Name: a purification and in vitro activity assay for a (p)ppgpp synthetase from clostridium difficile
Uploaded: 2018-11-03T15:00:00
Description: Watch this Scientific Journal Video about A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile at JoVE.com

עבודה זו מומן על ידי NIAID 1K22AI118929-01. EBP נתמך על ידי מענק תוכנית הקיץ מלגת מחקר של משרד של המחקר באוניברסיטת דומיניון הישן, נורפולק, וירג'יניה, ארה ב.

1. inducible ביטוי של חלבון מתויג היסטידין
<ol><li>להגביר rsh מ ג difficile הדנ א R20291.<ol>
<li>השתמש פולימראז אמינות גבוהה ופעל לפי הוראות היצרן.</li>
		<li>להגביר difficile ג rsh באמצעות תחל rsh_F (CAGGTACCGGTTATATGCATGATAAAGAATTACAAG), rsh_R (CCCTGCAGCTAATGGTGATGGTGATGGTGATTTGTCATTCTATAAATAC), אשר מציגה תג hexahistidine C-טרמינל. הע?...

<ol>
	<li>Cheek, S., Ginalski, K., Zhang, H., Grishin, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+update+of+the+sequence+and+structure+classification+of+kinases.">A comprehensive update of the sequence and structure classification of kinases.</a> BMC Structural Biology. 5 (1), 6 (2005).</li><li>Porath, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilized+metal+ion+affinity+chromatography.">Immobilized metal ion affinity chromatography.</a> Protein Expression and Purification. 3 (4), 263-281 (1992).</li><li>Arnau, J., Lauritzen, C., Pedersen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+strategy,+production+and+purification+of+proteins+with+exopeptidase-cleavable+His-tags.">Cloning strategy, production and purification of proteins with exopeptidase-cleavable His-tags.</a> Nature Protocols. 1 (5), 2326-2333 (2006).</li><li>Porath, J., Carlsson, J., Olsson, I., Belfrage, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metal+chelate+affinity+chromatography,+a+new+approach+to+protein+fractionation.">Metal chelate affinity chromatography, a new approach to protein fractionation.</a> Nature. 258 (5536), 598-599 (1975).</li><li>Smith, M. C., Furman, T. C., Ingolia, T. D., Pidgeon, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chelating+peptide-immobilized+metal+ion+affinity+chromatography.+A+new+concept+in+affinity+chromatography+for+recombinant+proteins.">Chelating peptide-immobilized metal ion affinity chromatography. A new concept in affinity chromatography for recombinant proteins.</a> Journal of Biological Chemistry. 263 (15), 7211-7215 (1988).</li><li>Graslund, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+purification.">Protein production and purification.</a> Nature Methods. 5 (2), 135-146 (2008).</li><li>Booth, W. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+an+N-terminal+Polyhistidine+Tag+on+Protein+Thermal+Stability.">Impact of an N-terminal Polyhistidine Tag on Protein Thermal Stability.</a> ACS Omega. 3 (1), 760-768 (2018).</li><li>Thielges, M. C., Chung, J. K., Axup, J. Y., Fayer, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+histidine+tag+attachment+on+picosecond+protein+dynamics.">Influence of histidine tag attachment on picosecond protein dynamics.</a> Biochemistry. 50 (25), 5799-5805 (2011).</li><li>Chaga, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty-five+years+of+immobilized+metal+ion+affinity+chromatography:+past,+present+and+future.">Twenty-five years of immobilized metal ion affinity chromatography: past, present and future.</a> Journal of Biochemical and Biophysical Methods. 49 (1-3), 313-334 (2001).</li><li>Ma, H., Deacon, S., Horiuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+challenge+of+selecting+protein+kinase+assays+for+lead+discovery+optimization.">The challenge of selecting protein kinase assays for lead discovery optimization.</a> Expert opinion on drug discovery. 3 (6), 607-621 (2008).</li><li>Tamayo, R., Tischler, A. D., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+EAL+domain+protein+VieA+is+a+cyclic+diguanylate+phosphodiesterase.">The EAL domain protein VieA is a cyclic diguanylate phosphodiesterase.</a> Journal of Biological Chemistry. 280 (39), 33324-33330 (2005).</li><li>Purcell, E. B., McKee, R. W., McBride, S. M., Waters, C. M., Tamayo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+Diguanylate+Inversely+Regulates+Motility+and+Aggregation+in+Clostridium+difficile.">Cyclic Diguanylate Inversely Regulates Motility and Aggregation in Clostridium difficile.</a> Journal of Bacteriology. 194 (13), 3307-3316 (2012).</li><li>Purcell, E. B., Tamayo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+cyclic+nucleotide+phosphodiesterases.">Identification and characterization of cyclic nucleotide phosphodiesterases.</a> Methods in Molecular Biology. 1016, 235-243 (2013).</li><li>Ross, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+cellulose+synthesis+Acetobacter+xylinum.+A+unique+guanyl+oligonucleotide+is+the+immediate+activator+of+the+cellulose+synthase.">Control of cellulose synthesis Acetobacter xylinum. A unique guanyl oligonucleotide is the immediate activator of the cellulose synthase.</a> Carbohydrate Research. 149 (1), 101-117 (1986).</li><li>Potrykus, K., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=(p)ppGpp:+still+magical?.">(p)ppGpp: still magical?.</a> Annual Review of Microbiology. 62, 35-51 (2008).</li><li>Boutte, C. C., Crosson, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+lifestyle+shapes+stringent+response+activation.">Bacterial lifestyle shapes stringent response activation.</a> Trends in Microbiology. 21 (4), 174-180 (2013).</li><li>Nanamiya, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+functional+analysis+of+novel+(p)ppGpp+synthetase+genes+in+Bacillus+subtilis.">Identification and functional analysis of novel (p)ppGpp synthetase genes in Bacillus subtilis.</a> Molecular Microbiology. 67 (2), 291-304 (2008).</li><li>Gaca, A. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basal+Levels+of+(p)ppGpp+in+Enterococcus+faecalis:+the+Magic+beyond+the+Stringent+Response.">Basal Levels of (p)ppGpp in Enterococcus faecalis: the Magic beyond the Stringent Response.</a> mBio. 4 (5), (2013).</li><li>Sebaihia, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multidrug-resistant+human+pathogen+Clostridium+difficile+has+a+highly+mobile,+mosaic+genome.">The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome.</a> Nature Genetics. 38 (7), 779-786 (2006).</li><li>Gasteiger, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ExPASy:+The+proteomics+server+for+in-depth+protein+knowledge+and+analysis.">ExPASy: The proteomics server for in-depth protein knowledge and analysis.</a> Nucleic Acids Research. 31 (13), 3784-3788 (2003).</li><li>Purcell, E. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nutrient-regulated+cyclic+diguanylate+phosphodiesterase+controls+Clostridium+difficile+biofilm+and+toxin+production+during+stationary+phase.">A nutrient-regulated cyclic diguanylate phosphodiesterase controls Clostridium difficile biofilm and toxin production during stationary phase.</a> Infection and Immunity. , (2017).</li><li>Mechold, U., Murphy, H., Brown, L., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intramolecular+Regulation+of+the+Opposing+(p)ppGpp+Catalytic+Activities+of+RelSeq,+the+Rel/Spo+Enzyme+from+Streptococcus+equisimilis.">Intramolecular Regulation of the Opposing (p)ppGpp Catalytic Activities of RelSeq, the Rel/Spo Enzyme from Streptococcus equisimilis.</a> Journal of Bacteriology. 184 (11), 2878-2888 (2002).</li><li>Dalebroux, Z. D., Svensson, S. L., Gaynor, E. C., Swanson, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ppGpp+Conjures+Bacterial+Virulence.">ppGpp Conjures Bacterial Virulence.</a> Microbiology and Molecular Biology Reviews. 74 (2), 171-199 (2010).</li><li>Bartlett, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clostridium+difficile:+progress+and+challenges.">Clostridium difficile: progress and challenges.</a> Annals of the New York Academy of Sciences. 1213, 62-69 (2010).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> US Department of Health and Human Services. , (2013).</li></ol>

כאן אנחנו מדווחים הטיהור של שלו מתויג RSH מ ג difficile ולהציג שיטה על כימות פעילות באמצעות כרומטוגרפיה radiolabeled שכבה דקה. בעבר נעשה שימוש בשיטה זו כדי להעריך את הפעילות של אנזימים cyclase diguanylate ג difficile, כמו גם המעביר ppGpp (p), נוקלאוטיד cyclase, קינאז ואנזימים phosphodiesterase של האורגניזמים האחרים<sup class=...

אנזימים קינאז, pyrophosphokinase (או diphospho-קינאז) להעביר פוספטים מבשרי טריפוספט (NTP) נוקלאוטיד המצע מולקולות. מצעים באפשרותך לכלול אחרים נוקלאוטידים, חומצות אמינו או חלבונים, פחמימות, שומנים1. ניתוחים Bioinformatic יכול לפעמים לחזות המצע cognate של אנזים או מצעים על סמך הדמיון כדי אנזימים מאופיין, אך אימות ניסיוני עדיין נחוץ. באופן דומה, בזיקה של אנזים substrate(s) שלו ואת הקצב שבו זה מזרז את התגובה פוספור-העברה, ואת ההשפעות של גורמים שותפים, מעכבי, או effectors אנזימים אחרים. להיקבע השפעול. כדי למנוע דלדול של מבשר ATP על ידי אחרים הצורכים ATP אנזימים המצויים הציטופלסמה חיידקי, פעילות כמותיים מבחני דורשים חלבון מטוהרים.
חלבון טיהור באמצעות כרומטוגרפיית זיקה מתכת כבר מכוסה באופן יסודי של ספרות2,3. תגיות היסטידין בהיקף של שישה שאריות היסטידין רצופים מצורף ל N - או C-הסופית של חלבון רקומביננטי מאפשרות טיהור מהירה זיקה מתכת כרומטוגרפיה4,5,6. רצפים אלה הם קטנים לעומת החלבונים הם לשנות, בדרך כלל יש השפעה מינימלית על פונקציה של חלבונים, למרות שהם יכולים לפעמים לשנות יציבות החלבון ו/או אנזים קינטיקה7,8. היסטידין תגים ב- N -, C-טרמיני של החלבון אותו יכול לקבל אפקטים שונים, אשר קשה לחזות מבלי להכיר את המבנה של החלבון המדובר. תגיות היסטידין משולבים בדרך כלל במהלך שכפול של חלבון רקומביננטי על-ידי עיצוב תחל זה לקודד את שאריות היסטידין 6, גם מיד 3' כדי codon התחלה ATG או מיידית 5' ל stop codon של מסגרת קריאה פתוחה. לאחר הגברה, הגן המכיל hexahistidine מאתרים לתוך וקטור תחת השליטה של יזם inducible, ביטוי, בדרך כלל זן מעבדה של e. coli. אז יכול להיות מבודדת החלבון רקומבינציה על שרף זיקה המכיל קיבוע קטיונים דו ערכיים (בדרך כלל ניקל או קובלט)9. ניתן להסיר מזהמות יליד המתכת מחייב חלבונים על ידי טיטור עם imidazole, אשר והשמה מזיחה חלבון מאוגד2. בסופו של דבר, חלבון המטרה הוא eluted מן העמודה עם ריכוז גבוה של imidazole. ישנם כמה מקורות מסחריים עבור קיבוע הקטיון מתכת שרפים, היצרנים לספק המלצות כדי להפוך את מאגר תנאים imidazole ריכוזים. לאחר • תנאי, חלבון יכול להיות נותחו על ידי נתרן dodecyl סולפט-לזיהוי בג'ל (מרחביות-עמוד), דיאליזה או מיד בשימוש מבחני פונקציונלי.
ישנן מספר שיטות לפיקוח פעילות קינאז בעקיפין על ידי צימוד הידרוליזה בונד פוספט ATP ריאקציה השנייה משחררת או מרגש fluorophore או יוצרת chemiluminescence, אבל תגובות אלו חלקים מרובים, ניתן יהיה לוגיסטית מאתגר10. הדרך הברור ביותר למדוד באופן ספציפי פוספור-העברת פעילות היא לפקח באופן ישיר ההעברה של קבוצת פוספט radiolabeled וγ זמינים מסחרית -32-P NTP קודמן המצע radiolabeled11 , 12 , 13. תערובות של סובסטרטים radiolabeled ומוצרים יכולים להיות מופרדים ו לכמת על ידי שכבה דקה כרומטוגרפיה (TLC). TLC מנצל את הניידות דיפרנציאלית של מומסים בגבול הממס נתון על-ידי מתן הממס (שלב נוזלי) להעביר על ידי נימיות על פני משטח (מעבדתי) שעליו היה תערובת של מומסים בגבול הספוחה14. מומסים בגבול קטנים ו/או חוסר אינטראקציה חיובית עם השלב מוצק נודדים למרחקים ארוכים ממיקומם הראשוני יותר מומסים בגבול עם משקל מולקולרי גבוה יותר או הזיקות נהדר עבור המוצק. בחינת פוספור-העברה, פוספט moieties להגדיל את המשקל המולקולרי של מולקולות הם מתווספים ולהוסיף מטען יוניים שלילי ב- pH נייטרלי או חומצי11,12,14. זה מקטין את הניידות שלהם על משטח בסיסיים כגון פיי-תאית. כשאתה פותח חומצי אשלגן פוספט מאגר, תערובות של מונו-, די-, tri-, טטרה- ו pentaphosphate מינים ניתן להפריד בקלות על פיי-תאית, המאפשר כימות של כל מין (איור 2, איור 3). מבחני כזה יכול להתבצע באמצעות lysates תאים המכילים את האנזים עניין, אבל זה כולל את פוטנציאל הפעילות של kinases אחרים, phosphatases ATPases כללי כדי לרוקן את המצע ו/או המוצר. עבור כמותיים במבחנה הערכה של פעילות אנזים, יש צורך לטהר את האנזים עניין.
Guanosine tetraphosphate (ppGpp) guanosine pentaphosphate (pppGpp) הם ribonucleotide איתות מולקולות נוצר על ידי העברת רב-תכליתי קבוצה של קודמן אדנוזין טריפוספט (ATP), בהתאמה, של diphosphate guanosine (תמ ג) או guanosine tetraphosphate (GTP) המצע15. אותות אלה ribonucleotide יחיד, המכונה באופן קולקטיבי (p) ppGpp, מתווכים ברמת התא בתגובה עקה המכונה תגובת מחמירים ב15,מגוונת מיני החיידקים16. שתי מחלקות ההכפלה של אנזימים לעודד היווצרות של15,ppGpp (p)17 Rel/Spo אנזימים homolog (RSH) הם 'זמן' bifunctional (p) ppGpp המעביר/hydrolases בשם שלהם דמיון רלה, ספוט (p) ppGpp מטבולית אנזימים של Escherichia coli אשר מכילים המעביר ההידרולז, תחומי הרגולציה, בעוד alarmone קטן המעביר (SAS) אנזימים synthetases monofunctional קצר נמצאו אך ורק גראם חיידקים חיוביים15, 17 , 18. יוצרי נבג גראם חיוביים החיידק Clostridium difficile מקודד בשם RSH ו- SAS הגנים19. כאן, אנו מציגים פעילות ראשונית מבחני לאשר כי האנזים RSH difficile ג הוא המעביר ppGpp catalytically פעיל (p).

<table>
	<tbody>
		<tr>
			<td>Inducible overexpression of a histidine-tagged protein</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Phusion polymerase</td>
			<td>New England Biolabs (NEB)</td>
			<td>M0530L</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAEX II DNA Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>20021</td>
			<td></td>
		</tr>
		<tr>
			<td>KpnI restriction enzyme</td>
			<td>NEB</td>
			<td>R0142S</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI restriction enzyme</td>
			<td>NEB</td>
			<td>R0140S</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>NEB</td>
			<td>M0202</td>
			<td></td>
		</tr>
		<tr>
			<td>NEB&#174; 5-alpha Competent&#160;E. coli&#160;(High Efficiency)</td>
			<td>NEB</td>
			<td>C2987I</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 (DE3) Competent E. coli</td>
			<td>NEB</td>
			<td>C2527I</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Sigma-Aldrich</td>
			<td>10724815001</td>
			<td></td>
		</tr>
		<tr>
			<td>JXN-26 centrifuge with JLA 10.500 rotor</td>
			<td>Beckman Coulter Avanti</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge with D3024/D3024R rotor</td>
			<td>Scilogex</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>MaxQ SHKE6000 Incubator</td>
			<td>Thermo Scientific</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultrasonic processor</td>
			<td>Sonics</td>
			<td>VC-750</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein purification by nickel affinity chromatography</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA resin</td>
			<td>G Biosciences</td>
			<td>786-940/941</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce Disposable Gravity columns, 10 mL</td>
			<td>Thermo Scientific</td>
			<td>29924</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mL Spectra/ Por float-A-lyzer G2 dialysis device (MWCO: 20-kD)</td>
			<td>Spectrum</td>
			<td>G235033</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Electrophoresis Cell</td>
			<td>BioRad</td>
			<td>1658004</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein activity assay by thin layer chromatography</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Thin layer chromatograph (TLC) development tank</td>
			<td>General Glass Blowing Company</td>
			<td>80-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine (PEI)-cellulose plates (20 cm x 20 cm, 100 um thickness) with polyester support</td>
			<td>Sigma-Aldrich</td>
			<td>Z122882-25EA</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP, [&#947;-32P]- 3000 Ci/mmol 10mCi/ml lead, 100 &#956;Ci</td>
			<td>Perkin Elmer</td>
			<td>NEG002A</td>
			<td></td>
		</tr>
		<tr>
			<td>Adenosine 5&#8217;-triphosphate (ATP) 100 mM</td>
			<td>Bio Basic Canada</td>
			<td>AB0311</td>
			<td></td>
		</tr>
		<tr>
			<td>Guanosine-5&#8217;-diphosphate disodium salt (GDP)</td>
			<td>Alfa Aesar</td>
			<td>AAJ61646MC/E</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage phosphor screen</td>
			<td>GE Healthcare Life Sciences</td>
			<td>BAS-IP TR 2040 E Tritium Screen</td>
			<td></td>
		</tr>
		<tr>
			<td>Storm 860 phosphorimager</td>
			<td>GE Healthcare Life Sciences</td>
			<td>-</td>
			<td></td>
		</tr>
	</tbody>
</table>

a purification and in vitro activity assay for a (p)ppgpp synthetase from clostridium difficile

אנזימים קינאז, pyrophosphokinase העברה של פוספט גמא או את moiety רב-תכליתי בטא-גמא של נוקלאוטיד טריפוספט מבשרי סובסטרטים ליצירת מוצרים phosphorylated. השימוש של γ -32- P שכותרתו NTP מבשרי מאפשר פיקוח סימולטני של ניצול המצע היווצרות המוצר על-ידי רדיוגרפיה. שכבה דקה כרומטוגרפיה (TLC) על צלחות תאית מאפשרת כימות רגיש של המצע והמוצר והגליונות מהירה. אנו מציגים שיטה ניצול של כרומטוגרפיה דק-שכבה כדי assay לפעילות pyrophosphokinase המעביר ppGpp מטוהרים (p). שיטה זו כבר בעבר בשימוש כדי לאפיין את פעילות מחזורית synthetases נוקלאוטיד, dinucleotide ומתאים בהרחבה אפיון הפעילות של כל אנזים הידרוליזה ערבות טריפוספט נוקלאוטיד או מעביר מסוף פוספט מתורם פוספט כדי מולקולה נוספת.

אנו מציגים שיטה ולטיהור זיקה המעביר ppGpp (p) Clostridium difficile , את ההערכה של פעילותה אנזימטיות. איור 1 מדגים את טיהור חלבון מושגת על ידי כרומטוגרפיית זיקה מתכת. השבר השני • תנאי (E2) מטיהור זה היה דיאליזה, המשמש את assay אנזימטי פעילות. איור 2 מפרט א...

Watch this Scientific Journal Video about A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile at JoVE.com

A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile

כאן, אנו מתארים שיטה לטיהור מתויג היסטידין pyrophosphokinase אנזימים וניצול כרומטוגרפיה שכבה דקה של סובסטרטים radiolabelled ומוצרים כדי assay עבור פעילות אנזימטי בתוך חוץ גופית. וזמינותו פעילות האנזים ישימה בהרחבה על כל קינאז, נוקלאוטיד cyclase או התגובה פוספור-העברת מנגנון אשר כולל נוקלאוטיד טריפוספט הידרוליזה.

ב חוץ גופית Assay פעילות עבור ppGpp (p) המעביר מ Clostridium difficile וטיהור

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to ...

שיטה זו יכולה לעזור לענות על שאלות מפתח על אנזימי phosphotransfer כולל ספציפיות מצע אנזים קינטיקה תגובה. היתרון העיקרי של טכניקה זו הוא שהיא מאפשרת איסוף מהיר של ערכות נתונים מרובות כי הם עקביים מאוד, המאפשר כימות חזק סטטיסטית של פעילות האנזים. הדגמה חזותית של שיטה זו היא קריטית כי איתור התגובות על לוחות TLC וכימות המינים הרדיואקטיביים בתגובות קל הרבה יותר להדגים מאשר להסביר.בנוסף לאתה, הדגימה של ההליך תהיה אסיה פודל, סטודנטית נוספת לתואר שני מהמעבדה שלי. התחל פרוטוקול זה עם דיכוי יתר בלתי ניתן לעיכול של חלבון מתויג היסטידין כמתואר בפרוטוקול הטקסט. הכן מיליליטר אחד של שף חומצה ניטילואצטית ניקל בעמודת כבידה כדי לטהר את החלבון.יום לפני השימוש, לצייד את העמודה לילה בארבע מעלות צלזיוס עם שני מיליליטר של חיץ שיווי משקל. למחרת להביא את הטור מארבע מעלות צלזיוס לטמפרטורת החדר לפני טעינת lysate הבהיר ולתת לו לעמוד במשך כשעתיים עד שלוש שעות. לאחר מכן תן שוב את גלולת החיץ במאגר התיזה.Sonicate התאים על קרח במשך 10 פעמים 10 שניות מרווחים, השהיה 30 שניות בין פולסים. להבהיר את lysate על ידי צנטריפוגה ב 3, 080 פעמים גרם במשך 30 דקות בארבע מעלות צלזיוס באמצעות מיקרוצנטריפוגה. הכן את lysate הבהיר עם כמויות שוות של מאגר תיזה, ולאחר מכן להחיל את lysate מוכן, הבהיר על העמודה ולאסוף את הזרימה דרך.החל מחדש את זרימת ה-lysate המובהרת אל העמודה ואוסף את הזרימה המשנית. ואז לשטוף את העמוד עם חמישה מיליליטר של חיץ לשטוף אחד ולאסוף את הזרימה דרך. לשטוף את העמודה שוב עם חמישה מיליליטר של חיץ לשטוף שני ולאסוף את הזרימה דרך.עכשיו להחיל שני מיליליטר של מאגר אלוטיום. לאסוף זרימה דרך בשני שברים של מיליליטר אחד כל אחד. במהלך טיהור חלבונים, הכללת מגנזיום כלורי במאגרי הטיהור, שינוי בפרוטוקול היצרן, חיונית לפעילות אנזימטית.כדי להעריך באופן איכותי טיהור חלבונים על ידי SDS-PAGE, הפעל 20 אליקוטים מיקרוליטר של כל שברי העמודות בערימה של 4%, 10% הפעלת ג'ל פוליאקרילמיד במשך 60 דקות ב- 170 וולט. מכתימים את הג'ל בכחול קומאסי 0.1% בטמפרטורת החדר במשך חמש שעות, מתנדנדים בעדינות על נדנדה על ספסל. לאחר מכן יש לבודד את הג'ל בחומצה אצטית קרחונית של 40%-10% בטמפרטורת החדר, המתנדנדת על נדנדת הספסל.דיאליזה שבר אלוט שני נגד חיץ דיאליזה ביחס של 200:1 באמצעות מכשיר דיאליזה מיליליטר אחד עם 20 קילודלטון משקל מולקולרי ניתוק לילה בארבע מעלות צלזיוס. לקבוע את הריכוז של דגימת חלבון דיאליזה על ידי מדידת ספיגה ב 280 ננומטר ושימוש מקדם הכחדה טוחן מחושב. יש לאחסן 100 מיקרוליטר של דגימת החלבון הדיאליזה במינוס 80 מעלות צלזיוס עד לשימוש.לפני ביצוע התגובה, להכין PEI תאית צלחות כרומטוגרפיה שכבה דקה על ידי שטיפת אותם במים deionized. מניחים את הצלחות בתא זכוכית עם מים מזוקקים כפולים לעומק של כ 0.5 ס"מ. לאחר מתן אפשרות למים לנדוד לראש הצלחת, מוציאים את הצלחות מתא הזכוכית ומשאירים על מתלה ספסל להתייבש בן לילה.סמן את הלוחות המיובשים שני סנטימטרים מקצה אחד עם עיפרון רך כדי לציין היכן הדגימות יוחלו על TLC. עבור דגימות שני מיקרוליטר, להחיל דגימות לא פחות מס"מ אחד זה מזה. בעת תכנון ניסויים, תמיד להשאיר נקודה אחת על כל צלחת לא משמש לשמש נתיב ריק לכמות מדגם.כדי לבצע את בדיקת פעילות האנזים, הכן תגובות בודדות באמצעות ATP גמא P32 כמתואר בפרוטוקול הטקסט. הוסף את RSH לאחר הרכיבים האחרים היו מעורבים, כמו תוספת של RSH לתערובת המכילה נוקלאוטיד יוזם את המשגיח פעילות אנזימטית. כדי לשלוט על הידרוליזה ATP מזיהום פעילות גרעין, להרכיב תגובה 10 מיקרוליטר המכיל ללא חלבון דגירה זה במקביל.ספוט דגימות שני מיקרוליטר ב T שווה אפס ובסוף הניסוי כדי להבטיח כי ATP לא היה הידרוליזה בהיעדר חלבון. מיד עם הוספת RSH, להסיר שני microliters ולתפוות אותו על לוח PEI-תאית שכותרתו כמו T שווה מדגם אפס דקות. הדגירה את התגובה ב 37 מעלות צלזיוס, הסרת aliquots שני microliter בנקודות הזמן הרצויות.לאחר שנאספו כל aliquots, לבצע כרומטוגרפיה שכבה דקה על ידי מילוי תא כרומטוגרפיה עם 1.5 טוחן מונובסיום פוספט לעומק של 0.5 ס"מ. לטבול את הקצה התחתון של הצלחת בממס ולאפשר את הממס לעבור לראש הצלחת על פני כ 90 דקות. מוציאים את הצלחת ממיכל הכרומטוגרפיה ומ מניחים אותה על מתלה ייבוש ספסל כדי להתייבש באוויר בן לילה.לאחר הצלחת יבשה, לעטוף את הצלחת בסרט פלסטיק, כדי למנוע העברה של חומר רדיואקטיבי לקלטת הדמיה לנתח על ידי אוטוביוגרפיה. חשוף את צלחת PEI-תאית המכילה תגובות מופרדות לקלטת זרחן במשך ארבע שעות בטמפרטורת החדר. לאחר החשיפה, דמיין את הקלטת על זרחן.באמצעות תוכנת דימות עם ממשק משתמש גרפי, צייר אזורים מעניינים או ROIs על-ידי בחירה תחילה באפשרות צייר מלבן ולאחר מכן השתמש בעכבר כדי לצייר ROIs מלבניים סביב נתיב שלם אחד ואת נקודות ATP ו- guanosine-tetraphosphate הכלולות בנתיב זה. השתמש בפקודות בחירה, העתקה והדבקה כדי לצייר פריטים מועתקים זהים בתוך הנתיבים האחרים כדי להבטיח שההסברים מודדים אות בתוך אזורים זהים בכל נתיב. כלול זיכרון דיסקים (ROIs) מנתיב שלא נעשה בו שימוש כדי שישמש כריק.באמצעות ניתוח, כלים, מנהל ההשקעות, הוספת פקודות של תוכנת ההדמיה, בחר את כל ה- ROIs המצוירים על הלוח PEI-תאית. עכשיו להשתמש בפקודות לנתח, להגדיר מדידות, למדוד לכמת את עוצמת האות בתוך כל ROI ולייצא את המידות כמו spreadsheeet. בגיליון האלקטרוני, הפחת ערכי ROI ריקים מאותות ניסיוניים.המרת הנתונים לאחוז guanosine-tetraphosphate סינתטי הוא קריטי, כי זה מבטיח כי ערכות נתונים שנאספו בימים שונים עם אצוות שונות של חלבון או גמא P32 ATP שונים הם עקביים ניתן לאסוף עבור הקפדה סטטיסטית. קריקטורה זו מדגימה כיצד אזורי עניין משמשים להגדרת נתיב המכיל את האות הרדיואקטיבי הכולל בדגימה ואת האזורים הרדיואקטיביים ATP וגואנוסין טטרפוספט מעניינים. אותות ATP ו- guanosine tetraphosphate מנורמלים לאות הכולל במקום לדווח על הערכים המוחלטים מכיוון ששגיאת צינור או ריקבון של המצע הרדיואקטיבי יכולים להשפיע על האות הכולל המדגם אך אינם משפיעים על פעילות האנזים.מוצג כאן הוא לוח TLC בפועל של תגובה שבוצעה באמצעות RSH C.difficile מטוהרים. תגובת בקרה ללא חלבון מאפשרת כימות של הידרוליזה ATP בלתי מרושתת בעוד נתיב ריק מאפשר כימות אותות מדויק. בנקודות ATP וגואנוסין-טטרפוספט, האנזים מעביר את הפוספט הרדיואקטיבי ממצע ATP למבשר התמ"ג, ויוצר טטרה פוספט גואנוזין רדיואקטיבי.זה מאשר כי סינתזת גואנוזה טטרפוספט putative מ C.difficile הוא אנזים פעיל. על ידי דגימת התגובה במרווחים, ניתן לראות את ההתקדמות. כאן האות הגולמי נצפה בכל נקודת זמן.ATP הולך ופוחת וגואנוסין טטרפוספט גדל. מוצגים כאן הנתונים המנורמלים. קווי השגיאה קטנים בהרבה מכיוון שהנורמליזציה מהווה שגיאת pipetting כלשהי.בעת ניסיון הליך זה, חשוב להיזהר לא לגרד את השרף על צלחת TLC, כמו זה יכול להפריע הגירה ממס. זוהי טכניקה נגישה מאוד עם ניתוח נתונים פשוט שיכול לספק במהירות כימות חזק של פעילות האנזים. השתמשנו בו כדי לאשר כי Clostridium difficile מסנתז גואנוסין טטרפוספט, אשר מעולם לא דווח בעבר.אל תשכח כי עבודה עם רדיואקטיביות יכול להיות מסוכן מאוד ואתה חייב לעקוב אחר הכללים של המוסד שלך לאחסון ושימוש בחומרים רדיואקטיביים בעת ביצוע הליך זה. שיטה זו יכולה לספק תובנה לתוך סינתזת גואנוסין טטרפוספט אבל זה יכול להיות מיושם גם על תגובות phosphotransfer אחרים, כולל פעילות קינאז חלבון סינתזה דיגואנילאט מחזורי.

Research

JoVE Journal

Immunology and Infection

A Purification and In Vitro Activity Assay for a (p)ppGpp Synthetase from Clostridium difficile

In vitro Biofilm Formation in an 8-well Chamber Slide

In vitro Biofilm Formation in an 8-well Chamber Slide

ב גיבוש biofilm חוץ גופית ב 8-Slide גם לשכת

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. ...

Measurement of Factor V Activity in Human Plasma Using a Microplate Coagulation Assay

מדידה של פעילות פקטור V בפלזמה אנושית באמצעות Assay קרישת Microplate

 In response to injury, blood coagulation is activated and results in generation of the clotting protease, thrombin. Thrombin cleaves fibrinogen to fibrin ...

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

רוק, בלוטות הרוק, וכן אוסף Hemolymph מ קרציות קרצית Scapularis

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne ...

Culturing and Maintaining Clostridium difficile in an Anaerobic Environment

Culturing and Maintaining Clostridium difficile in an Anaerobic Environment

Culturing ושמירה<em&gt; Difficile Clostridium</em&gt; בסביבת אנאירובית

Clostridium  difficile is a Gram-positive, anaerobic, sporogenic bacterium  that is primarily responsible for antibiotic associated diarrhea (AAD) and is ...

In vitro Coculture Assay to Assess Pathogen Induced Neutrophil Trans-epithelial Migration

In vitro Coculture Assay to Assess Pathogen Induced Neutrophil Trans-epithelial Migration

במבחנה Coculture Assay כדי להעריך פתוגן המושרה נדידת נויטרופילים טרנס אפיתל

Mucosal surfaces serve as protective barriers against pathogenic organisms.&#160;Innate immune responses are activated upon sensing pathogen leading to ...

Isolation, Identification, and Purification of Murine Thymic Epithelial Cells

בידוד, זיהוי, וטיהור של תאי Murine הרתי אפיתל

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple ...

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

RNA טיהור מן intracellularly Grown<em&gt; חיידקי ליסטריה</em&gt; בתאי Macrophage

Analysis of the transcriptome of bacterial pathogens during mammalian infection is a valuable tool for studying genes and factors that mediate infection. ...

Flow Cytometric Analysis of Natural Killer Cell Lytic Activity in Human Whole Blood

ניתוח תזרים Cytometric של תא הטבעי Killer ממס פעילות דם מלא אנוש

NK cell cytotoxicity is a widely used measure to determine the effect of outside intervention on NK cell function. However, the accuracy and ...

Cefoperazone-treated Mouse Model of Clinically-relevant Clostridium difficile Strain R20291

Cefoperazone-treated Mouse Model of Clinically-relevant Clostridium difficile Strain R20291

Cefoperazone שטופל עכבר דגם של קליני רלוונטי<em&gt; Clostridium difficile</em&gt; R20291 הזנים

Clostridium difficile is an anaerobic, gram-positive, spore-forming enteric pathogen that is associated with increasing morbidity and mortality and ...

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

פרוטוקול לאפיין את השינויים המורפולוגיים של<em&gt; Clostridium difficile</em&gt; בתגובה לטיפול אנטיביוטי

Assessment of antibiotic action with new drug development directed towards anaerobic bacteria is difficult and technically demanding. To gain insight into ...