Name: identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis
Uploaded: 2018-04-16T14:00:00
Description: Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃŽÂ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

JQW, XD, RCDD e YY foram apoiados por concessões dos institutos nacionais de saúde R01 NS088353; NIH conceder 1R21AR071583-01; a Fundação de Hermann Staman Ogilvie fundo-Memorial; a iniciativa do cérebro UTHealth e CTSA UL1 TR000371; e uma bolsa da Universidade do Texas sistema neurociência e Neurotecnologia Research Institute (Grant #362469).

Todos os animal uso e protocolos experimentais foram efectuados de acordo com o guia para o cuidado e o uso de animais de laboratório e aprovados pelo Comitê de biossegurança institucional e Comissão de bem-estar Animal no Health Science Center da Universidade do Texas, no Houston.
1. purificação de células positivas PDGFRα da linhagem do Oligodendrocyte de cérebro de rato (modificado de immunopanning descrito anteriormente protocolos5,<sup class="xref...

<ol>
	<li>Wu, J. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tcf7+is+an+important+regulator+of+the+switch+of+self-renewal+and+differentiation+in+a+multipotential+hematopoietic+cell+line.">Tcf7 is an important regulator of the switch of self-renewal and differentiation in a multipotential hematopoietic cell line.</a> PLoS Genet. 8 (3), e1002565 (2012).</li><li>Zuchero, J. B., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+and+extrinsic+control+of+oligodendrocyte+development.">Intrinsic and extrinsic control of oligodendrocyte development.</a> Curr Opin Neurobiol. 23 (6), 914-920 (2013).</li><li>Liu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+oligodendrocyte+differentiation+by+Olig2+and+Sox10:+evidence+for+reciprocal+interactions+and+dosage-dependent+mechanisms.">Induction of oligodendrocyte differentiation by Olig2 and Sox10: evidence for reciprocal interactions and dosage-dependent mechanisms.</a> Dev Biol. 302 (2), 683-693 (2007).</li><li>Dong, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+Identification+of+Long+Non-coding+RNAs+in+Purified+Cell+Types+from+the+Brain+Reveals+Functional+LncRNA+in+OPC+Fate+Determination.">Comprehensive Identification of Long Non-coding RNAs in Purified Cell Types from the Brain Reveals Functional LncRNA in OPC Fate Determination.</a> PLoS Genet. 11 (12), e1005669 (2015).</li><li>Hilgenberg, L. G., Smith, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+dissociated+mouse+cortical+neuron+cultures.">Preparation of dissociated mouse cortical neuron cultures.</a> J Vis Exp. (10), e562 (2007).</li><li>Emery, B., Dugas, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+oligodendrocyte+lineage+cells+from+mouse+cortices+by+immunopanning.">Purification of oligodendrocyte lineage cells from mouse cortices by immunopanning.</a> Cold Spring Harb Protoc. 2013 (9), 854-868 (2013).</li><li>Cahoy, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptome+database+for+astrocytes,+neurons,+and+oligodendrocytes:+a+new+resource+for+understanding+brain+development+and+function.">A transcriptome database for astrocytes, neurons, and oligodendrocytes: a new resource for understanding brain development and function.</a> J Neurosci. 28 (1), 264-278 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> J Neurosci. 34 (36), 11929-11947 (2014).</li><li>Cheng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+protein+signaling+and+olig1/2+interact+to+regulate+the+differentiation+and+maturation+of+adult+oligodendrocyte+precursor+cells.">Bone morphogenetic protein signaling and olig1/2 interact to regulate the differentiation and maturation of adult oligodendrocyte precursor cells.</a> Stem Cells. 25 (12), 3204-3214 (2007).</li><li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimmomatic:+a+flexible+trimmer+for+Illumina+sequence+data.">Trimmomatic: a flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30 (15), 2114-2120 (2014).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Methods. 9 (4), 357-359 (2012).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Heinz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+combinations+of+lineage-determining+transcription+factors+prime+cis-regulatory+elements+required+for+macrophage+and+B+cell+identities.">Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities.</a> Mol Cell. 38 (4), 576-589 (2010).</li><li>Team, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+language+and+environment+for+statistical+computing.">A language and environment for statistical computing.</a> R Foundation for Statistical Computing. , (2015).</li><li>Kharchenko, P. V., Tolstorukov, M. Y., Park, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+analysis+of+ChIP-seq+experiments+for+DNA-binding+proteins.">Design and analysis of ChIP-seq experiments for DNA-binding proteins.</a> Nat Biotechnol. 26 (12), 1351-1359 (2008).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biol. 9 (9), R137 (2008).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Robinson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat Biotechnol. 29 (1), 24-26 (2011).</li><li>Bailey, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MEME+SUITE:+tools+for+motif+discovery+and+searching.">MEME SUITE: tools for motif discovery and searching.</a> Nucleic Acids Res. 37 (Web Server issue), W202-W208 (2009).</li><li>Sims, D., Sudbery, I., Ilott, N. E., Heger, A., Ponting, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+depth+and+coverage:+key+considerations+in+genomic+analyses.">Sequencing depth and coverage: key considerations in genomic analyses.</a> Nat Rev Genet. 15 (2), 121-132 (2014).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Res. 22 (9), 1813-1831 (2012).</li><li>Consortium, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Mazzoni, E. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-based+mapping+of+developmental+transcriptional+programs.">Embryonic stem cell-based mapping of developmental transcriptional programs.</a> Nat Methods. 8 (12), 1056-1058 (2011).</li><li>Kheradpour, P., Kellis, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+discovery+and+characterization+of+regulatory+motifs+in+ENCODE+TF+binding+experiments.">Systematic discovery and characterization of regulatory motifs in ENCODE TF binding experiments.</a> Nucleic Acids Res. 42 (5), 2976-2987 (2014).</li><li>Dugas, J. C., Tai, Y. C., Speed, T. P., Ngai, J., Barres, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+analysis+of+oligodendrocyte+differentiation.">Functional genomic analysis of oligodendrocyte differentiation.</a> J Neurosci. 26 (43), 10967-10983 (2006).</li><li>Gilfillan, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limitations+and+possibilities+of+low+cell+number+ChIP-seq.">Limitations and possibilities of low cell number ChIP-seq.</a> BMC Genomics. 13, 645 (2012).</li><li>Raskatov, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+NF-kappaB-dependent+gene+transcription+using+programmable+DNA+minor+groove+binders.">Modulation of NF-kappaB-dependent gene transcription using programmable DNA minor groove binders.</a> Proc Natl Acad Sci U S A. 109 (4), 1023-1028 (2012).</li><li>Cheneby, J., Gheorghe, M., Artufel, M., Mathelier, A., Ballester, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ReMap+2018:+an+updated+atlas+of+regulatory+regions+from+an+integrative+analysis+of+DNA-binding+ChIP-seq+experiments.">ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments.</a> Nucleic Acids Res. , (2017).</li><li>Yevshin, I., Sharipov, R., Valeev, T., Kel, A., Kolpakov, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GTRD:+a+database+of+transcription+factor+binding+sites+identified+by+ChIP-seq+experiments.">GTRD: a database of transcription factor binding sites identified by ChIP-seq experiments.</a> Nucleic Acids Res. 45 (D1), D61-D67 (2017).</li><li>Kulakovskiy, I. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HOCOMOCO:+a+comprehensive+collection+of+human+transcription+factor+binding+sites+models.">HOCOMOCO: a comprehensive collection of human transcription factor binding sites models.</a> Nucleic Acids Res. 41 (Database issue), D195-D202 (2013).</li><li>Jain, D., Baldi, S., Zabel, A., Straub, T., Becker, P. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+promoters+give+rise+to+false+positive+'Phantom+Peaks'+in+ChIP-seq+experiments.">Active promoters give rise to false positive 'Phantom Peaks' in ChIP-seq experiments.</a> Nucleic Acids Res. 43 (14), 6959-6968 (2015).</li><li>Gerstein, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+the+human+regulatory+network+derived+from+ENCODE+data.">Architecture of the human regulatory network derived from ENCODE data.</a> Nature. 489 (7414), 91-100 (2012).</li></ol>

Redes de regulamento do gene de mamíferos são muito complexas. ChIP-seq é um método poderoso para investigar interações proteína-ADN de todo o genoma. Este protocolo inclui como executar Olig2 ChIP-seq usando um número baixo de OPCs purificados de cérebro de rato (tão baixo quanto 20 mil células por reação). O primeiro passo fundamental para este protocolo é a purificação de OPCs de cérebro de rato por immunopanning com anticorpo PDGFRα. Para a selecção positiva de OPCs com placas PDGFRα revestido, O...

É importante estudar a proteína (ou complexo proteico) ligações de DNA e as marcas epigenéticas para construir redes de regulação transcricionais envolvida em vários processos biológicos. Particularmente, as associações de fatores de transcrição com o DNA genômico podem desempenhar um papel importante no Regulamento do gene, a diferenciação celular e o desenvolvimento de tecido. Uma poderosa ferramenta para estudar a regulação transcricional e mecanismos epigenéticos é imunoprecipitação da cromatina (ChIP). Devido aos avanços rápidos na próxima geração de tecnologia de sequenciamento, ChIP, juntamente com o sequenciamento de DNA do elevado-throughput (ChIP-seq) é usado para as análises de associações de proteína-ADN e marcas epigenéticas1. No entanto, um protocolo padrão de ChIP-seq requer aproximadamente 20 milhões de células por reação, o que dificulta a aplicação desta técnica, quando o número de células é limitado, tais como células primárias isoladas e populações de células raras.
Células de linhagem oligodendrocyte incluindo células precursoras de oligodendrocyte (OPCs) e oligodendrócitos são amplamente distribuídas por todo o cérebro e são essenciais para o desenvolvimento e a função do cérebro. Como um tipo de células precursoras, OPCs são capazes de auto-renovação e diferenciação. OPCs não só servem como progenitoras de oligodendrócitos, mas também desempenham um papel importante na propagação de sinalização neuronal, comunicando-se com outros tipos de células de cérebro2. Estudos anteriores sugeriram que o desenvolvimento do oligodendrocyte é regulamentado por fatores de transcrição de linhagem-específicos tais como Olig2 e Sox103,4. Estes fatores de transcrição foram encontrados para ligar as regiões promotor ou potenciador de alguns genes cruciais para influenciar sua expressão durante oligodendrocyte especificação e diferenciação. No entanto, é difícil identificar DNA-ligando da proteína (ou complexo proteico) de interesse em OPCs primárias aguda purificadas com um número muito limitado de células.
Este protocolo descreve como investigar sistematicamente a immunoprecipitated DNA genômico pela Olig2 no rato purificada OPCs no genoma-larga escala usando a técnica de ChIP-seq. OPCs de cérebro de rato aguda foram purificados por immunopanning e usados em um experimento de ChIP sem proliferação in vitro. Um número limitado de OPCs pode ser obtido por immunopanning e é insuficiente para experimentos de ChIP-seq padrão. Neste documento, um protocolo de ChIP-seq baixo-célula com tão baixo quanto 20 mil células por reação de ChIP para fatores de transcrição é descrito. Em breve, reticuladas células foram lysed e lisadas por um dispositivo sonication de cisalhamento a cromatina. A cromatina cortada foi incubada com anticorpo Olig2, bem como proteína grânulos revestidos A para precipitar Olig2 anticorpo ligado DNA genômico. Após a eluição de grânulos de proteína A-revestido e cross-linking reversa, DNA genômico precipitado pelo anticorpo Olig2 foi purificado por extração fenol-clorofórmio. O produto resultante foi quantificado e submetido a T-tailing, primeira demão recozimento modelo de comutação e de extensão, a adição de adaptadores e amplificação, seleção de tamanho de biblioteca e purificação passos para construção de biblioteca de ChIP-seq.
Após o sequenciamento, foi analisada a qualidade do cru diz tanto a amostra preparada com anticorpos de factor de transcrição Olig2 e a amostra de controle. Pares de base de baixa qualidade e adaptador contendo leram fragmentos foram aparados. Próximo, aparadas leituras estavam alinhadas para o genoma de referência de rato. As regiões genômicas que foram significativamente enriquecidas para leituras de ChIP, em comparação com as amostras de controlo, foram detectadas como picos. Picos significativos, representando potenciais locais de ligação de fator de transcrição, foram filtrados e visualizados em um navegador de genoma.
Notavelmente, o método descrito neste protocolo pode ser amplamente utilizado para ChIP-seq de outros factores de transcrição com qualquer tipo de célula do número limitado.

<table>
	<tbody>
		<tr>
			<td>Reagent/ Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Banderiaea simplicifolia lectin 1</td>
			<td>Vector Laboratories</td>
			<td># L-1100</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat anti-PDGFRa antibody</td>
			<td>BD Bioscience</td>
			<td># 558774</td>
			<td></td>
		</tr>
		<tr>
			<td>Neural tissue dissociation Kit (P)</td>
			<td>MACS Miltenyi Biotec</td>
			<td># 130-092-628</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase</td>
			<td>STEMCELL technologies</td>
			<td># 07920</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Thermo Fisher</td>
			<td># 15596026</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-NG2 Chondroitin Sulfate Proteoglycan Antibody</td>
			<td>Millipore</td>
			<td># AB5320</td>
			<td></td>
		</tr>
		<tr>
			<td>Bioruptor Pico sonication device</td>
			<td>Diagenode</td>
			<td># B01060001</td>
			<td></td>
		</tr>
		<tr>
			<td>True MicroChIP kit</td>
			<td>Diagenode</td>
			<td># C01010130</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v)</td>
			<td>Thermo Fisher</td>
			<td># 15593031</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-Up kit</td>
			<td>MACHEREY-NAGEL</td>
			<td># 740609</td>
			<td></td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Assay Kit</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA SMART ChIP-Seq kit</td>
			<td>Clontech Laboratories</td>
			<td># 634865</td>
			<td></td>
		</tr>
		<tr>
			<td>Agencourt AMPure XP</td>
			<td>Beckman Voulter</td>
			<td># A63880</td>
			<td></td>
		</tr>
		<tr>
			<td>GlycoBlue</td>
			<td>Thermo Fisher</td>
			<td># AM9516</td>
			<td></td>
		</tr>
		<tr>
			<td>pico-green</td>
			<td>Thermo Fisher</td>
			<td># P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>D-PBS</td>
			<td>Thermo Fisher</td>
			<td># 14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBR Green master mix</td>
			<td>Bio-Rad Laboratories</td>
			<td># 1725124</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Fisher Scientific</td>
			<td># 11-320-033</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (P/S)</td>
			<td>Fisher Scientific</td>
			<td># 15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>N-2 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17502048</td>
			<td></td>
		</tr>
		<tr>
			<td>B-27 Supplement</td>
			<td>Fisher Scientific</td>
			<td># 17504044</td>
			<td></td>
		</tr>
		<tr>
			<td>insulin</td>
			<td>Sigma</td>
			<td># I6634</td>
			<td>Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 &#956;l of 1 N HCl.</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin, suitable for cell culture (BSA)</td>
			<td>Sigma</td>
			<td># A4161</td>
			<td>Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4</td>
		</tr>
		<tr>
			<td>Fibroblast Growth Factor basic Protein, Human recombinant (bFGF)</td>
			<td>EMD Millipore</td>
			<td># GF003</td>
			<td></td>
		</tr>
		<tr>
			<td>HUMAN PDGF-AA</td>
			<td>VWR</td>
			<td># 102061-188</td>
			<td></td>
		</tr>
		<tr>
			<td>poly-D-lysine</td>
			<td>VWR</td>
			<td># IC15017510</td>
			<td>Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using.</td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mm</td>
			<td>VWR</td>
			<td># 25373-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mm</td>
			<td>VWR</td>
			<td># 25373-187</td>
			<td></td>
		</tr>
		<tr>
			<td>HBSS, 10X, no Calcium, no Magnesium, no Phenol Red</td>
			<td>Fisher Scientific</td>
			<td># 14185-052</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue</td>
			<td>Stemcell Technologies</td>
			<td># 07050</td>
			<td></td>
		</tr>
		<tr>
			<td>protease inhibitor cocktail</td>
			<td>Sigma</td>
			<td># 11697498001</td>
			<td></td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>FastQC</td>
			<td>[10] http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td>
			<td></td>
			<td>Obtaining quality control metrics of raw and trimmed reads</td>
		</tr>
		<tr>
			<td>Trimmomatic 0.33</td>
			<td>[11] http://www.usadellab.org/cms/?page=trimmomatic</td>
			<td></td>
			<td>Trimming and filtering raw reads</td>
		</tr>
		<tr>
			<td>GENCODE mm10</td>
			<td>ftp://ftp.sanger.ac.uk/pub/gencode/Gencode_mouse/release_M15/GRCm38.primary_assembly.genome.fa.gz</td>
			<td></td>
			<td>Mouse reference genome</td>
		</tr>
		<tr>
			<td>Bowtie2 2.2.4</td>
			<td>[12] http://bowtie-bio.sourceforge.net/bowtie2/index.shtml</td>
			<td></td>
			<td>Aligning reads to a reference genome</td>
		</tr>
		<tr>
			<td>SAMTools 1.5</td>
			<td>[13] http://samtools.sourceforge.net/</td>
			<td></td>
			<td>Converting SAM file into BAM format</td>
		</tr>
		<tr>
			<td>HOMER 4.9.1</td>
			<td>[14] http://homer.ucsd.edu/homer/</td>
			<td></td>
			<td>Creating a tag directory and annotating enriched genomic regions with gene symbols</td>
		</tr>
		<tr>
			<td>R 3.2.2</td>
			<td>[15] https://www.R-project.org/</td>
			<td></td>
			<td>Programming scripts and running functions</td>
		</tr>
		<tr>
			<td>SPP 1.13</td>
			<td>[16] https://github.com/hms-dbmi/spp</td>
			<td></td>
			<td>Creating a strand cross-correlation plot</td>
		</tr>
		<tr>
			<td>MACS2 2.2.4</td>
			<td>[17] https://github.com/taoliu/MACS</td>
			<td></td>
			<td>Finding regions of ChIP enrichment over control</td>
		</tr>
		<tr>
			<td>BEDTools 2.25</td>
			<td>[18] http://bedtools.readthedocs.io/en/latest/</td>
			<td></td>
			<td>Genome arithmetics</td>
		</tr>
		<tr>
			<td>bedGraphToBigWig</td>
			<td>http://hgdownload.cse.ucsc.edu/admin/exe/</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>IGV browser 2.3.58</td>
			<td>[19] http://software.broadinstitute.org/software/igv/</td>
			<td></td>
			<td>Visualization and browsing of significant ChIP-seq peaks</td>
		</tr>
		<tr>
			<td>Microsoft Excel</td>
			<td></td>
			<td></td>
			<td>Spreasheet program</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s blacklist</td>
			<td>https://sites.google.com/site/anshulkundaje/projects/blacklists</td>
			<td></td>
			<td>Filtering peaks</td>
		</tr>
		<tr>
			<td>mm10.chrom.sizes</td>
			<td>http://hgdownload.cse.ucsc.edu/goldenPath/mm10/bigZips/mm10.chrom.sizes.</td>
			<td></td>
			<td>Converting bedGraph file into bigwig</td>
		</tr>
		<tr>
			<td>ENCODE&#39;s motif database</td>
			<td>[25] http://compbio.mit.edu/encode-motifs/</td>
			<td></td>
			<td>Comprehensive motif database required for motif enrichment</td>
		</tr>
		<tr>
			<td>MEME-ChIP</td>
			<td>[20] http://meme-suite.org/index.html</td>
			<td></td>
			<td>Motif enrichment analysis and motif discovery</td>
		</tr>
		<tr>
			<td>Primer names used for qPCR</td>
			<td></td>
			<td></td>
			<td>Primer sequences used for qPCR</td>
		</tr>
		<tr>
			<td>Mbp-F:</td>
			<td></td>
			<td></td>
			<td>CTATAAATCGGCTCACAAGG</td>
		</tr>
		<tr>
			<td>Mbp-R:</td>
			<td></td>
			<td></td>
			<td>AGGCGGTTATATTAAGAAGC</td>
		</tr>
		<tr>
			<td>Iba1-F:</td>
			<td></td>
			<td></td>
			<td>ACTGCCAGCCTAAGACAACC</td>
		</tr>
		<tr>
			<td>Iba1-R:</td>
			<td></td>
			<td></td>
			<td>GCTTTTCCTCCCTGCAAATCC</td>
		</tr>
		<tr>
			<td>Mog-F:</td>
			<td></td>
			<td></td>
			<td>GGCTTCTTGGAGGAAGGGAC</td>
		</tr>
		<tr>
			<td>Mog-R:</td>
			<td></td>
			<td></td>
			<td>TGAATTGTCCTGCATAGCTGC</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td></td>
			<td></td>
			<td>ATGACATCAAGAAGGTGGTG</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td></td>
			<td></td>
			<td>CATACCAGGAAATGAGCTTG</td>
		</tr>
		<tr>
			<td>Tuj1-F</td>
			<td></td>
			<td></td>
			<td>TTTTCGTCTCTAGCCGCGTG</td>
		</tr>
		<tr>
			<td>Tuj1-R</td>
			<td></td>
			<td></td>
			<td>GATGACCTCCCAGAACTTGGC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-F</td>
			<td></td>
			<td></td>
			<td>AGAGTTACACGTTTGAGCTGTC</td>
		</tr>
		<tr>
			<td>PDGFR&#945;-R</td>
			<td></td>
			<td></td>
			<td>GTCCCTCCACGGTACTCCT</td>
		</tr>
	</tbody>
</table>

identifying transcription factor olig2 genomic binding sites in acutely purified pdgfr&#945;+ cells by low-cell chromatin immunoprecipitation sequencing analysis

Em células de mamíferos, a transcrição do gene é regulada de maneira específica de tipo de célula pelas interações dos fatores transcricionais com DNA genômico. Fatores de transcrição de linhagem-específicos são considerados desempenham um papel essencial na especificação de célula e diferenciação durante o desenvolvimento. ChIP, juntamente com o sequenciamento de DNA do elevado-throughput (ChIP-seq) é amplamente utilizado para analisar os locais obrigatórios de todo o genoma de fatores de transcrição (ou seu complexo associado) de DNA genômico. No entanto, um grande número de células é necessário para uma reação de ChIP padrão, que torna difícil estudar o número limitado de células primárias isoladas ou populações de células raras. Para entender o mecanismo regulatório de transcrição de linhagem específica oligodendrocyte fator Olig2 no rato agudamente purificado OPCs, um método detalhado usando ChIP-seq para identificar os sítios de ligação de todo o genoma de Olig2 (ou Olig2 complexo) é mostrado. Primeiro, o protocolo explica como purificar a alfa do receptor do fator de crescimento derivado de plaquetas (PDGFRα) OPCs positivos de cérebro de rato. Em seguida, Olig2 anticorpo mediada ChIP e construção de biblioteca são executadas. A última parte descreve o software de bioinformatic e procedimentos utilizados para análise de Olig2 ChIP-seq. Em resumo, este trabalho relata um método para analisar as ligações de todo o genoma do fator transcricional Olig2 no cérebro agudamente purificado OPCs.

Realizou-se baixo-celular ChIP-seq e bioinformatic análises foram feitas para investigar as potenciais interações do fator transcricional Olig2 com DNA genômico no cérebro agudamente purificado OPCs. A Figura 1 mostra um fluxo de trabalho geral de ambos os experimentais e os procedimentos de análise de dados. Neste protocolo, cérebros de ratos pós-natal foram dissociados em uma suspensão de célula única. Após dissociação de tecido, immunopanning...

Watch this Scientific Journal Video about Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃŽÂ±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysi

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRÃƒÆ’Ã…Â½Ãƒâ€šÃ‚Â±+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

Aqui nós apresentamos um protocolo que visa analisar todo o genoma ligação do factor de transcrição do oligodendrocyte 2 (Olig2) em agudamente purificada oligodendrocyte precursor as células do cérebro (OPCs) através da realização de imunoprecipitação da cromatina de baixo-celular (ChIP) , preparação de biblioteca, elevado-throughput sequenciamento e análise de dados de bioinformatic.

Identificação de Sítios de Ligação Genômica do Fator de Transcrição Olig2 em Células PDGFRα+ Purificadas por Análise de Sequenciamento de Imunoprecipitação de Cromatina de Poucas Células

In mammalian cells, gene transcription is regulated in a cell type specific manner by the interactions of transcriptional factors with genomic DNA. ...

Education

Research

JoVE Core

JoVE Journal

Molecular Biology

Biology

Neuroscience

Genetics

Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFR&#945;+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis

Unit 1

DNA Structure and Function

Gene Expression

SCIENTISTS IN ACTION

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

Transfecção de células de camundongo por Ganglionares da Retina In vivo Eletroporação

The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural ...

Neurociência

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Em células vivas, imagens de células precursoras de órgãos sensoriais na Intact Drosophila As pupas

Since the discovery of Green Fluorescent Protein (GFP), there has been a revolutionary change in the use of live-cell imaging as a tool for understanding ...

Chromatin Immunoprecipitation from Dorsal Root Ganglia Tissue following Axonal Injury

Cromatina imunoprecipitação de Tissue Dorsal Root Gânglios seguintes Lesão Axonal

Axons in the central nervous system (CNS) do not regenerate while those in the peripheral nervous system (PNS) do regenerate 
to a limited extent after ...

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange (ABE)

Detection of Protein Palmitoylation in Cultured Hippocampal Neurons by Immunoprecipitation and Acyl-Biotin Exchange ABE

Detecção de palmitoylation proteína em neurônios cultivados por imunoprecipitação e Acil-Biotina Exchange (ABE)

Palmitoylation is a post-translational lipid  modification involving the attachment of a 16-carbon saturated fatty acid,  palmitate, to cysteine residues ...

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

Extracellularly Identifying Motor Neurons for a Muscle Motor Pool in Aplysia californica

Extracelularmente Identificar os neurônios motores de um pool do motor muscular em<em&gt; Aplysia californica</em

In animals with large  identified neurons (e.g. mollusks), analysis of motor pools is done using  intracellular techniques1,2,3,4. Recently,  we developed ...

Intracerebroventricular Injection of Amyloid-&#946; Peptides in Normal Mice to Acutely Induce Alzheimer-like Cognitive Deficits

Intracerebroventricular Injection of Amyloid-ÃƒÅ½Ã‚Â² Peptides in Normal Mice to Acutely Induce Alzheimer-like Cognitive Deficits

Injeção intracerebroventricular de peptídeos amilóide-beta em ratos normais para induzir Acutely déficits cognitivos Alzheimer-like

Amyloid-&#946; (A&#946;) is a major pathological mediator of both familial and sporadic Alzheimer's disease (AD). In the brains of AD patients, ...

Assessment of Dopaminergic Homeostasis in Mice by Use of High-performance Liquid Chromatography Analysis and Synaptosomal Dopamine Uptake

Avaliação da homeostase Dopaminergic em camundongos pelo uso de análise de cromatografia líquida de alta performance e captação da dopamina Synaptosomal

Dopamine (DA) is a modulatory neurotransmitter controlling motor activity, reward processes and cognitive function. Impairment of dopaminergic (DAergic) ...

Isolation and Cultivation of Neural Progenitors Followed by Chromatin-Immunoprecipitation of Histone 3 Lysine 79 Dimethylation Mark

Isolamento e cultivo de progenitores neurais seguido de imunoprecipitação de cromatina da marcação de dimetilação da lisina 9 da histona 3

Brain development is a complex process, which is controlled in a temporo-spatial manner by gradients of morphogens and different transcriptional programs. ...

Isolation of Adult Spinal Cord Nuclei for Massively Parallel Single-nucleus RNA Sequencing

Isolamento dos núcleos de adultos da medula espinhal para a sequenciação do ARN de Single-núcleo maciçamente paralelo

Probing an individual cell&#39;s gene expression enables the identification of cell type and cell state. Single-cell RNA sequencing has emerged as a ...

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing (DIVA-Seq)

Single-cell RNA Sequencing of Fluorescently Labeled Mouse Neurons Using Manual Sorting and Double In Vitro Transcription with Absolute Counts Sequencing DIVA-Seq

Sequenciação do ARN de célula única de neurônios fluorescente etiquetadas do Mouse usando a classificação Manual e duplo In Vitro a transcrição com contagens absolutas sequenciamento (DIVA-Seq)

Single-cell RNA sequencing (RNA-seq) is now a widely implemented tool for assaying gene expression. Commercially available single-cell RNA-sequencing ...