Name: identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis
Uploaded: 2018-04-16T14:00:00
Description: Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃŽÂ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

JQW, XD, RCDD en YY werden ondersteund door subsidies van de nationale instituten van gezondheid R01 NS088353; NIH grant 1R21AR071583-01; de Wouters Ogilvie Fonds-Hermann Gedenkfonds; de UTHealth hersenen initiatief en CTSA UL1 TR000371; en een beurs van de Universiteit van Texas systeem neurowetenschap en Neurotechnology Research Institute (Grant #362469).

Alle dierlijke gebruik en experimentele protocollen werden uitgevoerd volgens de richtsnoeren voor de zorg en het gebruik van proefdieren en goedgekeurd door de Commissie voor institutionele bioveiligheid en dierenwelzijn Comité bij de University of Texas Health Science Center op Houston.
1. de zuivering van PDGFRα positieve Oligodendrocyt Lineage cellen uit de hersenen van de muis (gewijzigd van bovenstaande immunopanning protocollen5,6</su...

<ol>
	<li>Wu, J. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tcf7+is+an+important+regulator+of+the+switch+of+self-renewal+and+differentiation+in+a+multipotential+hematopoietic+cell+line.">Tcf7 is an important regulator of the switch of self-renewal and differentiation in a multipotential hematopoietic cell line.</a> PLoS Genet. 8 (3), e1002565 (2012).</li><li>Zuchero, J. B., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+and+extrinsic+control+of+oligodendrocyte+development.">Intrinsic and extrinsic control of oligodendrocyte development.</a> Curr Opin Neurobiol. 23 (6), 914-920 (2013).</li><li>Liu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+oligodendrocyte+differentiation+by+Olig2+and+Sox10:+evidence+for+reciprocal+interactions+and+dosage-dependent+mechanisms.">Induction of oligodendrocyte differentiation by Olig2 and Sox10: evidence for reciprocal interactions and dosage-dependent mechanisms.</a> Dev Biol. 302 (2), 683-693 (2007).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+Identification+of+Long+Non-coding+RNAs+in+Purified+Cell+Types+from+the+Brain+Reveals+Functional+LncRNA+in+OPC+Fate+Determination.">Comprehensive Identification of Long Non-coding RNAs in Purified Cell Types from the Brain Reveals Functional LncRNA in OPC Fate Determination.</a> PLoS Genet. 11 (12), e1005669 (2015).</li><li>Hilgenberg, L. G., Smith, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+dissociated+mouse+cortical+neuron+cultures.">Preparation of dissociated mouse cortical neuron cultures.</a> J Vis Exp. (10), e562 (2007).</li><li>Emery, B., Dugas, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+oligodendrocyte+lineage+cells+from+mouse+cortices+by+immunopanning.">Purification of oligodendrocyte lineage cells from mouse cortices by immunopanning.</a> Cold Spring Harb Protoc. 2013 (9), 854-868 (2013).</li><li>Cahoy, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptome+database+for+astrocytes,+neurons,+and+oligodendrocytes:+a+new+resource+for+understanding+brain+development+and+function.">A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function.</a> J Neurosci. 28 (1), 264-278 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> J Neurosci. 34 (36), 11929-11947 (2014).</li><li>Cheng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+protein+signaling+and+olig1/2+interact+to+regulate+the+differentiation+and+maturation+of+adult+oligodendrocyte+precursor+cells.">Bone morphogenetic protein signaling and olig1/2 interact to regulate the differentiation and maturation of adult oligodendrocyte precursor cells.</a> Stem Cells. 25 (12), 3204-3214 (2007).</li><li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimmomatic:+a+flexible+trimmer+for+Illumina+sequence+data.">Trimmomatic: a flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30 (15), 2114-2120 (2014).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Team, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+language+and+environment+for+statistical+computing.">A language and environment for statistical computing.</a> R Foundation for Statistical Computing. , (2015).</li><li>Kharchenko, P. V., Tolstorukov, M. Y., Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+analysis+of+ChIP-seq+experiments+for+DNA-binding+proteins.">Design and analysis of ChIP-seq experiments for DNA-binding proteins.</a> Nat Biotechnol. 26 (12), 1351-1359 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucleic Acids Res. 37 (Web Server issue), W202-W208 (2009).</li><li>Sims, D., Sudbery, I., Ilott, N. E., Heger, A., Ponting, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+depth+and+coverage:+key+considerations+in+genomic+analyses.">Sequencing depth and coverage: key considerations in genomic analyses.</a> Nat Rev Genet. 15 (2), 121-132 (2014).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Consortium, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Kheradpour, P., Kellis, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+discovery+and+characterization+of+regulatory+motifs+in+ENCODE+TF+binding+experiments.">Systematic discovery and characterization of regulatory motifs in ENCODE TF binding experiments.</a> Nucleic Acids Res. 42 (5), 2976-2987 (2014).</li><li>Dugas, J. C., Tai, Y. C., Speed, T. P., Ngai, J., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+analysis+of+oligodendrocyte+differentiation.">Functional genomic analysis of oligodendrocyte differentiation.</a> J Neurosci. 26 (43), 10967-10983 (2006).</li><li>Gilfillan, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limitations+and+possibilities+of+low+cell+number+ChIP-seq.">Limitations and possibilities of low cell number ChIP-seq.</a> BMC Genomics. 13, 645 (2012).</li><li>Raskatov, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+NF-kappaB-dependent+gene+transcription+using+programmable+DNA+minor+groove+binders.">Modulation of NF-kappaB-dependent gene transcription using programmable DNA minor groove binders.</a> Proc Natl Acad Sci U S A. 109 (4), 1023-1028 (2012).</li><li>Cheneby, J., Gheorghe, M., Artufel, M., Mathelier, A., Ballester, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ReMap+2018:+an+updated+atlas+of+regulatory+regions+from+an+integrative+analysis+of+DNA-binding+ChIP-seq+experiments.">ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments.</a> Nucleic Acids Res. , (2017).</li><li>Yevshin, I., Sharipov, R., Valeev, T., Kel, A., Kolpakov, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTRD:+a+database+of+transcription+factor+binding+sites+identified+by+ChIP-seq+experiments.">GTRD: a database of transcription factor binding sites identified by ChIP-seq experiments.</a> Nucleic Acids Res. 45 (D1), D61-D67 (2017).</li><li>Kulakovskiy, I. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HOCOMOCO:+a+comprehensive+collection+of+human+transcription+factor+binding+sites+models.">HOCOMOCO: a comprehensive collection of human transcription factor binding sites models.</a> Nucleic Acids Res. 41 (Database issue), D195-D202 (2013).</li><li>Jain, D., Baldi, S., Zabel, A., Straub, T., Becker, P. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+promoters+give+rise+to+false+positive+'Phantom+Peaks'+in+ChIP-seq+experiments.">Active promoters give rise to false positive 'Phantom Peaks' in ChIP-seq experiments.</a> Nucleic Acids Res. 43 (14), 6959-6968 (2015).</li><li>Gerstein, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+the+human+regulatory+network+derived+from+ENCODE+data.">Architecture of the human regulatory network derived from ENCODE data.</a> Nature. 489 (7414), 91-100 (2012).</li></ol>

Bij zoogdiercellen verordening netwerken zijn zeer complex. ChIP-seq is een krachtige methode om onderzoeken van genoom-brede eiwit-DNA interacties. Dit protocol omvat het uitvoeren van Olig2 ChIP-seq met behulp van een laag aantal gezuiverde OPCs vanuit muis brains (zo laag als 20 duizend cellen per reactie). De eerste belangrijke stap voor dit protocol is de zuivering van OPCs van muis hersenen door immunopanning met PDGFRα antilichaam. Voor positieve selectie van OPCs met PDGFRα gecoate platen gecoate OPCs vaak zwak...

Het is belangrijk om te studeren het eiwit (of eiwit complex) DNA bindingen en de epigenetische merken transcriptionele regulerende netwerken die betrokken zijn bij verschillende biologische processen te bouwen. In het bijzonder kunnen de bindingen van transcriptiefactoren aan de genomic DNA spelen een belangrijke rol in de genregulatie, de celdifferentiatie en het weefsel ontwikkeling. Een krachtig hulpmiddel voor het bestuderen van de transcriptionele verordening en Epigenetische mechanismen is chromatine immunoprecipitation (ChIP). Als gevolg van de snelle vooruitgang in de technologie van de volgende generatie sequencing, wordt ChIP in combinatie met high-throughput DNA sequencing (ChIP-seq) gebruikt voor analyses van eiwit-DNA bindingen en epigenetische merken1. Een standaardprotocol voor ChIP-seq vereist echter ongeveer 20 miljoen cellen per reactie, waardoor de toepassing van deze techniek moeilijk wanneer het celaantal beperkt, zoals geïsoleerde primaire cellen en zeldzame cel populaties is.
Oligodendrocyt lineage cellen met inbegrip van oligodendrocyte voorlopercellen (OPCs) en oligodendrocyten zijn wijd verspreid over de hersenen en zijn essentieel voor de ontwikkeling en de functie van de hersenen. Als een soort van voorlopercellen zijn OPCs geschikt voor zowel zelf-vernieuwing en differentiatie. OPCs niet alleen dienen als progenitoren voor oligodendrocyten maar ook een belangrijke rol spelen in de verspreiding van neuronale signalering door te communiceren met andere soorten hersenen cellen2. Eerdere studies hebben gesuggereerd dat Oligodendrocyt ontwikkeling wordt gereguleerd door geslacht-specifieke transcriptiefactoren zoals Olig2 en Sox103,4. Deze transcriptiefactoren bleken te binden aan de promotor of versterker regio's van sommige cruciale genen te beïnvloeden hun uitdrukking tijdens Oligodendrocyt specificatie en differentiatie. Echter, het is uitdagend om te identificeren van DNA-bindende eiwit (of eiwit complex) belangstelling voor acuut gezuiverde primaire OPCs met een zeer beperkt aantal cellen.
Dit protocol wordt beschreven hoe aan de genomic DNA-immunoprecipitated door Olig2 in gezuiverde muis OPCs op genoom-brede schaal met behulp van ChIP-seq techniek systematisch te onderzoeken. OPCs van muis hersenen waren acuut gezuiverd door immunopanning en gebruikt een ChIP experiment zonder proliferatie in vitro. Een beperkt aantal OPCs kan worden verkregen door immunopanning en voor de standaard ChIP-seq experimenten ontoereikend is. Hierin wordt een lage-cel ChIP-seq protocol met zo laag als 20 duizend cellen per ChIP reactie voor transcriptiefactoren beschreven. Kortom, waren kruislings gekoppelde cellen lysed en sonicated door een ultrasoonapparaat apparaat wilt schuintrekken van de chromatine. De sheared chromatine was geïncubeerd met Olig2 antilichaam evenals eiwit A beklede kralen om te precipiteren Olig2 antilichaam gebonden genomic DNA. Na de elutie van eiwit A beklede kralen en omgekeerde dwarsbinding, werd genomic DNA neergeslagen door Olig2 antilichaam gezuiverd door fenol-chloroform extractie. Het resulterende product werd gekwantificeerd en onderworpen aan T-tailing, primer gloeien sjabloon schakelen en uitbreiding, de toevoeging van adapters en versterking, bibliotheek maat keuze en zuivering stappen voor ChIP-seq bibliotheek bouw.
Na sequencing, was de kwaliteit van de rauwe leesbewerkingen van zowel het monster bereid met Olig2 transcriptie factor antilichaam en de controlemonster geanalyseerd. Lage kwaliteit basenparen en adapter met lezen fragmenten werden bijgesneden. Volgende, bijgesneden leest waren afgestemd op de muis referentie genoom. De genomische regio's die aanzienlijk verrijkt waren voor ChIP leest, in vergelijking met de controlemonster, werden ontdekt als pieken. Belangrijke pieken, die potentiële transcriptie factor bandplaatsen, werden gefilterd en gevisualiseerd in een genoom-browser.
Met name kan de in dit protocol beschreven methode in grote lijnen worden gebruikt voor ChIP-seq van andere transcriptiefactoren met elk celtype van beperkte oplage.

<table>
	<tbody>
		<tr>
			<td>Reagent/ Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Banderiaea simplicifolia lectin 1</td>
			<td>Vector Laboratories</td>
			<td># L-1100</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat anti-PDGFRa antibody</td>
			<td>BD Bioscience</td>
			<td># 558774</td>
			<td></td>
		</tr>
		<tr>
			<td>Neural tissue dissociation Kit (P)</td>
			<td>MACS Miltenyi Biotec</td>
			<td># 130-092-628</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>STEMCELL technologies</td>
			<td># 07920</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Thermo Fisher</td>
			<td># 15596026</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody</td>
			<td>Millipore</td>
			<td># AB5320</td>
			<td></td>
		</tr>
		<tr>
			<td>Bioruptor Pico sonication device</td>
			<td>Diagenode</td>
			<td># B01060001</td>
			<td></td>
		</tr>
		<tr>
			<td>True MicroChIP kit</td>
			<td>Diagenode</td>
			<td># C01010130</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v)</td>
			<td>Thermo Fisher</td>
			<td># 15593031</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-Up kit</td>
			<td>MACHEREY-NAGEL</td>
			<td># 740609</td>
			<td></td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Assay Kit</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA SMART ChIP-Seq kit</td>
			<td>Clontech Laboratories</td>
			<td># 634865</td>
			<td></td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP</td>
			<td>Beckman Voulter</td>
			<td># A63880</td>
			<td></td>
		</tr>
		<tr>
			<td>GlycoBlue</td>
			<td>Thermo Fisher</td>
			<td># AM9516</td>
			<td></td>
		</tr>
		<tr>
			<td>pico-green</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>D-PBS</td>
			<td>Thermo Fisher</td>
			<td># 14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green master mix</td>
			<td>Bio-Rad Laboratories</td>
			<td># 1725124</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Fisher Scientific</td>
			<td># 11-320-033</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (P/S)</td>
			<td>Fisher Scientific</td>
			<td># 15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>N-2 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17502048</td>
			<td></td>
		</tr>
		<tr>
			<td>B-27 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17504044</td>
			<td></td>
		</tr>
		<tr>
			<td>insulin</td>
			<td>Sigma</td>
			<td># I6634</td>
			<td>Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 &#956;l of 1 N HCl.</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin, suitable for cell culture (BSA)</td>
			<td>Sigma</td>
			<td># A4161</td>
			<td>Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4</td>
		</tr>
		<tr>
			<td>Fibroblast Growth Factor basic Protein, Human recombinant (bFGF)</td>
			<td>EMD Millipore</td>
			<td># GF003</td>
			<td></td>
		</tr>
		<tr>
			<td>HUMAN PDGF-AA</td>
			<td>VWR</td>
			<td># 102061-188</td>
			<td></td>
		</tr>
		<tr>
			<td>poly-D-lysine</td>
			<td>VWR</td>
			<td># IC15017510</td>
			<td>Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using.</td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mm</td>
			<td>VWR</td>
			<td># 25373-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mm</td>
			<td>VWR</td>
			<td># 25373-187</td>
			<td></td>
		</tr>
		<tr>
			<td>HBSS, 10X, no Calcium, no Magnesium, no Phenol Red</td>
			<td>Fisher Scientific</td>
			<td># 14185-052</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue</td>
			<td>Stemcell Technologies</td>
			<td># 07050</td>
			<td></td>
		</tr>
		<tr>
			<td>protease inhibitor cocktail</td>
			<td>Sigma</td>
			<td># 11697498001</td>
			<td></td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>FastQC</td>
			<td>[10] http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td>
			<td></td>
			<td>Obtaining quality control metrics of raw and trimmed reads</td>
		</tr>
		<tr>
			<td>Trimmomatic 0.33</td>
			<td>[11] http://www.usadellab.org/cms/?page=trimmomatic</td>
			<td></td>
			<td>Trimming and filtering raw reads</td>
		</tr>
		<tr>
			<td>GENCODE mm10</td>
			<td>ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz</td>
			<td></td>
			<td>Mouse reference genome</td>
		</tr>
		<tr>
			<td>Bowtie2 2.2.4</td>
			<td>[12] http://bowtie-bio.sourceforge.net/bowtie2/index.shtml</td>
			<td></td>
			<td>Aligning reads to a reference genome</td>
		</tr>
		<tr>
			<td>SAMTools 1.5</td>
			<td>[13] http://samtools.sourceforge.net/</td>
			<td></td>
			<td>Converting SAM file into BAM format</td>
		</tr>
		<tr>
			<td>HOMER 4.9.1</td>
			<td>[14] http://homer.ucsd.edu/homer/</td>
			<td></td>
			<td>Creating a tag directory and annotating enriched genomic regions with gene symbols</td>
		</tr>
		<tr>
			<td>R 3.2.2</td>
			<td>[15] https://www.R-project.org/</td>
			<td></td>
			<td>Programming scripts and running functions</td>
		</tr>
		<tr>
			<td>SPP 1.13</td>
			<td>[16] https://github.com/hms-dbmi/spp</td>
			<td></td>
			<td>Creating a strand cross-correlation plot</td>
		</tr>
		<tr>
			<td>MACS2 2.2.4</td>
			<td>[17] https://github.com/taoliu/MACS</td>
			<td></td>
			<td>Finding regions of ChIP enrichment over control</td>
		</tr>
		<tr>
			<td>BEDTools 2.25</td>
			<td>[18] http://bedtools.readthedocs.io/en/latest/</td>
			<td></td>
			<td>Genome arithmetics</td>
		</tr>
		<tr>
			<td>bedGraphToBigWig</td>
			<td>http://hgdownload.cse.ucsc.edu/admin/exe/</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>IGV browser 2.3.58</td>
			<td>[19] http://software.broadinstitute.org/software/igv/</td>
			<td></td>
			<td>Visualization and browsing of significant ChIP-seq peaks</td>
		</tr>
		<tr>
			<td>Microsoft Excel</td>
			<td></td>
			<td></td>
			<td>Spreasheet program</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s blacklist</td>
			<td>https://sites.google.com/site/anshulkundaje/projects/blacklists</td>
			<td></td>
			<td>Filtering peaks</td>
		</tr>
		<tr>
			<td>mm10.chrom.sizes</td>
			<td>http://hgdownload.cse.ucsc.edu/goldenPath/mm10/bigZips/mm10.chrom.sizes.</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s motif database</td>
			<td>[25] http://compbio.mit.edu/encode-motifs/</td>
			<td></td>
			<td>Comprehensive motif database required for motif enrichment</td>
		</tr>
		<tr>
			<td>MEME-ChIP</td>
			<td>[20] http://meme-suite.org/index.html</td>
			<td></td>
			<td>Motif enrichment analysis and motif discovery</td>
		</tr>
		<tr>
			<td>Primer names used for qPCR</td>
			<td></td>
			<td></td>
			<td>Primer sequences used for qPCR</td>
		</tr>
		<tr>
			<td>Mbp-F:</td>
			<td></td>
			<td></td>
			<td>CTATAAATCGGCTCACAAGG</td>
		</tr>
		<tr>
			<td>Mbp-R:</td>
			<td></td>
			<td></td>
			<td>AGGCGGTTATATTAAGAAGC</td>
		</tr>
		<tr>
			<td>Iba1-F:</td>
			<td></td>
			<td></td>
			<td>ACTGCCAGCCTAAGACAACC</td>
		</tr>
		<tr>
			<td>Iba1-R:</td>
			<td></td>
			<td></td>
			<td>GCTTTTCCTCCCTGCAAATCC</td>
		</tr>
		<tr>
			<td>Mog-F:</td>
			<td></td>
			<td></td>
			<td>GGCTTCTTGGAGGAAGGGAC</td>
		</tr>
		<tr>
			<td>Mog-R:</td>
			<td></td>
			<td></td>
			<td>TGAATTGTCCTGCATAGCTGC</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td></td>
			<td></td>
			<td>ATGACATCAAGAAGGTGGTG</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td></td>
			<td></td>
			<td>CATACCAGGAAATGAGCTTG</td>
		</tr>
		<tr>
			<td>Tuj1-F</td>
			<td></td>
			<td></td>
			<td>TTTTCGTCTCTAGCCGCGTG</td>
		</tr>
		<tr>
			<td>Tuj1-R</td>
			<td></td>
			<td></td>
			<td>GATGACCTCCCAGAACTTGGC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-F</td>
			<td></td>
			<td></td>
			<td>AGAGTTACACGTTTGAGCTGTC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-R</td>
			<td></td>
			<td></td>
			<td>GTCCCTCCACGGTACTCCT</td>
		</tr>
	</tbody>
</table>

identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis

Bij zoogdiercellen wordt gene transcriptie geregeld in een cel type specifieke wijze door de interacties van transcriptionele factoren met genomic DNA. Geslacht-specifieke transcriptiefactoren worden beschouwd als spelen een essentiële rol in cel specificatie en differentiatie tijdens de ontwikkeling. ChIP in combinatie met high-throughput DNA sequencing (ChIP-seq) wordt veel gebruikt voor het analyseren van genoom-brede bandplaatsen van transcriptiefactoren (of de bijbehorende complex) aan de genomic DNA. Een groot aantal cellen zijn echter vereist voor een standaard ChIP reactie, waardoor het moeilijk is om te studeren het beperkte aantal geïsoleerde primaire cellen of zeldzame cel populaties. Om te begrijpen van het reguleringsmechanisme van Oligodendrocyt geslacht-specifieke transcriptie factor Olig2 in acuut gezuiverde muis OPCs, een gedetailleerde methode met behulp van ChIP-seq te identificeren van het genoom-brede bandplaatsen of Olig2 (Olig2 complex) wordt weergegeven. Ten eerste, het protocol wordt uitgelegd hoe te zuiveren van de bloedplaatjes afkomstige groei factor receptor-alpha (PDGFRα) positieve OPCs vanuit muis brains. Vervolgens Olig2 antilichaam gemedieerde ChIP en bibliotheek bouw worden uitgevoerd. Het laatste deel beschrijft de bioinformatic software en procedures voor de Olig2 ChIP-seq analyse. Kortom meldt dit papier een methode voor het analyseren van het genoom-brede bindingen van transcriptionele factor Olig2 in acuut gezuiverde hersenen OPCs.

Low-cel ChIP-seq werd uitgevoerd en bioinformatic analyses werden uitgevoerd voor het onderzoek naar de mogelijke interacties tussen transcriptionele factor Olig2 met genomic DNA in acuut gezuiverde hersenen OPCs. Figuur 1 toont een algemene workflow van zowel de experimentele en de procedures van de analyse van gegevens. In dit protocol, werden postnatale muizen hersenen los in de schorsing van een eencellige. Na weefsel dissociatie, werd immunopanning uitge...

Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃŽÂ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃƒÆ’Ã…Â½Ãƒâ€šÃ‚Â±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

Hier presenteren we een protocol dat is ontworpen voor het analyseren van de genoom-brede binding van de transcriptiefactor Oligodendrocyt 2 (Olig2) in acuut gezuiverde oligodendrocyte voorloper hersencellen (OPCs) door het uitvoeren van lage-cel chromatine immunoprecipitation (ChIP) , bibliotheek voorbereiding, high-throughput sequencing en bioinformatic data-analyse.

Identificeren van transcriptie Factor Olig2 Genomic bandplaatsen in acuut gezuiverd PDGFRα + cellen door lage-cel chromatine Immunoprecipitation Sequencing analyse

In mammalian cells, gene transcription is regulated in a cell type specific manner by the interactions of transcriptional factors with genomic DNA. ...

Education

Research

JoVE Core

JoVE Journal

Molecular Biology

Biology

Neuroscience

Genetics

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFR&#945;+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

Unit 1

DNA Structure and Function

Gene Expression

SCIENTISTS IN ACTION

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

Transfectie van Mouse retinale ganglioncellen door In vivo Elektroporatie

The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural ...

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Live-cell imaging van zintuig voorloper cellen in Intact Drosophila Poppen

Since the discovery of Green Fluorescent Protein (GFP), there has been a revolutionary change in the use of live-cell imaging as a tool for understanding ...

Chromatin Immunoprecipitation from Dorsal Root Ganglia Tissue following Axonal Injury

Chromatine immunoprecipitatie van achterwortelganglia Tissue volgende axonale schade

Axons in the central nervous system (CNS) do not regenerate while those in the peripheral nervous system (PNS) do regenerate 
to a limited extent after ...

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange (ABE)

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange ABE

Detectie van eiwit palmitoylering in gekweekte hippocampale neuronen door immunoprecipitatie en Acyl-Biotin Exchange (ABE)

Palmitoylation is a post-translational lipid  modification involving the attachment of a 16-carbon saturated fatty acid,  palmitate, to cysteine residues ...

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

Extracellulair Het identificeren van Motor Neuronen voor een Muscle Motor Pool in<em&gt; Aplysia californica</em

In animals with large  identified neurons (e.g. mollusks), analysis of motor pools is done using  intracellular techniques1,2,3,4. Recently,  we developed ...

Intracerebroventricular Injection of Amyloid-&#946; Peptides in Normal Mice to Acutely Induce Alzheimer-like Cognitive Deficits

Intracerebroventricular Injection of Amyloid-ÃƒÅ½Ã‚Â² Peptides in Normal Mice to Acutely Induce Alzheimer-like Cognitive Deficits

Intracerebroventriculaire Injectie van amyloid-β peptiden in normale muizen om acuut induceren Alzheimer-achtige cognitieve tekorten

Amyloid-&#946; (A&#946;) is a major pathological mediator of both familial and sporadic Alzheimer's disease (AD). In the brains of AD patients, ...

Assessment of Dopaminergic Homeostasis in Mice by Use of High-performance Liquid Chromatography Analysis and Synaptosomal Dopamine Uptake

Beoordeling van Dopaminerge homeostase in muizen door gebruik van High-performance Liquid Chromatography analyse en Synaptosomal Dopamine opname

Dopamine (DA) is a modulatory neurotransmitter controlling motor activity, reward processes and cognitive function. Impairment of dopaminergic (DAergic) ...

Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark

Isolatie en teelt van neurale progenitoren gevolgd door chromatine-Immunoprecipitation van Histone 3 Lysine 79 Dimethylation Mark

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. ...

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

Isolatie van volwassen ruggenmerg kernen voor Massively Parallel Single-nucleus RNA Sequencing

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a ...

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing (DIVA-Seq)

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing DIVA-Seq

Eencellige RNA Sequencing van Fluorescently geëtiketteerde muis neuronen met behulp van handmatig sorteren en dubbele In Vitro transcriptie met Absolute aantallen Sequencing (DIVA-Seq)

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing ...