Name: identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis
Uploaded: 2018-04-16T14:00:00
Description: Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃŽÂ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

JQW, XD, RCDD e YY sono stati supportati da concessioni dagli istituti nazionali di salute R01 NS088353; NIH grant 1R21AR071583-01; Irene Ogilvie fondo-Memorial Hermann Fondazione; l'iniziativa di cervello di UTHealth e CTSA UL1 TR000371; e una borsa di studio presso la University of Texas sistema di Neuroscienze e Neurotecnologie Research Institute (Grant n. 362469).

Tutti i uso animale e protocolli sperimentali erano eseguiti in conformità con la guida per la cura e l'uso di animali da laboratorio e approvati dal Comitato istituzionale biosicurezza e Animal Welfare Committee presso la University of Texas Health Science Center at Houston.
1. purificazione di cellule Lineage Oligodendrocyte PDGFRα Positive dal cervello di topo (modificato dal immunopanning precedentemente descritti protocolli5,6<sup...

<ol>
	<li>Wu, J. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tcf7+is+an+important+regulator+of+the+switch+of+self-renewal+and+differentiation+in+a+multipotential+hematopoietic+cell+line.">Tcf7 is an important regulator of the switch of self-renewal and differentiation in a multipotential hematopoietic cell line.</a> PLoS Genet. 8 (3), e1002565 (2012).</li><li>Zuchero, J. B., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+and+extrinsic+control+of+oligodendrocyte+development.">Intrinsic and extrinsic control of oligodendrocyte development.</a> Curr Opin Neurobiol. 23 (6), 914-920 (2013).</li><li>Liu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+oligodendrocyte+differentiation+by+Olig2+and+Sox10:+evidence+for+reciprocal+interactions+and+dosage-dependent+mechanisms.">Induction of oligodendrocyte differentiation by Olig2 and Sox10: evidence for reciprocal interactions and dosage-dependent mechanisms.</a> Dev Biol. 302 (2), 683-693 (2007).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+Identification+of+Long+Non-coding+RNAs+in+Purified+Cell+Types+from+the+Brain+Reveals+Functional+LncRNA+in+OPC+Fate+Determination.">Comprehensive Identification of Long Non-coding RNAs in Purified Cell Types from the Brain Reveals Functional LncRNA in OPC Fate Determination.</a> PLoS Genet. 11 (12), e1005669 (2015).</li><li>Hilgenberg, L. G., Smith, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+dissociated+mouse+cortical+neuron+cultures.">Preparation of dissociated mouse cortical neuron cultures.</a> J Vis Exp. (10), e562 (2007).</li><li>Emery, B., Dugas, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+oligodendrocyte+lineage+cells+from+mouse+cortices+by+immunopanning.">Purification of oligodendrocyte lineage cells from mouse cortices by immunopanning.</a> Cold Spring Harb Protoc. 2013 (9), 854-868 (2013).</li><li>Cahoy, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptome+database+for+astrocytes,+neurons,+and+oligodendrocytes:+a+new+resource+for+understanding+brain+development+and+function.">A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function.</a> J Neurosci. 28 (1), 264-278 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> J Neurosci. 34 (36), 11929-11947 (2014).</li><li>Cheng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+protein+signaling+and+olig1/2+interact+to+regulate+the+differentiation+and+maturation+of+adult+oligodendrocyte+precursor+cells.">Bone morphogenetic protein signaling and olig1/2 interact to regulate the differentiation and maturation of adult oligodendrocyte precursor cells.</a> Stem Cells. 25 (12), 3204-3214 (2007).</li><li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimmomatic:+a+flexible+trimmer+for+Illumina+sequence+data.">Trimmomatic: a flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30 (15), 2114-2120 (2014).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Team, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+language+and+environment+for+statistical+computing.">A language and environment for statistical computing.</a> R Foundation for Statistical Computing. , (2015).</li><li>Kharchenko, P. V., Tolstorukov, M. Y., Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+analysis+of+ChIP-seq+experiments+for+DNA-binding+proteins.">Design and analysis of ChIP-seq experiments for DNA-binding proteins.</a> Nat Biotechnol. 26 (12), 1351-1359 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucleic Acids Res. 37 (Web Server issue), W202-W208 (2009).</li><li>Sims, D., Sudbery, I., Ilott, N. E., Heger, A., Ponting, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+depth+and+coverage:+key+considerations+in+genomic+analyses.">Sequencing depth and coverage: key considerations in genomic analyses.</a> Nat Rev Genet. 15 (2), 121-132 (2014).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Consortium, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Kheradpour, P., Kellis, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+discovery+and+characterization+of+regulatory+motifs+in+ENCODE+TF+binding+experiments.">Systematic discovery and characterization of regulatory motifs in ENCODE TF binding experiments.</a> Nucleic Acids Res. 42 (5), 2976-2987 (2014).</li><li>Dugas, J. C., Tai, Y. C., Speed, T. P., Ngai, J., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+analysis+of+oligodendrocyte+differentiation.">Functional genomic analysis of oligodendrocyte differentiation.</a> J Neurosci. 26 (43), 10967-10983 (2006).</li><li>Gilfillan, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limitations+and+possibilities+of+low+cell+number+ChIP-seq.">Limitations and possibilities of low cell number ChIP-seq.</a> BMC Genomics. 13, 645 (2012).</li><li>Raskatov, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+NF-kappaB-dependent+gene+transcription+using+programmable+DNA+minor+groove+binders.">Modulation of NF-kappaB-dependent gene transcription using programmable DNA minor groove binders.</a> Proc Natl Acad Sci U S A. 109 (4), 1023-1028 (2012).</li><li>Cheneby, J., Gheorghe, M., Artufel, M., Mathelier, A., Ballester, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ReMap+2018:+an+updated+atlas+of+regulatory+regions+from+an+integrative+analysis+of+DNA-binding+ChIP-seq+experiments.">ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments.</a> Nucleic Acids Res. , (2017).</li><li>Yevshin, I., Sharipov, R., Valeev, T., Kel, A., Kolpakov, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTRD:+a+database+of+transcription+factor+binding+sites+identified+by+ChIP-seq+experiments.">GTRD: a database of transcription factor binding sites identified by ChIP-seq experiments.</a> Nucleic Acids Res. 45 (D1), D61-D67 (2017).</li><li>Kulakovskiy, I. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HOCOMOCO:+a+comprehensive+collection+of+human+transcription+factor+binding+sites+models.">HOCOMOCO: a comprehensive collection of human transcription factor binding sites models.</a> Nucleic Acids Res. 41 (Database issue), D195-D202 (2013).</li><li>Jain, D., Baldi, S., Zabel, A., Straub, T., Becker, P. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+promoters+give+rise+to+false+positive+'Phantom+Peaks'+in+ChIP-seq+experiments.">Active promoters give rise to false positive 'Phantom Peaks' in ChIP-seq experiments.</a> Nucleic Acids Res. 43 (14), 6959-6968 (2015).</li><li>Gerstein, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+the+human+regulatory+network+derived+from+ENCODE+data.">Architecture of the human regulatory network derived from ENCODE data.</a> Nature. 489 (7414), 91-100 (2012).</li></ol>

Reti di regolazione genica dei mammiferi sono molto complesse. ChIP-seq è un potente metodo per indagare le interazioni proteina-DNA del genoma. Questo protocollo comprende come eseguire Olig2 ChIP-seq utilizzando un basso numero di OPCs purificato da cervelli di topo (bassi quanto 20 mila cellule per reazione). Il primo passo fondamentale per questo protocollo è la purificazione di OPCs da cervelli di topo di immunopanning con l'anticorpo PDGFRα. Per la selezione positiva di OPCs con piastre PDGFRα rivestito, OPCs s...

È importante studiare la proteina (o complesso proteico) DNA binding e i segni epigenetici per costruire reti di regolazione trascrizionale coinvolti nei vari processi biologici. In particolare, le associazioni di fattori di trascrizione da DNA genomic possono giocare un ruolo importante nella regolazione genica, la differenziazione cellulare e lo sviluppo del tessuto. Un potente strumento per lo studio della regolazione trascrizionale e meccanismi epigenetici è immunoprecipitazione della cromatina (ChIP). A causa dei rapidi progressi nella tecnologia di sequenziamento di nuova generazione, ChIP accoppiato con sequenziamento del DNA di alto-rendimento (ChIP-seq) viene utilizzato per le analisi di binding proteina-DNA e segni epigenetici1. Tuttavia, un protocollo standard di ChIP-seq richiede circa 20 milioni di cellule per reazione, il che rende difficile l'applicazione di questa tecnica quando il numero di cellulare è limitato, come cellule primarie isolate e popolazioni di cellule rare.
Del oligodendrocyte lignaggio cellule compreso le cellule del precursore del oligodendrocyte (OPCs) ed i oligodendrocytes sono ampiamente distribuite in tutto il cervello e sono essenziali per lo sviluppo e la funzione del cervello. Come un tipo delle cellule del precursore, OPCs sono capaci di auto-rinnovamento e di differenziazione. Gli OPC non solo servono come progenitori per gli oligodendrociti ma anche svolgono un ruolo importante nella propagazione della segnalazione di un neurone comunicando con altri tipi di cellule di cervello2. Studi precedenti hanno suggerito che lo sviluppo del oligodendrocyte è regolato da fattori di trascrizione lineage-specifici come Olig2 e Sox103,4. Questi fattori di trascrizione sono stati trovati da associare alle regioni promotore o enhancer di alcuni geni cruciali per influenzare la loro espressione durante del oligodendrocyte specificazione e differenziamento. Tuttavia, è difficile da identificare il grippaggio del DNA della proteina (o complesso proteico) di interesse in OPCs acutamente purificata primario con un numero molto limitato di cellule.
Questo protocollo viene descritto come analizzare sistematicamente l'immunoprecipitato DNA genomico di Olig2 in OPCs purificata del mouse a scala di genoma utilizzando la tecnica di ChIP-seq. OPCs da cervelli di topo erano acutamente purificato mediante immunopanning e utilizzati in un esperimento di ChIP senza proliferazione in vitro. Un numero limitato di OPCs può essere ottenuto da immunopanning e non è sufficiente per gli esperimenti di ChIP-seq standard. Nel presente accordo, un protocollo di ChIP-seq cella di basso con basso quanto 20 mila cellule per reazione di ChIP per fattori di trascrizione è descritto. In breve, reticolate cellule sono state lisate e sonicate da un dispositivo di sonicazione per tosare la cromatina. La cromatina tosata è stata incubata con Olig2 anticorpo come pure proteina perline rivestite con A per precipitare il DNA genomic di Olig2 anticorpo associato. Dopo eluizione da proteina A-rivestito perline e cross-linking inversa, DNA genomic precipitato da Olig2 anticorpo è stato purificato mediante estrazione con fenolo-cloroformio. Il prodotto risultante è stato quantificato e sottoposti a T-tailing, primer modello di commutazione e di estensione, l'aggiunta di schede e amplificazione, selezione dimensione raccolta e purificazione di ricottura passi per la costruzione della libreria ChIP-seq.
Dopo la sequenziazione, è stata analizzata la qualità del crudi si legge da sia il campione preparato con anticorpo di fattore di trascrizione Olig2 e il campione di controllo. Coppie di basi di bassa qualità e adattatore contenente leggere frammenti sono stati tagliati. Successiva, profilate letture sono state allineate al genoma di riferimento del mouse. Le regioni genomiche che significativamente sono state arricchite per letture di ChIP, rispetto al campione di controllo, sono state rilevate come picchi. Picchi significativi, che rappresentano potenziali siti di legame del fattore di trascrizione, sono stati filtrati e visualizzati in un browser del genoma.
In particolare, il metodo descritto in questo protocollo può essere utilizzato ampiamente per ChIP-seq di altri fattori di trascrizione con qualsiasi tipo di cellula di un numero limitato.

<table>
	<tbody>
		<tr>
			<td>Reagent/ Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Banderiaea simplicifolia lectin 1</td>
			<td>Vector Laboratories</td>
			<td># L-1100</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat anti-PDGFRa antibody</td>
			<td>BD Bioscience</td>
			<td># 558774</td>
			<td></td>
		</tr>
		<tr>
			<td>Neural tissue dissociation Kit (P)</td>
			<td>MACS Miltenyi Biotec</td>
			<td># 130-092-628</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>STEMCELL technologies</td>
			<td># 07920</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Thermo Fisher</td>
			<td># 15596026</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody</td>
			<td>Millipore</td>
			<td># AB5320</td>
			<td></td>
		</tr>
		<tr>
			<td>Bioruptor Pico sonication device</td>
			<td>Diagenode</td>
			<td># B01060001</td>
			<td></td>
		</tr>
		<tr>
			<td>True MicroChIP kit</td>
			<td>Diagenode</td>
			<td># C01010130</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v)</td>
			<td>Thermo Fisher</td>
			<td># 15593031</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-Up kit</td>
			<td>MACHEREY-NAGEL</td>
			<td># 740609</td>
			<td></td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Assay Kit</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA SMART ChIP-Seq kit</td>
			<td>Clontech Laboratories</td>
			<td># 634865</td>
			<td></td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP</td>
			<td>Beckman Voulter</td>
			<td># A63880</td>
			<td></td>
		</tr>
		<tr>
			<td>GlycoBlue</td>
			<td>Thermo Fisher</td>
			<td># AM9516</td>
			<td></td>
		</tr>
		<tr>
			<td>pico-green</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>D-PBS</td>
			<td>Thermo Fisher</td>
			<td># 14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green master mix</td>
			<td>Bio-Rad Laboratories</td>
			<td># 1725124</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Fisher Scientific</td>
			<td># 11-320-033</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (P/S)</td>
			<td>Fisher Scientific</td>
			<td># 15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>N-2 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17502048</td>
			<td></td>
		</tr>
		<tr>
			<td>B-27 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17504044</td>
			<td></td>
		</tr>
		<tr>
			<td>insulin</td>
			<td>Sigma</td>
			<td># I6634</td>
			<td>Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 &#956;l of 1 N HCl.</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin, suitable for cell culture (BSA)</td>
			<td>Sigma</td>
			<td># A4161</td>
			<td>Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4</td>
		</tr>
		<tr>
			<td>Fibroblast Growth Factor basic Protein, Human recombinant (bFGF)</td>
			<td>EMD Millipore</td>
			<td># GF003</td>
			<td></td>
		</tr>
		<tr>
			<td>HUMAN PDGF-AA</td>
			<td>VWR</td>
			<td># 102061-188</td>
			<td></td>
		</tr>
		<tr>
			<td>poly-D-lysine</td>
			<td>VWR</td>
			<td># IC15017510</td>
			<td>Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using.</td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mm</td>
			<td>VWR</td>
			<td># 25373-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mm</td>
			<td>VWR</td>
			<td># 25373-187</td>
			<td></td>
		</tr>
		<tr>
			<td>HBSS, 10X, no Calcium, no Magnesium, no Phenol Red</td>
			<td>Fisher Scientific</td>
			<td># 14185-052</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue</td>
			<td>Stemcell Technologies</td>
			<td># 07050</td>
			<td></td>
		</tr>
		<tr>
			<td>protease inhibitor cocktail</td>
			<td>Sigma</td>
			<td># 11697498001</td>
			<td></td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>FastQC</td>
			<td>[10] http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td>
			<td></td>
			<td>Obtaining quality control metrics of raw and trimmed reads</td>
		</tr>
		<tr>
			<td>Trimmomatic 0.33</td>
			<td>[11] http://www.usadellab.org/cms/?page=trimmomatic</td>
			<td></td>
			<td>Trimming and filtering raw reads</td>
		</tr>
		<tr>
			<td>GENCODE mm10</td>
			<td>ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz</td>
			<td></td>
			<td>Mouse reference genome</td>
		</tr>
		<tr>
			<td>Bowtie2 2.2.4</td>
			<td>[12] http://bowtie-bio.sourceforge.net/bowtie2/index.shtml</td>
			<td></td>
			<td>Aligning reads to a reference genome</td>
		</tr>
		<tr>
			<td>SAMTools 1.5</td>
			<td>[13] http://samtools.sourceforge.net/</td>
			<td></td>
			<td>Converting SAM file into BAM format</td>
		</tr>
		<tr>
			<td>HOMER 4.9.1</td>
			<td>[14] http://homer.ucsd.edu/homer/</td>
			<td></td>
			<td>Creating a tag directory and annotating enriched genomic regions with gene symbols</td>
		</tr>
		<tr>
			<td>R 3.2.2</td>
			<td>[15] https://www.R-project.org/</td>
			<td></td>
			<td>Programming scripts and running functions</td>
		</tr>
		<tr>
			<td>SPP 1.13</td>
			<td>[16] https://github.com/hms-dbmi/spp</td>
			<td></td>
			<td>Creating a strand cross-correlation plot</td>
		</tr>
		<tr>
			<td>MACS2 2.2.4</td>
			<td>[17] https://github.com/taoliu/MACS</td>
			<td></td>
			<td>Finding regions of ChIP enrichment over control</td>
		</tr>
		<tr>
			<td>BEDTools 2.25</td>
			<td>[18] http://bedtools.readthedocs.io/en/latest/</td>
			<td></td>
			<td>Genome arithmetics</td>
		</tr>
		<tr>
			<td>bedGraphToBigWig</td>
			<td>http://hgdownload.cse.ucsc.edu/admin/exe/</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>IGV browser 2.3.58</td>
			<td>[19] http://software.broadinstitute.org/software/igv/</td>
			<td></td>
			<td>Visualization and browsing of significant ChIP-seq peaks</td>
		</tr>
		<tr>
			<td>Microsoft Excel</td>
			<td></td>
			<td></td>
			<td>Spreasheet program</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s blacklist</td>
			<td>https://sites.google.com/site/anshulkundaje/projects/blacklists</td>
			<td></td>
			<td>Filtering peaks</td>
		</tr>
		<tr>
			<td>mm10.chrom.sizes</td>
			<td>http://hgdownload.cse.ucsc.edu/goldenPath/mm10/bigZips/mm10.chrom.sizes.</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s motif database</td>
			<td>[25] http://compbio.mit.edu/encode-motifs/</td>
			<td></td>
			<td>Comprehensive motif database required for motif enrichment</td>
		</tr>
		<tr>
			<td>MEME-ChIP</td>
			<td>[20] http://meme-suite.org/index.html</td>
			<td></td>
			<td>Motif enrichment analysis and motif discovery</td>
		</tr>
		<tr>
			<td>Primer names used for qPCR</td>
			<td></td>
			<td></td>
			<td>Primer sequences used for qPCR</td>
		</tr>
		<tr>
			<td>Mbp-F:</td>
			<td></td>
			<td></td>
			<td>CTATAAATCGGCTCACAAGG</td>
		</tr>
		<tr>
			<td>Mbp-R:</td>
			<td></td>
			<td></td>
			<td>AGGCGGTTATATTAAGAAGC</td>
		</tr>
		<tr>
			<td>Iba1-F:</td>
			<td></td>
			<td></td>
			<td>ACTGCCAGCCTAAGACAACC</td>
		</tr>
		<tr>
			<td>Iba1-R:</td>
			<td></td>
			<td></td>
			<td>GCTTTTCCTCCCTGCAAATCC</td>
		</tr>
		<tr>
			<td>Mog-F:</td>
			<td></td>
			<td></td>
			<td>GGCTTCTTGGAGGAAGGGAC</td>
		</tr>
		<tr>
			<td>Mog-R:</td>
			<td></td>
			<td></td>
			<td>TGAATTGTCCTGCATAGCTGC</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td></td>
			<td></td>
			<td>ATGACATCAAGAAGGTGGTG</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td></td>
			<td></td>
			<td>CATACCAGGAAATGAGCTTG</td>
		</tr>
		<tr>
			<td>Tuj1-F</td>
			<td></td>
			<td></td>
			<td>TTTTCGTCTCTAGCCGCGTG</td>
		</tr>
		<tr>
			<td>Tuj1-R</td>
			<td></td>
			<td></td>
			<td>GATGACCTCCCAGAACTTGGC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-F</td>
			<td></td>
			<td></td>
			<td>AGAGTTACACGTTTGAGCTGTC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-R</td>
			<td></td>
			<td></td>
			<td>GTCCCTCCACGGTACTCCT</td>
		</tr>
	</tbody>
</table>

identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis

In cellule di mammifero, trascrizione genica è disciplinata in modo specifico di cella tipo le interazioni dei fattori trascrizionali con DNA genomico. Fattori di trascrizione Lineage-specifici sono considerati svolgono un ruolo essenziale nella specifica delle cellule e differenziazione durante lo sviluppo. ChIP accoppiato con sequenziamento del DNA di alto-rendimento (ChIP-seq) è ampiamente usato per analizzare i siti di legame del genoma di fattori di trascrizione (o suo complesso associato) di DNA genomico. Tuttavia, un numero elevato di celle è necessario per una reazione di ChIP standard, che lo rende difficile da studiare il numero limitato di cellule primarie isolate o popolazioni di cellule rare. Al fine di comprendere il meccanismo di regolazione di trascrizione lineage-specifici del oligodendrocyte fattore Olig2 nel topo acutamente purificata OPCs, un metodo dettagliato utilizzando ChIP-seq per identificare i siti di legame del genoma di Olig2 (o Olig2 complesso) viene visualizzato. In primo luogo, il protocollo spiega come purificare l'alfa del ricevitore di fattore di crescita derivato dalle piastrine (PDGFRα) positivo OPCs da cervelli di topo. Successivamente, Olig2 anticorpo mediato ChIP e la costruzione della libreria vengono eseguite. L'ultima parte viene descritto il software bioinformatico e procedure utilizzate per l'analisi di Olig2 ChIP-seq. In sintesi, questa carta segnala un metodo per analizzare le associazioni di genoma del fattore trascrizionale Olig2 nel cervello acutamente purificato OPCs.

Basso-cella ChIP-seq è stata effettuata e analisi bioinformatiche sono stati fatti per studiare le interazioni potenziali del fattore trascrizionale Olig2 con DNA genomico in cervello acutamente purificato OPCs. La figura 1 Mostra un flusso di lavoro generale sia sperimentale che le procedure di analisi dei dati. In questo protocollo, cervelli di topi postnatali fossero dissociati in sospensione unicellulare. Dopo dissociazione del tessuto, immunopanning è ...

Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃŽÂ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃƒÆ’Ã…Â½Ãƒâ€šÃ‚Â±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

Qui presentiamo un protocollo che è stato progettato per analizzare l'associazione genoma del fattore di trascrizione del oligodendrocyte 2 (Olig2) in cellule del precursore del oligodendrocyte cervello acutamente purificato (OPCs) eseguendo immunoprecipitazione della cromatina basso-cella (ChIP) , libreria preparazione, high throughput sequenziamento e analisi bioinformatica dei dati.

Identificare i siti di fattore di trascrizione Olig2 associazione genomico in acutamente purificato PDGFRα + cellule di immunoprecipitazione della cromatina Low-cella ordinamento dell'analisi

In mammalian cells, gene transcription is regulated in a cell type specific manner by the interactions of transcriptional factors with genomic DNA. ...

Education

Research

JoVE Core

JoVE Journal

Molecular Biology

Biology

Neuroscience

Genetics

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFR&#945;+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

Unit 1

DNA Structure and Function

Gene Expression

SCIENTISTS IN ACTION

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

Trasfezione delle cellule gangliari della retina di topo In vivo Elettroporazione

The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural ...

Ricerca

Neuroscienze

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Live-cellula Imaging di cellule sensoriali Precursore in Organo intatto Drosophila Pupae

Since the discovery of Green Fluorescent Protein (GFP), there has been a revolutionary change in the use of live-cell imaging as a tool for understanding ...

Chromatin Immunoprecipitation from Dorsal Root Ganglia Tissue following Axonal Injury

Immunoprecipitazione della cromatina dal tessuto dei gangli dorsali seguenti danno assonale

Axons in the central nervous system (CNS) do not regenerate while those in the peripheral nervous system (PNS) do regenerate 
to a limited extent after ...

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange (ABE)

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange ABE

Rilevamento di palmitoilazione proteina in colture di neuroni ippocampali di immunoprecipitazione e di acil-Biotina Exchange (ABE)

Palmitoylation is a post-translational lipid  modification involving the attachment of a 16-carbon saturated fatty acid,  palmitate, to cysteine residues ...

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

Extracellulare Identificazione neuroni motori per un pool di motore muscolare in<em&gt; Aplysia californica</em

In animals with large  identified neurons (e.g. mollusks), analysis of motor pools is done using  intracellular techniques1,2,3,4. Recently,  we developed ...

Intracerebroventricular Injection of Amyloid-&#946; Peptides in Normal Mice to Acutely Induce Alzheimer-like Cognitive Deficits

Intracerebroventricular Injection of Amyloid-ÃƒÅ½Ã‚Â² Peptides in Normal Mice to Acutely Induce Alzheimer-like Cognitive Deficits

Iniezione intracerebroventricular dei peptidi beta-amiloide in topi normali per indurre Acutamente Alzheimer-like Deficit cognitivi

Amyloid-&#946; (A&#946;) is a major pathological mediator of both familial and sporadic Alzheimer's disease (AD). In the brains of AD patients, ...

Assessment of Dopaminergic Homeostasis in Mice by Use of High-performance Liquid Chromatography Analysis and Synaptosomal Dopamine Uptake

Valutazione dell'omeostasi dopaminergici in topi tramite l'uso di analisi di cromatografia liquida ad alte prestazioni e assorbimento della dopamina sinaptosomiali

Dopamine (DA) is a modulatory neurotransmitter controlling motor activity, reward processes and cognitive function. Impairment of dopaminergic (DAergic) ...

Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark

Isolamento e coltura dei progenitori neurali seguito da immunoprecipitazione della cromatina di istone 3 lisina 79 Dimethylation Mark

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. ...

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

Isolamento dei Nuclei del midollo spinale adulto per il sequenziamento massivamente parallelo Single-nucleo RNA

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a ...

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing (DIVA-Seq)

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing DIVA-Seq

Sequenziamento di RNA unicellulare di neuroni di topo fluorescente contrassegnati con cernita manuale e doppia trascrizione In Vitro con conteggi assoluti sequenziamento (DIVA-Seq)

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing ...