Name: quantitative pcr of t7 bacteriophage from biopanning
Uploaded: 2018-09-27T14:00:00
Description: Watch this Scientific Journal Video about Quantitative PCR of T7 Bacteriophage from Biopanning at JoVE.com

이 작품은 PhRMA 기초 연구 동기 부여에 의해 지원 되었다 고 국가 심 혼, 폐, 혈액 연구소 건강의 국가 학회의 보너스 번호 R01HL138251에서 부여 합니다.

1. 뇌관 디자인 및 T7 살 균 소 게놈 DNA에 대 한 분석
<ol><li>T7 살 균 소 게놈 DNA의 확대를 위한 뇌관 디자인. 참고: F (앞으로)와 R (반전) 뇌관 ( 재료의 표참조) T7 DNA 순서를 증폭 라이브러리 변수 영역 (그림 1) 상류에 위치.</li>
	<li>용융 온도 (Tm), 백분율 GC 내용 (GC %), 뇌관 이합체, 머리 핀 형성 및 PCR 적합성 (그림 1)를 포함 한 뇌관의 매개 ?...

<ol>
	<li>Smith, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Filamentous+fusion+phage:+novel+expression+vectors+that+display+cloned+antigens+on+the+virion+surface.">Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface.</a> Science. 228 (4705), 1315-1317 (1985).</li><li>Smith, G. P., Petrenko, V. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phage+Display.">Phage Display.</a> Chemical Reviews. 97 (96), 391-410 (1997).</li><li>Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Display+technologies:+Application+for+the+discovery+of+drug+and+gene+delivery+agents.">Display technologies: Application for the discovery of drug and gene delivery agents.</a> Advanced Drug Delivery Reviews. 58 (15), 1622-1654 (2006).</li><li>Dias-Neto, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+phage+display:+Integrating+and+comparing+available+molecular+tools+to+enable+costeffective+high-throughput+analysis.">Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis.</a> PLoS ONE. 4 (12), 1-11 (2009).</li><li>Peng, X., Nguyen, A., Ghosh, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+M13+and+T7+bacteriophages+by+TaqMan+and+SYBR+green+qPCR.">Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR.</a> Journal of Virological Methods. 252 (June 2017), 100-107 (2017).</li><li>Khan, M. S., Pande, T., Mvan de Ven, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Qualitative+and+quantitative+detection+of+T7+bacteriophages+using+paper+based+sandwich+ELISA.">Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA.</a> Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).</li><li>Brasino, M., Lee, J. H., Cha, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+highly+amplified+enzyme-linked+immunosorbent+assay+signals+from+genetically+engineered+bacteriophage.">Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage.</a> Analytical Biochemistry. 470, 7-13 (2014).</li><li>Yu, X., Burgoon, M., Shearer, A., Gilden, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+phage+peptide+interaction+with+antibody+using+phage+mediated+immuno-PCR.">Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR.</a> J immunol Methods. 326 (1-2), 33-40 (2007).</li><li>Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminm&#228;ki, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homogenous+M13+bacteriophage+quantification+assay+using+switchable+lanthanide+fluorescence+probes.">Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes.</a> BioTechniques. 53 (5), 301-303 (2012).</li><li>Schlaman, H. R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+of+signaling+proteins+with+phage-displayed+ligands+by+fluorescence+correlation+spectroscopy.">Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy.</a> Journal of Biomolecular Screening. 13 (8), 766-776 (2008).</li><li>Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+enumeration+of+phage+in+monodisperse+emulsions.">Rapid enumeration of phage in monodisperse emulsions.</a> Analytical Chemistry. 86 (12), 5642-5648 (2014).</li><li>Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+and+quantitation+of+bacteriophage+M13+using+desalting+spin+columns+and+digital+PCR.">Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR.</a> Journal of Virological Methods. 185 (1), 171-174 (2012).</li><li>. T7Select&#174; Biopanning Kit Available from: <a target="_blank" href="https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit">https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit</a> (2018)</li><li>Schneider, A., Hommel, G., Blettner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Linear+Regression+Analysis.">Linear Regression Analysis.</a> Deutsches &#196;rzteblatt international. 107 (44), 776-782 (2010).</li><li>Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+MIQE+Guidelines:+Minimun+information+for+publication+of+quantitative+real-time+PCR+experiments.">The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments.</a> Clinical Chemitry. 55 (4), 611-622 (2009).</li><li>Lock, M., Alvira, M. R., Chen, S. -. J., Wilson, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Absolute+Determination+of+Single-Stranded+and+Self-Complementary+Adeno-Associated+Viral+Vector+Genome+Titers+by+Droplet+Digital+PCR.">Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR.</a> Human Gene Therapy Methods. 25 (2), 115-125 (2014).</li><li>Fittipaldi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+of+infectious+bacteriophage+T4+virus+by+propidium+monoazide+real-time+PCR.">Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR.</a> Journal of Virological Methods. 168 (1-2), 228-232 (2010).</li><li>Lodder, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduction+of+bacteriophage+MS2+by+filtration+and+irradiation+determined+by+culture+and+quantitative+real-time+RT-PCR.">Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR.</a> Journal of Water and Health. 11 (2), 256-266 (2013).</li><li>Brown-Jaque, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+resistance+genes+in+phage+particles+isolated+from+human+feces+and+induced+from+clinical+bacterial+isolates.">Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates.</a> International Journal of Antimicrobial Agents. , (2017).</li><li>Naveca, F. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+reverse+transcription+real-time+polymerase+chain+reaction+for+simultaneous+detection+of+Mayaro,+Oropouche,+and+oropouche-like+viruses.">Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses.</a> Memorias do Instituto Oswaldo Cruz. 112 (7), 510-513 (2017).</li><li>Jia, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+detection+and+differentiation+of+human+parvovirus+B19+and+human+parvovirus+4+by+an+internally+controlled+multiplex+quantitative+real-time+PCR.">Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR.</a> Molecular and Cellular Probes. 36, 50-57 (2017).</li><li>Bliem, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+triplex+quantitative+pcr+strategy+for+quantification+of+toxigenic+and+nontoxigenic+Vibrio+cholerae+in+aquatic+environments.">A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments.</a> Applied and Environmental Microbiology. 81 (9), 3077-3085 (2015).</li><li>Wan, Z., Goddard, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Competition+Between+Conjugation+and+M13+Phage+Infection+in+Escherichia+coli+in+the+Absence+of+Selection+Pressure:+A+Kinetic+Study.">Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study.</a> G3 Genes|Genomes|Genetics. 2 (10), 1137-1144 (2012).</li></ol>

우리 살 균 소 게놈 DNA5, 계량을 정량 방법을 개발 하 고 우리가 여기 설명 T7 페이지 CF 같은 점액 장벽에 대 한 선정을 열거 하는 정량 방법을 적응. 간행물의 양적 실시간 PCR 실험 (MIQE) 지침에 대 한 최소 정보 개발 T7 페이지15의 열거에 대 한 정량 방법의 유효성을 검사 하 적응 했다. 우리는 biopanning 실험에서 페이지 척도를 개발 하는 프로토콜은 시간 효율적, ?...

살 균 소 (살 균 소) 디스플레이 기술, 1985 년, 조지 스미스에 의해 개발은 대상 또는 세포 막, 질병 항 원, 세포 세포 또는 특정 수용 체에 대 한 펩 티 드 또는 단백질 ligands를 식별 하는 강력한, 높은 처리량 접근 장기 고 지난 2 년간1,2조직. 여기, polypeptides 또는 단일 체인 항 체의 임의의 라이브러리 페이지 (일반적으로 M13 또는 T7)의 외 투 단백질에 표시 되 고 특정 ligands 고정된 단백질에 생체 외에서 또는 vivo에서 이동에서 확인할 수 있습니다. 반복 선택 과정을 통해 생물 시스템입니다. 다음, ligands 질병3,4의 진단 및 치료에 대 한 이미징 또는 치료 에이전트와 결합 될 수 있습니다. 그것은 정확 하 게 biopanning의 여러 단계 중 페이지를 열거 하는 중요 한: (1) 계량 기판에 바인딩할 페이지 (2) 하 고 선택의 각 라운드 농축 인지 확인 하려면 페이지를 계량 (살 균 소 농축 나타냅니다 biopanned 살 균 소 선호도 대상에 대 한)입니다. 정량화, 더블 레이어 패 분석 결과, 현재 금 표준에는 여러 과제가; 그것은 지루한, 성가신, 잠재적으로 많은 수의 샘플에 대 한 부정 확 한입니다. 따라서, 우리의 그룹 T7, M13 살 균 소 입자 biopanning5에서 열거 하는 민감한, 재현 하 고, 정확 하 고 효율적인 시간 정량적 중 합 효소 연쇄 반응 (정량) 방법을 개발 했습니다.
정량 Pcr T7 및 M13 페이지를 정확 하 게 계량 하는 매력적이 고 실현 가능한 방법 이다. 때문에 각 개별 살 균 소 입자 (dsDNA 또는 ssDNA) 게놈 DNA의 복사본을 하나 포함할 수 있습니다, 한 살 균 소 게놈은 한 살 균 소 입자; 살 균 소 게놈의 수를 측정, 페이지의 수를 정할 수 있다. 정량, 형광 기자 중 염료 비 특히 살 균 소 게놈 DNA 바인딩 또는 PCR 증폭, 동안 시퀀스 특정 뇌관 그리고 형광을 통해 구체적으로 신호 증폭의 각 라운드 증가. 형광 신호 그 라운드/사이클 확대의 임계값에 도달 하는 때 임계값 주기 (Ct)으로 유명 하다. 참조 살 균 소 DNA의 알려진된 농도 표준 곡선을 설정할 Ct 값에 대 한 구성 됩니다. DNA 샘플의 Ct 값으로 표준 곡선을 사용 하 여 페이지의 농도 보간됩니다 수 있습니다.
동안 수많은 전략 이전 개발 되었고 페이지 biopanning에서 척도를 광범위 하 게 사용, 그들 각각의 구체적인 과제는. 가장 인기 있는 하 고 기존의 방법은 더블 레이어 패 분석 결과입니다. 여기, 호스트 박테리아 감염 페이지 직렬 희석에 준비 된, 고체 agar 기판에 도금 및 천;와 겹쳐 페이지 수 플 라크 형성 (즉, 플 라크 형성 단위 또는 pfu) 한 천 배지에서의 열거 됩니다. 상 패 분석 결과 이며 민감한 하지만 지루한, 시간이 정확 하지 않은, 특히 많은 예제와 높은 농도5. 또한, 효소 연결 된 immunosorbent 분석 실험 (ELISA) T7, M13 살 균 소 입자6,7,8열거 적응 되었습니다. 여기, 페이지 다른 희석에 묶여있다 고 고체 기판 (즉, 한 미 판), 살 균 소 특정 항 체를 탐지 캡처하고 기자 (예를 들어, 효소 민감한 비 기판, fluorophores)를 사용 하 여 검색 현재 살 균 소 입자의 수를 결정 합니다. 샘플의 정보 (예를 들어, 형광, 흡 광도) 알려진된 농도에서 살 균 소 표준에 대 한 알 수 없는 농도 척도를 사용할 수 있습니다. 살 균 소 기반 ELISAs 개발 되었습니다 하지만 그들은 잠재적인 제한 다른. 한 그룹 개발 종이 기반 샌드위치 ELISA를 7 배나 (10-1029 pfu/mL); 부 량 범위 그러나,이 방법은 항 체 코팅의 여러 단계를 필요한 그리고8분석 결과 대 한 전체 하루에 최대 했다. 우리의 그룹 또한 M13 살 균 소 입자를 계량 하는 ELISA 방법 개발 했지만 10의 덜 민감한 감지 범위6  1011 pfu/mL5. M13 열거 하 전환 란타넘족 형광 프로브를 개발 하 고 20 분; 내 부 량 데이터를 얻을 수 있습니다. 그러나,이 분석 결과 10의 좁은 동적 범위 1012 pfu/mL99 . 한 그룹 솔루션, M13 살 균 소 입자를 열거할 원자 힘 현미경 검사 법을 사용 하지만이 고급 전자 현미경 필요 농도10의 좁은 범위 내에서 일했다. 또 다른 연구 형광 M13 및 T4 기자 페이지를 트랩 및 형광 방울; 수로 페이지를 단 분산 유화 제 사용 그러나,이 접근은 또한 10에서 좁은 부 량 범위 전시 106 pfu/mL112 . 드롭릿 디지털 PCR M13 페이지를 계량 하는 데 사용 되었습니다, 동안이 접근은 전염 성 및 비 전염 성 살 균 소 입자12의 번호를 수 없습니다.
우리의 그룹 최근 정량 방법을 열거 하는 두 개의 서로 다른 형광 기자 염료5를 사용 하 여 혈액-뇌 장벽 세포 모델에 대 한 biopanning에서 식별 T7 및 M13 페이지를 개발 했습니다. 상기 정량화 방법에 비해 정량 방법 개발 되었고 높은 처리량 및 수많은 샘플을 계량 시간 효율적인 DNase와 전염 성 및 비 전염 성 페이지 구분 나 전처리의 수는 살 균 소 샘플입니다. 중요 한 것은,이 이렇게 수 reproducibly 고 정확 하 게 계량 M13 및 T7 biopanning 샘플에서 살 균 소. 살 균 소 정량의 지역에 있는 연구원은 초보자 안내, 여기 우리가 T7 살 균 소 입자 시스테인 제한 된 라이브러리 (CX7C)에서 한 체 외에 낭 성 섬유 증 (CF) 점액 장벽에 대 한 패닝 열거 하는 상세한 정량 방법을 설명 합니다. 이 작품에서 정량 방법 살 균 소 입자와 물, 토양, 및 체액을 포함 하 여 다른 소스에서 biopanning의 다른 종류에서 계량을 확장할 수 있습니다.

<table>
	<tbody>
		<tr>
			<td>Materials and reagents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primers for T7 genomic DNA</td>
			<td>IDT</td>
			<td></td>
			<td>F: CCTCTTGGGAGGAAGAGATTTG 
			R: TACGGGTCTCGTAGGACTTAAT</td>
		</tr>
		<tr>
			<td>T7Select packaging control DNA</td>
			<td>EMD Millipore</td>
			<td>69679-1UG</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp optical 96-well reaction plate</td>
			<td>ThermoFisher Scientific</td>
			<td>N8010560</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR master mix--Power up SYBR Green master mix</td>
			<td>Applied biosystems</td>
			<td>A25742</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp optical adhesive film kit</td>
			<td>ThermoFisher Scientific</td>
			<td>4313663</td>
			<td></td>
		</tr>
		<tr>
			<td>T7Select 415-1 Cloning Kit</td>
			<td>EMD Millipore</td>
			<td>70015</td>
			<td>User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP</td>
		</tr>
		<tr>
			<td>DNase I solution</td>
			<td>ThermoFisher Scientific</td>
			<td>90083</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well transwell plate</td>
			<td>Corning</td>
			<td>3472</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure DNase/RNase-Free Distilled H2O</td>
			<td>Invitrogen</td>
			<td>10977015</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (1X)</td>
			<td>Corning</td>
			<td>21040CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Equipments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ViiA7 Real-Time PCR System with Fast 96-Well Block</td>
			<td>ThermoFisher Scientific</td>
			<td>4453535</td>
			<td></td>
		</tr>
		<tr>
			<td>Heraeus Pico 21 Microcentrifuge</td>
			<td>ThermoFisher Scientific</td>
			<td>75002415</td>
			<td></td>
		</tr>
		<tr>
			<td>Fisherbrand Digital Vortex Mixer</td>
			<td>Fisher Scientific</td>
			<td>02-215-370</td>
			<td></td>
		</tr>
		<tr>
			<td>HERMO SCIENTIFIC Multi-Blok Heater</td>
			<td>ThermoFisher Scientific</td>
			<td>Model:2001</td>
			<td></td>
		</tr>
		<tr>
			<td>Sorvall Legend X1 Centrifuge</td>
			<td>ThermoFisher Scientific</td>
			<td>75004220</td>
			<td></td>
		</tr>
		<tr>
			<td>M-20 Microplate Swinging Bucket Rotor</td>
			<td>ThermoFisher Scientific</td>
			<td>75003624</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Software</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio Real-time PCR software</td>
			<td>ThermoFisher Scientific</td>
			<td></td>
			<td>v1.2</td>
		</tr>
		<tr>
			<td>Real-time qPCR primer design</td>
			<td>IDT</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>OligoAnalyzer 3.1</td>
			<td>IDT</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

quantitative pcr of t7 bacteriophage from biopanning

이 프로토콜 T7 페이지 페이지 선택 실험 (즉, "biopanning")에서 열거 하 양이 많은 PCR (정량)의 사용을 설명 합니다. 정량은 DNA, 계량에 형광 기반의 접근 그리고 여기, 살 균 소 게놈 살 균 소 입자에 대 한 프록시로 계량에 적응. 이 프로토콜에서 추가적인 DNA 정화 없이 높은 온도 난방을 사용 하 여 손쉬운 살 균 소 DNA 준비 방법을 설명 합니다. 메서드를 사용 하면 열 처리 페이지의 작은 볼륨 및 정량 반응의 작은 볼륨에만 필요합니다. 정량은 높은 처리량 및 빠르고, 처리 하 고 다른 페이지 열거 방법에 2-4 헤 비교에에서 반응의 96 잘 접시에서 데이터를 가져올 수, 정량 시간 효율적입니다. 여기, 정량은 낭 성 섬유 증 같은 점액 모델 생체 외에서 biopanning에서 식별 T7 페이지를 열거 하는 데 사용 됩니다. 정량 방법 척도 biopanning의 다른 종류를 포함 하 여 다른 실험에서 T7 페이지를 확장할 수 있습니다 (예., 단백질 바인딩, vivo에서 움직일 수 살 균 소 심사) 및 기타 소스 (예: 시스템 또는 체액). 요약 하자면,이 프로토콜 DNA 캡슐화 바이러스 척도를 수정할 수 있습니다.

정량 Pcr 뇌관 디자인 다른 뇌관 디자인 도구를 사용할 수 있습니다. 일반적으로, 뇌관 디자인 프로그램은 그들의 자신의 내장 알고리즘을 계산 하 고 뇌관, 예를 들어, GC %, Tm, 뇌관 이합체 또는 머리 핀 형성 등 의 중요 매개 변수 일반적으로, 주요 기준은 다른 유사 뇌관 설계 도구, 및 뇌관 그들의 지침에 따라 설계할 수 있습니다. 뇌관 폭발 뇌관의 특이성을 ...

Watch this Scientific Journal Video about Quantitative PCR of T7 Bacteriophage from Biopanning at JoVE.com

Quantitative PCR of T7 Bacteriophage from Biopanning

Biopanning에서 t 7 살 균 소의 양이 많은 PCR

재현, 정확 하 고 시간이 효율적인 정량 PCR (정량) 방법 살 균 소 T7 열거 하는 여기에 설명 되어 있습니다. 프로토콜에는 살 균 소 게놈 DNA 준비, PCR 반응 준비, 정량 자전거 조건, 및 정량 데이터 분석 명확 하 게 설명합니다.

This protocol describes the use of quantitative PCR (qPCR) to enumerate T7 phages from phage selection experiments (i.e., &#34;biopanning&#34;). qPCR is a ...

이 방법은 복잡한 견본 및 박테리오파지 기지를 둔 진단 및 치료에서 박테리오파지의 열거와 관련있는 바이러스학 및 미생물학 필드에 있는 중요한 문제점을 대답하는 것을 도울 수 있었습니다. 이 기술의 주요 장점은 파지 디스플레이 바이오패닝 실험에서 많은 수의 샘플을 시간 효율적이고 정확한 정량화를 가능하게 한다는 것입니다. 절차를 시연하는 것은 라시미 모한티와 제 실험실대학원생 인 Jasmim Leal이 될 것입니다.프라이머를 설계하고 재고 농도를 생성한 후, 마이크로리터 당 0.1 마이크로그램의 농도로 참조 T7 파지 DNA를 얻을 수 있습니다. 초순수수를 사용하여 마이크로리터 당 100만 펨토그램에서 0.2 밀리리터 PCR 튜브의 마이크로리터 당 1펨토그램에 이르는 이 DNA를 10배 연속 희석시킵니다. 각 농도의 20 마이크로리터를 준비하여 파이펫 팁을 변경하고 희석의 각 단계 사이에 튜브를 소용돌이치게 하십시오.그런 다음 마이크로리터 당 펨토그램에서 마이크로리터 당 게놈 사본으로 T7 파지 참조 DNA 농도를 변환합니다. 첫째, 시료 T7 파지 클론의 파이펫 200 마이크로리터는 원하는 10개의 샘플 각각에 대해 1.5 밀리리터 마이크로 원심분리기 튜브로 복제한다. 각 튜브에 DNase 의 마이크로리터 2개를 추가합니다.튜브를 캡하고 가열 된 건조 목욕에서 10 분 동안 섭씨 37도에서 배양하십시오. 그런 다음 가열 된 건조 목욕에서 15 분 동안 섭씨 100도에서 배양하십시오. 10초 동안 18, 534배 g에서 열 처리 파지를 함유한 튜브원심분리기.원심 분리튜브를 터치 활성화 모드로 설정된 소용돌이 믹서에 10초 동안 놓아 파지를 섞습니다. 10초 동안 18, 534회 g로 다시 회전합니다. 그 후, 실온으로 냉각하기 위해 실험실 벤치에 샘플을 약 1 시간 남겨 둡니다.qPCR 프리믹스를 알 수 없는 농도의 10개의 바이오팬드 파지 샘플과 트리플리케이트의 표준 농도 7개 시료에 대해 준비한다. qPCR 마스터 믹스 255마이크로리터, 프라이머 51마이크로리터 및 102마이크로리터의 물을 포함하는 51개의 샘플에 대한 프리믹스가 생성되었습니다. 준비된 PCR의 8마이크로리터를 96웰 qPCR 플레이트의 51개의 웰에 혼합합니다.다음으로 각 우물에 열 처리 된 T7 파지 샘플 2 개를 추가하여 qPCR 프리믹스의 표면 아래에 분배합니다. 접착제 필름을 사용하여 접시를 밀봉하십시오. 알루미늄 호일에 플레이트를 감싸서 형광 사진 표백을 최소화한 다음 qPCR 장비에서 플레이트를 실행합니다.텍스트 프로토콜에 설명된 대로 사이클링 조건을 설정하고 곡선 설정을 녹입니다. qPCR을 실행하면 증폭 플롯, 용융 곡선 플롯 및 다중 구성 요소 플롯을 원시 데이터에서 분석합니다. 증폭 플롯은 각 샘플의 PCR 증폭이 성공여부를 나타냅니다.다성분 플롯은 증폭 주기 전반에 걸쳐 형광 신호의 증폭 및 붕괴를 나타낸다. 용융 곡선 플롯은 프라이머의 특이성을 검증하는 데 사용되지만 각 PCR 제품에는 고유한 용융 온도가 하나 있기 때문에. 표준 곡선은 참조 DNA에서 생성됩니다.여기서 증폭 효율은 qPCR 연구에서 92.4%의 대표적인 데이터로 계산된 다음 마이크로리터당 10~1,000만 개의 게놈 사본의 테스트 범위에서 이중 층 플라크 분석에 의해 정량화된 동일한 파지에 비교된다. 여기에서 볼 수 있듯이 qPCR 수량의 파지 수는 플라크 분석보다 높습니다. 분산계수에 의해 표현되는 qPCR 방법의 반복성은 이 절차를 시도하는 동안 2.85에서 27.2%에 이르는 값을 갖는 것으로 보이며, 큐PCR의 개발 및 사용에 대한 많은 고려 사항이 있다는 것을 기억하는 것이 중요하며, 신중한 처리 및 시료 준비 및 관련 장비의 교정을 포함하여 파지를 정확하게 정량화하는 것이 중요합니다.이 방법에 따라, 다른 기술은 복잡한 환경 샘플에서 생체 생체 파닝, 파지 라이브러리 DNA 제제 및 차세대 염기 검출에 포함된 다양한 응용 분야에서 파지 입자를 열거하기 위해 수행될 수 있다. 파지는 실험실에서 생물학적 위험으로 간주되며 장갑과 실험실 코트를 포함한 개인 보호 장비와 같은 예방 조치는 절차를 수행하는 동안 항상 착용해야합니다.

Research

JoVE Journal

Immunology and Infection

Quantitative Imaging of Lineage-specific Toll-like Receptor-mediated Signaling in Monocytes and Dendritic Cells from Small Samples of Human Blood

Monocytes과 인간 혈액의 작은 샘플에서 돌기 세포의 리니지 특정 수신자 같은 수용체 - 매개 시그널링의 정량 이미징

Individual variations in immune status determine responses to infection and contribute to disease severity and outcome.  Aging is associated with an ...

연구

면역학 및 감염병학

High-throughput Quantitative Real-time RT-PCR Assay for Determining Expression Profiles of Types I and III Interferon Subtypes

높은 처리량 정량 실시간 RT-PCR 분석 유형 I과 III 인터페론 하위 유형의 발현 양상을 결정하는

Described in this report is a qRT-PCR assay for the analysis of seventeen human IFN subtypes in a 384-well plate format that incorporates highly specific ...

Development and Validation of a Quantitative PCR Method for Equid Herpesvirus-2 Diagnostics in Respiratory Fluids

호흡기 유체의 Equid 헤르페스 바이러스-2 진단에 대한 정량적 PCR 방법의 개발 및 검증

The protocol describes a quantitative RT-PCR method for the detection and quantification of EHV-2 in equine respiratory fluids according to the NF U47-600 ...

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR (RS-PCR)

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR RS-PCR

의 유전자형<em&gt; 황색 포도상 구균</em&gt;에 의해 리보솜 스페이서 PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, ...

High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR

나노 PCR에 의한 동물 표본의 호흡기 병원체의 높은 처리량 검출

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of ...

Optimization of a Quantitative Micro-neutralization Assay

정량적 마이크로 중화 분석의 최적화

The micro-neutralization (MN) assay is a standard technique for measuring the infectivity of the influenza virus and the inhibition of virus replication. ...

Isolation and Quantitative Evaluation of Brush Cells from Mouse Tracheas

마우스 기관에서 브러시 셀의 격리 및 정량 평가

Tracheal brush cells are cholinergic chemosensory epithelial cells poised to transmit signals from the airway lumen to the immune and nervous systems. ...

Pan-lyssavirus Real Time RT-PCR for Rabies Diagnosis

광견병 진단을 위한 팬-리사바이러스 실시간 RT-PCR

Molecular assays are rapid, sensitive and specific, and have become central to diagnosing rabies. PCR based assays have been utilized for decades to ...

Determination of Immune Cell Identity and Purity Using Epigenetic-Based Quantitative PCR

후성유전학 기반 정량적 PCR을 이용한 면역 세포 정체성 및 순도 측정

Immune cell subtype population frequencies can have a large effect on the efficacy of T cell therapies. Current methods, like flow cytometry, have ...

Localization and Quantification of Begomoviruses in Whitefly Tissues by Immunofluorescence and Quantitative PCR

면역형광 및 정량적 PCR에 의한 화이트플라이 조직에서 베고모바이러스의 국소화 및 정량화

Begomoviruses (genus Begomovirus, family Geminiviridae) are transmitted by whiteflies of the Bemisia tabaci complex in a persistent, circulative manner. ...