</td>
			<td>ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz</td>
			<td></td>
			<td>Mouse reference genome</td>
		</tr>
		<tr>
			<td>Bowtie2 2.2.4</td>
			<td>[12] http://bowtie-bio.sourceforge.net/bowtie2/index.shtml</td>
			<td></td>
			<td>Aligning reads to a reference genome</td>
		</tr>
		<tr>
			<td>SAMTools 1.5</td>
			<td>[13] http://samtools.sourceforge.net/</td>
			<td></td>
			<td>Converting SAM file into BAM format</td>
		</tr>
		<tr>
			<td>HOMER 4.9.1</td>
			<td>[14] http://homer.ucsd.edu/homer/</td>
			<td></td>
			<td>Creating a tag directory and annotating enriched genomic regions with gene symbols</td>
		</tr>
		<tr>
			<td>R 3.2.2</td>
			<td>[15] https://www.R-project.org/</td>
			<td></td>
			<td>Programming scripts and running functions</td>
		</tr>
		<tr>
			<td>SPP 1.13</td>
			<td>[16] https://github.com/hms-dbmi/spp</td>
			<td></td>
			<td>Creating a strand cross-correlation plot</td>
		</tr>
		<tr>
			<td>MACS2 2.2.4</td>
			<td>[17] https://github.com/taoliu/MACS</td>
			<td></td>
			<td>Finding regions of ChIP enrichment over control</td>
		</tr>
		<tr>
			<td>BEDTools 2.25</td>
			<td>[18] http://bedtools.readthedocs.io/en/latest/</td>
			<td></td>
			<td>Genome arithmetics</td>
		</tr>
		<tr>
			<td>bedGraphToBigWig</td>
			<td>http://hgdownload.cse.ucsc.edu/admin/exe/</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>IGV browser 2.3.58</td>
			<td>[19] http://software.broadinstitute.org/software/igv/</td>
			<td></td>
			<td>Visualization and browsing of significant ChIP-seq peaks</td>
		</tr>
		<tr>
			<td>Microsoft Excel</td>
			<td></td>
			<td></td>
			<td>Spreasheet program</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s blacklist</td>
			<td>https://sites.google.com/site/anshulkundaje/projects/blacklists</td>
			<td></td>
			<td>Filtering peaks</td>
		</tr>
		<tr>
			<td>mm10.chrom.sizes</td>
			<td>http://hgdownload.cse.ucsc.edu/goldenPath/mm10/bigZips/mm10.chrom.sizes.</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s motif database</td>
			<td>[25] http://compbio.mit.edu/encode-motifs/</td>
			<td></td>
			<td>Comprehensive motif database required for motif enrichment</td>
		</tr>
		<tr>
			<td>MEME-ChIP</td>
			<td>[20] http://meme-suite.org/index.html</td>
			<td></td>
			<td>Motif enrichment analysis and motif discovery</td>
		</tr>
		<tr>
			<td>Primer names used for qPCR</td>
			<td></td>
			<td></td>
			<td>Primer sequences used for qPCR</td>
		</tr>
		<tr>
			<td>Mbp-F:</td>
			<td></td>
			<td></td>
			<td>CTATAAATCGGCTCACAAGG</td>
		</tr>
		<tr>
			<td>Mbp-R:</td>
			<td></td>
			<td></td>
			<td>AGGCGGTTATATTAAGAAGC</td>
		</tr>
		<tr>
			<td>Iba1-F:</td>
			<td></td>
			<td></td>
			<td>ACTGCCAGCCTAAGACAACC</td>
		</tr>
		<tr>
			<td>Iba1-R:</td>
			<td></td>
			<td></td>
			<td>GCTTTTCCTCCCTGCAAATCC</td>
		</tr>
		<tr>
			<td>Mog-F:</td>
			<td></td>
			<td></td>
			<td>GGCTTCTTGGAGGAAGGGAC</td>
		</tr>
		<tr>
			<td>Mog-R:</td>
			<td></td>
			<td></td>
			<td>TGAATTGTCCTGCATAGCTGC</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td></td>
			<td></td>
			<td>ATGACATCAAGAAGGTGGTG</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td></td>
			<td></td>
			<td>CATACCAGGAAATGAGCTTG</td>
		</tr>
		<tr>
			<td>Tuj1-F</td>
			<td></td>
			<td></td>
			<td>TTTTCGTCTCTAGCCGCGTG</td>
		</tr>
		<tr>
			<td>Tuj1-R</td>
			<td></td>
			<td></td>
			<td>GATGACCTCCCAGAACTTGGC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-F</td>
			<td></td>
			<td></td>
			<td>AGAGTTACACGTTTGAGCTGTC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-R</td>
			<td></td>
			<td></td>
			<td>GTCCCTCCACGGTACTCCT</td>
		</tr>
	</tbody>
</table>

identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis

I pattedyrceller er gen transskription reguleret på en bestemt måde, celle type af transcriptional faktorer interaktioner med genomisk DNA. Afstamning-specifikke transkriptionsfaktorer betragtes som spiller en afgørende rolle i celle specifikation og differentiering under udvikling. ChIP kombineret med høj overførselshastighed DNA-sekventering (ChIP-FF.) er almindeligt anvendt til at analysere genome-wide bindingssteder transkriptionsfaktorer (eller dens tilknyttede komplekse) til genomisk DNA. Men et stort antal celler er nødvendig for et standard ChIP reaktion, hvilket gør det vanskeligt at studere det begrænsede antal isolerede primærelementer eller sjældne cellepopulationer. For at forstå den regulerende mekanisme af oligodendrocyte afstamning-specifikke transskription faktor Olig2 i akut renset mus OPCs, en detaljeret metode ved hjælp af ChIP-seq til at identificere genome-wide bindingsstederne af Olig2 (eller Olig2 komplekse) er vist. Først protokollen forklarer hvordan til at rense Trombocyt-afledt vækst faktor receptor alpha (PDGFRα) positiv OPCs fra mus hjerner. Dernæst Olig2 antistof medieret ChIP og bibliotek konstruktion udføres. Den sidste del beskriver bioinformatic software og procedurer, der anvendes til Olig2 ChIP-seq analyse. Sammenfattende rapporter dette papir en metode til at analysere genome-wide bindingerne af transcriptional faktor Olig2 i akut renset hjernen OPCs.

Lav-celle ChIP-seq blev udført og bioinformatic analyser blev udført for at undersøge de potentielle vekselvirkninger mellem transcriptional faktor Olig2 med genomisk DNA i akut renset hjernen OPCs. Figur 1 viser en generel arbejdsgang både den eksperimentelle og procedurer for analyse af data. I denne protokol, var postnatal mus hjerner adskilt i en enkelt celle suspension. Efter væv dissociation, blev immunopanning udført for at rense OPCs ved hjælp ...

Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃŽÂ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃƒÆ’Ã…Â½Ãƒâ€šÃ‚Â±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

Her præsenterer vi en protokol, der er designet til at analysere genome-wide bindingen af oligodendrocyte transskription faktoren 2 (Olig2) i akut renset hjernen oligodendrocyte forløber celler (OPCs) ved at udføre lav-celle kromatin immunoprecipitation (ChIP) , bibliotek forberedelse, høj overførselshastighed sekvensering og bioinformatic dataanalyse.

At identificere transskription faktor Olig2 genomisk bindingssteder i akut renset PDGFRα + celler ved lav-celle kromatin Immunoprecipitation sekventering analyse

In mammalian cells, gene transcription is regulated in a cell type specific manner by the interactions of transcriptional factors with genomic DNA. ...

Education

Research

JoVE Core

JoVE Journal

Molecular Biology

Biology

Neuroscience

Genetics

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFR&#945;+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

Unit 1

DNA Structure and Function

Gene Expression

SCIENTISTS IN ACTION

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural ...

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Since the discovery of Green Fluorescent Protein (GFP), there has been a revolutionary change in the use of live-cell imaging as a tool for understanding ...

Chromatin Immunoprecipitation from Dorsal Root Ganglia Tissue following Axonal Injury

Axons in the central nervous system (CNS) do not regenerate while those in the peripheral nervous system (PNS) do regenerate 
to a limited extent after ...

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange (ABE)

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange ABE

Påvisning af protein palmitoylering i dyrkede hippocampale neuroner ved immunopræcipitation og Acyl-Biotin Exchange (ABE)

Palmitoylation is a post-translational lipid  modification involving the attachment of a 16-carbon saturated fatty acid,  palmitate, to cysteine residues ...

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

Ekstracellulært Identifikation motorneuroner for en Muskel Motor Pool i<em&gt; Aplysia californica</em

In animals with large  identified neurons (e.g. mollusks), analysis of motor pools is done using  intracellular techniques1,2,3,4. Recently,  we developed ...

Intracerebroventricular Injection of Amyloid-&#946; Peptides in Normal Mice to Acutely Induce Alzheimer-like Cognitive Deficits

Intracerebroventricular Injection of Amyloid-ÃƒÅ½Ã‚Â² Peptides in Normal Mice to Acutely Induce Alzheimer-like Cognitive Deficits

Intracerebroventrikulær Injektion af amyloid-p-peptider i normale mus til Akut Fremkald Alzheimer-lignende kognitive mangler

Amyloid-&#946; (A&#946;) is a major pathological mediator of both familial and sporadic Alzheimer's disease (AD). In the brains of AD patients, ...

Assessment of Dopaminergic Homeostasis in Mice by Use of High-performance Liquid Chromatography Analysis and Synaptosomal Dopamine Uptake

Vurdering af dopaminerge homøostase i mus ved hjælp af High-performance væskekromatografi analyse og Synaptosomal dopamin optagelse

Dopamine (DA) is a modulatory neurotransmitter controlling motor activity, reward processes and cognitive function. Impairment of dopaminergic (DAergic) ...

Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark

Isolering og dyrkning af neurale stamceller efterfulgt af kromatin-Immunoprecipitation af Histon 3 lysin 79 Dimethylation Mark

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. ...

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

Isolering af voksen rygmarven kerner for massivt Parallel Single-kernen RNA sekventering

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a ...

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing (DIVA-Seq)

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing DIVA-Seq

Encellede RNA sekventering af Fluorescently mærket mus neuroner ved hjælp af manuel sortering og dobbelt In Vitro transskription med absolut tæller sekventering (DIVA-Seq)

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing ...