Name: identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis
Uploaded: 2018-04-16T14:00:00
Description: Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃŽÂ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

JQW, XD, RCDD, 그리고 YY는 국립 연구소의 건강 R01 NS088353;에서 교부 금에 의해 지원 되었다 NIH 그랜트 1R21AR071583-01; Staman Ogilvie 기금-기념 헤르만 재단; UTHealth 뇌 이니셔티브와 CTSA UL1 TR000371; 그리고 텍사스 시스템 신경 과학 대학 Neurotechnology 연구소 (부여 #362469)에서 부여.

모든 동물 사용 및 실험 프로토콜 관리 및 실험 동물의 사용에 대 한 가이드를 따라 수행 되었고 기관 Biosafety 위원회에서 건강 과학 센터 택 사스 대학에서 동물 복지 위원회에 의해 승인 휴스턴입니다.
1. 쥐의 뇌 (앞에서 설명한 immunopanning 프로토콜5,,67에서 수정)에서 PDGFRα 긍정적인 Oligodendrocyte 계보 세포?...

<ol>
	<li>Wu, J. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tcf7+is+an+important+regulator+of+the+switch+of+self-renewal+and+differentiation+in+a+multipotential+hematopoietic+cell+line.">Tcf7 is an important regulator of the switch of self-renewal and differentiation in a multipotential hematopoietic cell line.</a> PLoS Genet. 8 (3), e1002565 (2012).</li><li>Zuchero, J. B., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+and+extrinsic+control+of+oligodendrocyte+development.">Intrinsic and extrinsic control of oligodendrocyte development.</a> Curr Opin Neurobiol. 23 (6), 914-920 (2013).</li><li>Liu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+oligodendrocyte+differentiation+by+Olig2+and+Sox10:+evidence+for+reciprocal+interactions+and+dosage-dependent+mechanisms.">Induction of oligodendrocyte differentiation by Olig2 and Sox10: evidence for reciprocal interactions and dosage-dependent mechanisms.</a> Dev Biol. 302 (2), 683-693 (2007).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+Identification+of+Long+Non-coding+RNAs+in+Purified+Cell+Types+from+the+Brain+Reveals+Functional+LncRNA+in+OPC+Fate+Determination.">Comprehensive Identification of Long Non-coding RNAs in Purified Cell Types from the Brain Reveals Functional LncRNA in OPC Fate Determination.</a> PLoS Genet. 11 (12), e1005669 (2015).</li><li>Hilgenberg, L. G., Smith, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+dissociated+mouse+cortical+neuron+cultures.">Preparation of dissociated mouse cortical neuron cultures.</a> J Vis Exp. (10), e562 (2007).</li><li>Emery, B., Dugas, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+oligodendrocyte+lineage+cells+from+mouse+cortices+by+immunopanning.">Purification of oligodendrocyte lineage cells from mouse cortices by immunopanning.</a> Cold Spring Harb Protoc. 2013 (9), 854-868 (2013).</li><li>Cahoy, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptome+database+for+astrocytes,+neurons,+and+oligodendrocytes:+a+new+resource+for+understanding+brain+development+and+function.">A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function.</a> J Neurosci. 28 (1), 264-278 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> J Neurosci. 34 (36), 11929-11947 (2014).</li><li>Cheng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+protein+signaling+and+olig1/2+interact+to+regulate+the+differentiation+and+maturation+of+adult+oligodendrocyte+precursor+cells.">Bone morphogenetic protein signaling and olig1/2 interact to regulate the differentiation and maturation of adult oligodendrocyte precursor cells.</a> Stem Cells. 25 (12), 3204-3214 (2007).</li><li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimmomatic:+a+flexible+trimmer+for+Illumina+sequence+data.">Trimmomatic: a flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30 (15), 2114-2120 (2014).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Team, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+language+and+environment+for+statistical+computing.">A language and environment for statistical computing.</a> R Foundation for Statistical Computing. , (2015).</li><li>Kharchenko, P. V., Tolstorukov, M. Y., Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+analysis+of+ChIP-seq+experiments+for+DNA-binding+proteins.">Design and analysis of ChIP-seq experiments for DNA-binding proteins.</a> Nat Biotechnol. 26 (12), 1351-1359 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucleic Acids Res. 37 (Web Server issue), W202-W208 (2009).</li><li>Sims, D., Sudbery, I., Ilott, N. E., Heger, A., Ponting, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+depth+and+coverage:+key+considerations+in+genomic+analyses.">Sequencing depth and coverage: key considerations in genomic analyses.</a> Nat Rev Genet. 15 (2), 121-132 (2014).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Consortium, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Kheradpour, P., Kellis, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+discovery+and+characterization+of+regulatory+motifs+in+ENCODE+TF+binding+experiments.">Systematic discovery and characterization of regulatory motifs in ENCODE TF binding experiments.</a> Nucleic Acids Res. 42 (5), 2976-2987 (2014).</li><li>Dugas, J. C., Tai, Y. C., Speed, T. P., Ngai, J., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+analysis+of+oligodendrocyte+differentiation.">Functional genomic analysis of oligodendrocyte differentiation.</a> J Neurosci. 26 (43), 10967-10983 (2006).</li><li>Gilfillan, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limitations+and+possibilities+of+low+cell+number+ChIP-seq.">Limitations and possibilities of low cell number ChIP-seq.</a> BMC Genomics. 13, 645 (2012).</li><li>Raskatov, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+NF-kappaB-dependent+gene+transcription+using+programmable+DNA+minor+groove+binders.">Modulation of NF-kappaB-dependent gene transcription using programmable DNA minor groove binders.</a> Proc Natl Acad Sci U S A. 109 (4), 1023-1028 (2012).</li><li>Cheneby, J., Gheorghe, M., Artufel, M., Mathelier, A., Ballester, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ReMap+2018:+an+updated+atlas+of+regulatory+regions+from+an+integrative+analysis+of+DNA-binding+ChIP-seq+experiments.">ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments.</a> Nucleic Acids Res. , (2017).</li><li>Yevshin, I., Sharipov, R., Valeev, T., Kel, A., Kolpakov, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTRD:+a+database+of+transcription+factor+binding+sites+identified+by+ChIP-seq+experiments.">GTRD: a database of transcription factor binding sites identified by ChIP-seq experiments.</a> Nucleic Acids Res. 45 (D1), D61-D67 (2017).</li><li>Kulakovskiy, I. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HOCOMOCO:+a+comprehensive+collection+of+human+transcription+factor+binding+sites+models.">HOCOMOCO: a comprehensive collection of human transcription factor binding sites models.</a> Nucleic Acids Res. 41 (Database issue), D195-D202 (2013).</li><li>Jain, D., Baldi, S., Zabel, A., Straub, T., Becker, P. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+promoters+give+rise+to+false+positive+'Phantom+Peaks'+in+ChIP-seq+experiments.">Active promoters give rise to false positive 'Phantom Peaks' in ChIP-seq experiments.</a> Nucleic Acids Res. 43 (14), 6959-6968 (2015).</li><li>Gerstein, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+the+human+regulatory+network+derived+from+ENCODE+data.">Architecture of the human regulatory network derived from ENCODE data.</a> Nature. 489 (7414), 91-100 (2012).</li></ol>

포유류 유전자 조절 네트워크는 매우 복잡 합니다. 칩 seq 게놈 넓은 단백질 DNA 상호 작용을 조사 하는 강력한 방법입니다. 이 프로토콜 Olig2 칩 seq (반응 당 20 천 셀 낮은) 마우스 두뇌에서 순화 OPCs의 낮은 수를 사용 하 여 수행 하는 방법을 포함 합니다. 이 프로토콜에 대 한 첫 번째 주요 단계에서 PDGFRα 항 체와 immunopanning에 의해 마우스 두뇌 OPCs의 정화 이다. PDGFRα 코팅 접시 OPCs의 긍정적인 선택 O...

단백질 (또는 복잡 한 단백질)을 공부 하는 것이 중요 하다 DNA 바인딩 및 후 성적인 부호 다양 한 생물학 과정에서 포함 된 transcriptional 규제 네트워크 구축. 특히, 게놈 dna 녹음 방송 요인의 바인딩 유전자 규칙, 세포 분화와 조직 개발에 중요 한 역할을 재생할 수 있습니다. 공부는 transcriptional 규칙 및 epigenetic 메커니즘에 대 한 강력한 도구 chromatin immunoprecipitation (칩)입니다. 차세대 시퀀싱 기술에 있는 급속 한 전진 때문 칩 (칩 seq) 연속 높 처리량 DNA와 결합 하 여 단백질-DNA 바인딩 및 epigenetic 마크1의 분석에 사용 됩니다. 그러나, 표준 칩 seq 프로토콜 셀 수는 고립 된 1 차 셀 등 희귀 세포 인구 제한 때이 기술의 응용 프로그램 어려운 반응 당 약 20 백만 셀을 필요 합니다.
Oligodendrocyte 계보 세포 oligodendrocyte 선구자 세포 (OPCs)와 oligodendrocytes를 포함 하 여 두뇌를 통해 널리 배포 하 고 개발 및 뇌의 기능에 필수적인. 선구자 세포의 유형으로 OPCs 자체 갱신와 차별화 할 수 있다. OPCs는 창시자 oligodendrocytes에 대 한 역할 뿐만 아니라 또한 뇌 세포2의 다른 종류와 통신 함으로써 신경 신호의 전파에 중요 한 역할. 이전 연구는 oligodendrocyte 개발 Olig2와 Sox103,4같은 계보 특정 녹음 방송 요인에 의해 통제 된다 제안 했다. 이 녹음 방송 요인 oligodendrocyte 사양과 차별화 하는 동안 그들의 표정에 영향을 몇 가지 중요 한 유전자의 발기인 또는 증강 인자 영역에 바인딩할 발견 됐다. 그러나, DNA 바인딩 단백질 (또는 복잡 한 단백질) 심하게 정화 기본 OPCs 셀의 매우 제한 된 수의 식별 하는 도전입니다.
이 프로토콜 Olig2 순화 마우스 OPCs 칩 seq 기술을 사용 하 여 게놈 넓은 규모에 의해 게놈 DNA immunoprecipitated를 체계적으로 조사 하는 방법을 설명 합니다. 마우스 두뇌에서 OPCs 심하게 immunopanning에 의해 정화 되었고 확산 체 외없이 칩 실험에 사용. 제한 된 수의 OPCs immunopanning에 의해 얻어질 수 있다 그리고 표준 칩 seq 실험에 대 한 충분 하지 않습니다. 여기, 낮은 셀 칩 seq 프로토콜은 낮은 녹음 방송 요인에 대 한 칩 반응 당 20 천 셀으로 설명 되어 있습니다. 간단히, 교차 연결 된 셀 lysed 되었고 sonicated 쥡니다 장치는 chromatin를 전단 하 여. 깎인된 chromatin Olig2 바인딩된 항 체 게놈 DNA를 침전 하는 코팅 구슬 Olig2 항 체와 단백질 incubated 했다. 단백질 A 코팅 구슬 및 역방향 cross-linking에서 차입, 후 genomic DNA Olig2 항 체에 의해 시 켰 던 페 놀-클로 프롬 적 출에 의해 순화 되었다. 결과 제품 계량은 T-미행을 복종, 뇌관 어 닐 링 템플릿 전환 및 확장, 어댑터 및 증폭, 라이브러리 크기 선택 및 정화의 추가 칩 seq 도서관 건축을 위한 단계.
시퀀싱, 후 샘플 Olig2 전사 인자 항 체와 준비와 컨트롤 샘플에서 원시 읽기의 품질 분석 했다. 낮은 품질의 기본적인 쌍 어댑터 포함 된 읽기 조각 손질 했다. 다음, 트림 읽기 마우스 참조 게놈에 정렬 했다. 컨트롤 샘플에 비해 칩 읽기 봉우리로 검색을 위한 농축 크게 했다 게놈 영역입니다. 중요 한 봉우리, 대표 하는 잠재적인 전사 인자 바인딩 사이트 필터링 되었고 게놈 브라우저에 시각.
특히,이 프로토콜에서 설명 하는 방법은 모든 셀 종류 제한 된 숫자의 다른 녹음 방송 요인의 칩 seq에 광범위 하 게 사용할 수 있습니다.

<table>
	<tbody>
		<tr>
			<td>Reagent/ Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Banderiaea simplicifolia lectin 1</td>
			<td>Vector Laboratories</td>
			<td># L-1100</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat anti-PDGFRa antibody</td>
			<td>BD Bioscience</td>
			<td># 558774</td>
			<td></td>
		</tr>
		<tr>
			<td>Neural tissue dissociation Kit (P)</td>
			<td>MACS Miltenyi Biotec</td>
			<td># 130-092-628</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>STEMCELL technologies</td>
			<td># 07920</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Thermo Fisher</td>
			<td># 15596026</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody</td>
			<td>Millipore</td>
			<td># AB5320</td>
			<td></td>
		</tr>
		<tr>
			<td>Bioruptor Pico sonication device</td>
			<td>Diagenode</td>
			<td># B01060001</td>
			<td></td>
		</tr>
		<tr>
			<td>True MicroChIP kit</td>
			<td>Diagenode</td>
			<td># C01010130</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v)</td>
			<td>Thermo Fisher</td>
			<td># 15593031</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-Up kit</td>
			<td>MACHEREY-NAGEL</td>
			<td># 740609</td>
			<td></td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Assay Kit</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA SMART ChIP-Seq kit</td>
			<td>Clontech Laboratories</td>
			<td># 634865</td>
			<td></td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP</td>
			<td>Beckman Voulter</td>
			<td># A63880</td>
			<td></td>
		</tr>
		<tr>
			<td>GlycoBlue</td>
			<td>Thermo Fisher</td>
			<td># AM9516</td>
			<td></td>
		</tr>
		<tr>
			<td>pico-green</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>D-PBS</td>
			<td>Thermo Fisher</td>
			<td># 14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green master mix</td>
			<td>Bio-Rad Laboratories</td>
			<td># 1725124</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Fisher Scientific</td>
			<td># 11-320-033</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (P/S)</td>
			<td>Fisher Scientific</td>
			<td># 15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>N-2 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17502048</td>
			<td></td>
		</tr>
		<tr>
			<td>B-27 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17504044</td>
			<td></td>
		</tr>
		<tr>
			<td>insulin</td>
			<td>Sigma</td>
			<td># I6634</td>
			<td>Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 &#956;l of 1 N HCl.</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin, suitable for cell culture (BSA)</td>
			<td>Sigma</td>
			<td># A4161</td>
			<td>Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4</td>
		</tr>
		<tr>
			<td>Fibroblast Growth Factor basic Protein, Human recombinant (bFGF)</td>
			<td>EMD Millipore</td>
			<td># GF003</td>
			<td></td>
		</tr>
		<tr>
			<td>HUMAN PDGF-AA</td>
			<td>VWR</td>
			<td># 102061-188</td>
			<td></td>
		</tr>
		<tr>
			<td>poly-D-lysine</td>
			<td>VWR</td>
			<td># IC15017510</td>
			<td>Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using.</td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mm</td>
			<td>VWR</td>
			<td># 25373-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mm</td>
			<td>VWR</td>
			<td># 25373-187</td>
			<td></td>
		</tr>
		<tr>
			<td>HBSS, 10X, no Calcium, no Magnesium, no Phenol Red</td>
			<td>Fisher Scientific</td>
			<td># 14185-052</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue</td>
			<td>Stemcell Technologies</td>
			<td># 07050</td>
			<td></td>
		</tr>
		<tr>
			<td>protease inhibitor cocktail</td>
			<td>Sigma</td>
			<td># 11697498001</td>
			<td></td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>FastQC</td>
			<td>[10] http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td>
			<td></td>
			<td>Obtaining quality control metrics of raw and trimmed reads</td>
		</tr>
		<tr>
			<td>Trimmomatic 0.33</td>
			<td>[11] http://www.usadellab.org/cms/?page=trimmomatic</td>
			<td></td>
			<td>Trimming and filtering raw reads</td>
		</tr>
		<tr>
			<td>GENCODE mm10</td>
			<td>ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz</td>
			<td></td>
			<td>Mouse reference genome</td>
		</tr>
		<tr>
			<td>Bowtie2 2.2.4</td>
			<td>[12] http://bowtie-bio.sourceforge.net/bowtie2/index.shtml</td>
			<td></td>
			<td>Aligning reads to a reference genome</td>
		</tr>
		<tr>
			<td>SAMTools 1.5</td>
			<td>[13] http://samtools.sourceforge.net/</td>
			<td></td>
			<td>Converting SAM file into BAM format</td>
		</tr>
		<tr>
			<td>HOMER 4.9.1</td>
			<td>[14] http://homer.ucsd.edu/homer/</td>
			<td></td>
			<td>Creating a tag directory and annotating enriched genomic regions with gene symbols</td>
		</tr>
		<tr>
			<td>R 3.2.2</td>
			<td>[15] https://www.R-project.org/</td>
			<td></td>
			<td>Programming scripts and running functions</td>
		</tr>
		<tr>
			<td>SPP 1.13</td>
			<td>[16] https://github.com/hms-dbmi/spp</td>
			<td></td>
			<td>Creating a strand cross-correlation plot</td>
		</tr>
		<tr>
			<td>MACS2 2.2.4</td>
			<td>[17] https://github.com/taoliu/MACS</td>
			<td></td>
			<td>Finding regions of ChIP enrichment over control</td>
		</tr>
		<tr>
			<td>BEDTools 2.25</td>
			<td>[18] http://bedtools.readthedocs.io/en/latest/</td>
			<td></td>
			<td>Genome arithmetics</td>
		</tr>
		<tr>
			<td>bedGraphToBigWig</td>
			<td>http://hgdownload.cse.ucsc.edu/admin/exe/</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>IGV browser 2.3.58</td>
			<td>[19] http://software.broadinstitute.org/software/igv/</td>
			<td></td>
			<td>Visualization and browsing of significant ChIP-seq peaks</td>
		</tr>
		<tr>
			<td>Microsoft Excel</td>
			<td></td>
			<td></td>
			<td>Spreasheet program</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s blacklist</td>
			<td>https://sites.google.com/site/anshulkundaje/projects/blacklists</td>
			<td></td>
			<td>Filtering peaks</td>
		</tr>
		<tr>
			<td>mm10.chrom.sizes</td>
			<td>http://hgdownload.cse.ucsc.edu/goldenPath/mm10/bigZips/mm10.chrom.sizes.</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s motif database</td>
			<td>[25] http://compbio.mit.edu/encode-motifs/</td>
			<td></td>
			<td>Comprehensive motif database required for motif enrichment</td>
		</tr>
		<tr>
			<td>MEME-ChIP</td>
			<td>[20] http://meme-suite.org/index.html</td>
			<td></td>
			<td>Motif enrichment analysis and motif discovery</td>
		</tr>
		<tr>
			<td>Primer names used for qPCR</td>
			<td></td>
			<td></td>
			<td>Primer sequences used for qPCR</td>
		</tr>
		<tr>
			<td>Mbp-F:</td>
			<td></td>
			<td></td>
			<td>CTATAAATCGGCTCACAAGG</td>
		</tr>
		<tr>
			<td>Mbp-R:</td>
			<td></td>
			<td></td>
			<td>AGGCGGTTATATTAAGAAGC</td>
		</tr>
		<tr>
			<td>Iba1-F:</td>
			<td></td>
			<td></td>
			<td>ACTGCCAGCCTAAGACAACC</td>
		</tr>
		<tr>
			<td>Iba1-R:</td>
			<td></td>
			<td></td>
			<td>GCTTTTCCTCCCTGCAAATCC</td>
		</tr>
		<tr>
			<td>Mog-F:</td>
			<td></td>
			<td></td>
			<td>GGCTTCTTGGAGGAAGGGAC</td>
		</tr>
		<tr>
			<td>Mog-R:</td>
			<td></td>
			<td></td>
			<td>TGAATTGTCCTGCATAGCTGC</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td></td>
			<td></td>
			<td>ATGACATCAAGAAGGTGGTG</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td></td>
			<td></td>
			<td>CATACCAGGAAATGAGCTTG</td>
		</tr>
		<tr>
			<td>Tuj1-F</td>
			<td></td>
			<td></td>
			<td>TTTTCGTCTCTAGCCGCGTG</td>
		</tr>
		<tr>
			<td>Tuj1-R</td>
			<td></td>
			<td></td>
			<td>GATGACCTCCCAGAACTTGGC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-F</td>
			<td></td>
			<td></td>
			<td>AGAGTTACACGTTTGAGCTGTC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-R</td>
			<td></td>
			<td></td>
			<td>GTCCCTCCACGGTACTCCT</td>
		</tr>
	</tbody>
</table>

identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis

포유류 세포에서 유전자 전사 genomic dna transcriptional 요인의 상호 작용에 의해 세포 유형 특정 방식으로 통제 된다. 계보 특정 녹음 방송 요인은 셀 사양 및 분화 개발 과정에 필수적인 역할을 간주 됩니다. 높은 처리량 DNA 연속 (칩 seq)와 결합 하는 칩은 genomic dna 녹음 방송 요인 (또는 그것의 관련 된 복잡 한)의 게놈 넓은 바인딩 사이트를 분석 하 널리 이용 된다. 그러나, 많은 세포는 하나의 표준 칩 반응, 어려운 고립 된 1 차 셀 또는 희귀 세포 인구 제한 수를 공부 하는 필요 합니다. Oligodendrocyte 계보 관련 전사의 규제 메커니즘을 이해 하기 위해서는 요소 Olig2 심하게 순화 마우스 OPCs Olig2 (또는 Olig2 복잡 한)의 게놈 넓은 바인딩 사이트 식별 칩 seq를 사용 하 여 상세한 방법에에서 표시 됩니다. 프로토콜 혈소판 파생 된 성장 인자 수용 체 알파 (PDGFRα)를 정화 하는 방법을 설명 하는 첫째, 긍정적인 OPCs 마우스 두뇌에서. 다음, Olig2 항 체 칩을 중재 하 고 도서관 건설 수행 됩니다. 마지막 부분 bioinformatic 소프트웨어 및 Olig2 칩 seq 분석에 사용 되는 절차에 설명 합니다. 요약 하자면,이 종이 심하게 정화 뇌 OPCs transcriptional 요소 Olig2의 게놈 넓은 바인딩 분석 하는 방법을 보고 합니다.

낮은 셀 칩 seq 수행한 고 bioinformatic 분석 심하게 정화 뇌 OPCs genomic dna Olig2 transcriptional 요소의 잠재적인 상호 작용을 조사 했다. 그림 1 실험 및 데이터 분석 절차의 일반적인 워크플로 보여 줍니다. 이 프로토콜에서 출생 후 쥐 두뇌 했다 단일 세포 현 탁 액에 해리 했다. 조직 분리 후 immunopanning PDGFRα 항 체를 사용 하 여 OPCs 정화 수행 되었다. <strong cla...

Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃŽÂ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃƒÆ’Ã…Â½Ãƒâ€šÃ‚Â±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

여기에 우리가 현재 낮은 셀 chromatin immunoprecipitation (칩)를 수행 하 여 분석 하는 게놈 넓은의 바인딩을 oligodendrocyte 녹음 방송 요인 2 (Olig2) 심하게 정화 뇌 oligodendrocyte 선구자 세포 (OPCs) 하도록 설계 된 프로토콜 도서관 준비, 높은 처리량 시퀀싱 및 bioinformatic 데이터 분석.

PDGFRα + 셀 낮은 셀 Chromatin Immunoprecipitation 시퀀싱 분석에 의해 정화에 녹음 방송 요인 Olig2 게놈 바인딩 사이트를 심하게 식별

In mammalian cells, gene transcription is regulated in a cell type specific manner by the interactions of transcriptional factors with genomic DNA. ...

Education

Research

JoVE Core

JoVE Journal

Molecular Biology

Biology

Neuroscience

Genetics

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFR&#945;+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

Unit 1

DNA Structure and Function

Gene Expression

SCIENTISTS IN ACTION

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

마우스 망막 신경절 세포 Transfection로 생체내에 Electroporation

The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural ...

연구

신경과학

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

손상의 감각 오르간 전구체 세포 라이브 셀 이미징 Drosophila Pupae

Since the discovery of Green Fluorescent Protein (GFP), there has been a revolutionary change in the use of live-cell imaging as a tool for understanding ...

Chromatin Immunoprecipitation from Dorsal Root Ganglia Tissue following Axonal Injury

Axonal 상해 다음 도설 루트 신경 조직에서 염색질의 Immunoprecipitation

Axons in the central nervous system (CNS) do not regenerate while those in the peripheral nervous system (PNS) do regenerate 
to a limited extent after ...

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange (ABE)

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange ABE

Immunoprecipitation 및 아실-비오틴 거래소 (아베)에 의한 양식 Hippocampal 뉴런의 단백질 Palmitoylation의 감지

Palmitoylation is a post-translational lipid  modification involving the attachment of a 16-carbon saturated fatty acid,  palmitate, to cysteine residues ...

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

Extracellularly의 근육 모터 풀에 모터 뉴런을 확인<em&gt; Aplysia californica</em

In animals with large  identified neurons (e.g. mollusks), analysis of motor pools is done using  intracellular techniques1,2,3,4. Recently,  we developed ...

Intracerebroventricular Injection of Amyloid-&#946; Peptides in Normal Mice to Acutely Induce Alzheimer-like Cognitive Deficits

Intracerebroventricular Injection of Amyloid-ÃƒÅ½Ã‚Â² Peptides in Normal Mice to Acutely Induce Alzheimer-like Cognitive Deficits

일반 마우스의 아밀로이드-β의 펩티드의 뇌 실내 주사는 급성 치매와 같은인지 적자를 유도합니다

Amyloid-&#946; (A&#946;) is a major pathological mediator of both familial and sporadic Alzheimer's disease (AD). In the brains of AD patients, ...

Assessment of Dopaminergic Homeostasis in Mice by Use of High-performance Liquid Chromatography Analysis and Synaptosomal Dopamine Uptake

고성능 액체 크로마토그래피 분석 및 Synaptosomal 도파민 통풍 관의 사용에 의해 쥐에서 Dopaminergic 항상성의 평가

Dopamine (DA) is a modulatory neurotransmitter controlling motor activity, reward processes and cognitive function. Impairment of dopaminergic (DAergic) ...

Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark

절연 및 신경 창시자 Chromatin-Immunoprecipitation 히스톤 3 리 79 Dimethylation 마크의 뒤의 재배

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. ...

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

대규모 병렬 단일 핵 RNA 시퀀싱에 대 한 성인 척수 핵의 절연

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a ...

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing (DIVA-Seq)

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing DIVA-Seq

단일 셀 RNA 시퀀싱 시퀀싱 (디바-Seq) 절대 수 수동 정렬 및 두 배 전사 생체 외에서 를 사용 하 여 붙일 레이블이 마우스 뉴런의

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing ...