Name: a purification and in vitro activity assay for a (p)ppgpp synthetase from clostridium difficile
Uploaded: 2018-11-03T15:00:00
Description: Watch this Scientific Journal Video about A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile at JoVE.com

이 작품은 NIAID 1K22AI118929-01에 의해 투자 되었다. EBP는 오래 된 판도 대학 노퍽, 버지니아, 미국에서 연구의 사무실에서 여름 연구 친교 프로그램 교부 금에 의해 지원 되었다.

1. 유도할 수 있는 Overexpression 히스티딘 태그 단백질의
<ol><li>Rsh C. 남과 어울리지 않 는 R20291 genomic DNA에서에서 증폭.<ol>
<li>높은 중 합 효소를 사용 하 고 제조업체의 지침을 따르십시오.</li>
		<li>C. 남과 어울리지 않는 rsh 뇌관을 사용 하 여 증폭 rsh_F (CAGGTACCGGTTATATGCATGATAAAGAATTACAAG)와 rsh_R (CCCTGCAGCTAATGGTGATGGTGATGGTGATTTGTCATTCTATAAATAC), C 터미널 hexahistidine ?...

<ol>
	<li>Cheek, S., Ginalski, K., Zhang, H., Grishin, N. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+update+of+the+sequence+and+structure+classification+of+kinases.">A comprehensive update of the sequence and structure classification of kinases.</a> BMC Structural Biology. 5 (1), 6 (2005).</li><li>Porath, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilized+metal+ion+affinity+chromatography.">Immobilized metal ion affinity chromatography.</a> Protein Expression and Purification. 3 (4), 263-281 (1992).</li><li>Arnau, J., Lauritzen, C., Pedersen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+strategy,+production+and+purification+of+proteins+with+exopeptidase-cleavable+His-tags.">Cloning strategy, production and purification of proteins with exopeptidase-cleavable His-tags.</a> Nature Protocols. 1 (5), 2326-2333 (2006).</li><li>Porath, J., Carlsson, J., Olsson, I., Belfrage, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metal+chelate+affinity+chromatography,+a+new+approach+to+protein+fractionation.">Metal chelate affinity chromatography, a new approach to protein fractionation.</a> Nature. 258 (5536), 598-599 (1975).</li><li>Smith, M. C., Furman, T. C., Ingolia, T. D., Pidgeon, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chelating+peptide-immobilized+metal+ion+affinity+chromatography.+A+new+concept+in+affinity+chromatography+for+recombinant+proteins.">Chelating peptide-immobilized metal ion affinity chromatography. A new concept in affinity chromatography for recombinant proteins.</a> Journal of Biological Chemistry. 263 (15), 7211-7215 (1988).</li><li>Graslund, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+purification.">Protein production and purification.</a> Nature Methods. 5 (2), 135-146 (2008).</li><li>Booth, W. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+an+N-terminal+Polyhistidine+Tag+on+Protein+Thermal+Stability.">Impact of an N-terminal Polyhistidine Tag on Protein Thermal Stability.</a> ACS Omega. 3 (1), 760-768 (2018).</li><li>Thielges, M. C., Chung, J. K., Axup, J. Y., Fayer, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+histidine+tag+attachment+on+picosecond+protein+dynamics.">Influence of histidine tag attachment on picosecond protein dynamics.</a> Biochemistry. 50 (25), 5799-5805 (2011).</li><li>Chaga, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty-five+years+of+immobilized+metal+ion+affinity+chromatography:+past,+present+and+future.">Twenty-five years of immobilized metal ion affinity chromatography: past, present and future.</a> Journal of Biochemical and Biophysical Methods. 49 (1-3), 313-334 (2001).</li><li>Ma, H., Deacon, S., Horiuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+challenge+of+selecting+protein+kinase+assays+for+lead+discovery+optimization.">The challenge of selecting protein kinase assays for lead discovery optimization.</a> Expert opinion on drug discovery. 3 (6), 607-621 (2008).</li><li>Tamayo, R., Tischler, A. D., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+EAL+domain+protein+VieA+is+a+cyclic+diguanylate+phosphodiesterase.">The EAL domain protein VieA is a cyclic diguanylate phosphodiesterase.</a> Journal of Biological Chemistry. 280 (39), 33324-33330 (2005).</li><li>Purcell, E. B., McKee, R. W., McBride, S. M., Waters, C. M., Tamayo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclic+Diguanylate+Inversely+Regulates+Motility+and+Aggregation+in+Clostridium+difficile.">Cyclic Diguanylate Inversely Regulates Motility and Aggregation in Clostridium difficile.</a> Journal of Bacteriology. 194 (13), 3307-3316 (2012).</li><li>Purcell, E. B., Tamayo, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+cyclic+nucleotide+phosphodiesterases.">Identification and characterization of cyclic nucleotide phosphodiesterases.</a> Methods in Molecular Biology. 1016, 235-243 (2013).</li><li>Ross, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+cellulose+synthesis+Acetobacter+xylinum.+A+unique+guanyl+oligonucleotide+is+the+immediate+activator+of+the+cellulose+synthase.">Control of cellulose synthesis Acetobacter xylinum. A unique guanyl oligonucleotide is the immediate activator of the cellulose synthase.</a> Carbohydrate Research. 149 (1), 101-117 (1986).</li><li>Potrykus, K., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=(p)ppGpp:+still+magical?.">(p)ppGpp: still magical?.</a> Annual Review of Microbiology. 62, 35-51 (2008).</li><li>Boutte, C. C., Crosson, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+lifestyle+shapes+stringent+response+activation.">Bacterial lifestyle shapes stringent response activation.</a> Trends in Microbiology. 21 (4), 174-180 (2013).</li><li>Nanamiya, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+functional+analysis+of+novel+(p)ppGpp+synthetase+genes+in+Bacillus+subtilis.">Identification and functional analysis of novel (p)ppGpp synthetase genes in Bacillus subtilis.</a> Molecular Microbiology. 67 (2), 291-304 (2008).</li><li>Gaca, A. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basal+Levels+of+(p)ppGpp+in+Enterococcus+faecalis:+the+Magic+beyond+the+Stringent+Response.">Basal Levels of (p)ppGpp in Enterococcus faecalis: the Magic beyond the Stringent Response.</a> mBio. 4 (5), (2013).</li><li>Sebaihia, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multidrug-resistant+human+pathogen+Clostridium+difficile+has+a+highly+mobile,+mosaic+genome.">The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome.</a> Nature Genetics. 38 (7), 779-786 (2006).</li><li>Gasteiger, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ExPASy:+The+proteomics+server+for+in-depth+protein+knowledge+and+analysis.">ExPASy: The proteomics server for in-depth protein knowledge and analysis.</a> Nucleic Acids Research. 31 (13), 3784-3788 (2003).</li><li>Purcell, E. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nutrient-regulated+cyclic+diguanylate+phosphodiesterase+controls+Clostridium+difficile+biofilm+and+toxin+production+during+stationary+phase.">A nutrient-regulated cyclic diguanylate phosphodiesterase controls Clostridium difficile biofilm and toxin production during stationary phase.</a> Infection and Immunity. , (2017).</li><li>Mechold, U., Murphy, H., Brown, L., Cashel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intramolecular+Regulation+of+the+Opposing+(p)ppGpp+Catalytic+Activities+of+RelSeq,+the+Rel/Spo+Enzyme+from+Streptococcus+equisimilis.">Intramolecular Regulation of the Opposing (p)ppGpp Catalytic Activities of RelSeq, the Rel/Spo Enzyme from Streptococcus equisimilis.</a> Journal of Bacteriology. 184 (11), 2878-2888 (2002).</li><li>Dalebroux, Z. D., Svensson, S. L., Gaynor, E. C., Swanson, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ppGpp+Conjures+Bacterial+Virulence.">ppGpp Conjures Bacterial Virulence.</a> Microbiology and Molecular Biology Reviews. 74 (2), 171-199 (2010).</li><li>Bartlett, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clostridium+difficile:+progress+and+challenges.">Clostridium difficile: progress and challenges.</a> Annals of the New York Academy of Sciences. 1213, 62-69 (2010).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> US Department of Health and Human Services. , (2013).</li></ol>

여기 우리가 보고 그의 태그 RSH C. 남과 어울리지 않 는에서 정화 활동 정량화 방사선된 얇은 층 착 색 인쇄기를 사용 하 여에 대 한 방법을 제시 하 고. 이 방법은 이전 C. 남과 어울리지 않는로 (p) ppGpp 합성, 뉴클레오티드 있고, 키 니 아 제 diguanylate 있고 효소와 다른 유기 체11,12 포스 효소의 활동을 평가 하기 위해 사용 되었습니다. ,</s...

키 및 pyrophosphokinase (또는 diphospho 키) 효소 기질 분자 뉴클레오티드 3 인산 염 (NTP) 선구자에서 인산 염을 전송. 기판 다른 뉴클레오티드, 아미노산 이나 단백질, 탄수화물, 그리고 지질1포함할 수 있습니다. 효소의 동족 기판 또는 특징이 효소를 유사성에 따라 기판 Bioinformatic 분석 예측 가끔 수 있습니다 하지만 실험 유효성 검사 여전히 필요 합니다. 마찬가지로, 그것의 substrate(s) 및는 그것 catalyzes 형광체 전송 반응 속도 효소의 선호도 및 공동 요인, 억제제, 또는 다른 효소 이펙터의 효과 결정 되어야 합니다 실험적으로. 다른 ATP 소모 효소 세균성 세포질에 존재에 의해 ATP 전조의 소모를 피하기 위해, 양적 활동 분석 실험 순화 된 단백질을 필요로 합니다.
단백질 정화 금속 친화성 크로마토그래피에 의해 문학2,3에 철저 하 게 적용 되었습니다 했습니다. 히스티딘 태그 6 연속 히스티딘 잔류물에는 N-또는 C-말단 재조합 단백질의 추가 구성 된 금속 친화성 크로마토그래피4,,56에 의해 급속 한 정화를 수 있습니다. 이러한 시퀀스는 작은 그들은 때로는 단백질 안정성 및 효소 반응 속도 론7,8변경할 수 있지만 그들은 수정 하 고 일반적으로 단백질 기능에 미치는 영향을 최소화 하는 단백질에 비해. 히스티딘 태그에는 N-와 C-테르미니 같은 단백질에 단백질의 구조를 알지 못하고 예측 하기 어려운 다양 한 효과 가질 수 있습니다. 히스티딘 태그는 일반적으로 복제는 재조합 형 단백질의 중 즉시 6 히스티딘 잔류물, 인코딩할 뇌관을 설계 하 여 3' ATG 시작 codon에 또는 즉시 5', 열려있는 독서 프레임 정지 codon를 하는 동안 통합 된다. 증폭 후 포함 하는 hexahistidine 유전자는 유도할 수 있는 발기인의 통제 벡터에 출혈 이며 표현 하는, 일반적으로 대장균의 실험실 긴장에. 재조합 단백질 다음 고정된 divalent 양이온 (일반적으로 니켈 또는 코발트)9를 포함 하는 선호도 수 지에 고립 될 수 있다. 기본 금속-바인딩 단백질 오염 하는 것은 이미, 경쟁적으로 바인딩된 단백질2배 수량으로 적정 하 여 제거할 수 있습니다. 마지막으로, 대상 단백질은 eluted 이미의 높은 농도와 열에서. 고정된 금속 양이온 수 지에 대 한 몇 가지 상용 소스 고 버퍼 조건 및 이미 농도 대 한 권장 사항을 제공 하는 제조 업체. 차입, 후 단백질 수 수 나트륨 라우릴 황산 polyacrylamide 젤 전기 이동 법 (SDS 페이지)에 의해 분석, dialyzed, 또는 기능 분석에서 즉시 사용.
해제 또는 fluorophore는 흥분 하거나 생성 하는 화학, 두 번째 반응에 ATP 인산 염 결합 가수분해를 커플링 하 여 키 니 아 제 활동을 직접으로 모니터링 하는 여러 가지 방법이 있습니다 하지만이 반응은 여러 이동 부분 그리고 될 수 있는 물류 도전10. 특히 형광체 전송 활동을 측정 하는 가장 간단한 방법은 모니터링 하는 데 직접 상용 γ-32에서 방사선된 인산 염 그룹의 전송-P 비 방사선 기판11 에 NTP 전조 , 12 , 13. 방사선된 기판 및 제품의 혼합물을 분리 하 고 얇은 층 크로마토그래피 (TLC)에 의해 측정할 수 있다. TLC 용 매 (액체 단계) 모 세관 작용에 의해 표면 (단단한 단계)는 용액의 흡착된14되었습니다에서 마이그레이션할 수 있도록 하 여 주어진된 용 매에서 용액의 차동 이동성을 활용 합니다. 있는 작은 고체 단계와 호의 베푸는 상호 작용 부족 용액 마이그레이션됩니다 높은 분자 무게 또는 고체에 대 한 대단한 선호도 용액 보다 더 긴 거리 그들의 초기 위치에서. 인 전송의 시험, 인산 moieties 그들에, 추가 되 고 중성 또는 산 성 pH11,,1214에서 부정적인 이온 충전 추가 분자의 분자량 증가. 이 페이 셀 룰 로스 등 기본 표면에 그들의 기동성을 감소합니다. 신랄 한 칼륨 인산 염 버퍼에서 개발, 페이-셀 루 로스, 각 종 (그림 2, 그림 3)의 정량화를 허용에 모노, 디, 트라이-, tetra-및 pentaphosphate 종의 혼합물을 쉽게 분리 수 있다. 이러한 분석의 관심, 효소를 포함 하는 세포 lysates를 사용 하 여 수행할 수 있습니다 하지만이 다른 kinases, 가수분해, 및 일반적인 ATPases의 활동에 대 한 잠재력을 고갈 기판 및/또는 제품을 포함 합니다. 평가 대 한 양적 체 외에서 효소 활동의, 그것은 관심의 효소 정화 해야 합니다.
Guanosine tetraphosphate (ppGpp) 및 guanosine pentaphosphate (pppGpp)는 ribonucleotide 신호 분자는 파이 인산의 이동에 의해 형성 된 그룹 아데노신 3 인산 염 (ATP) 전조에서 각각, guanosine diphosphate (GDP) 또는 guanosine tetraphosphate (GTP) 기판15. 이러한 단일 ribonucleotide 신호, (p) ppGpp로 총칭 알려진 다양 한 세균성 종15,16에 엄격한 응답으로 알려진 환경 스트레스에 셀 전체 응답 중재. 두 가지 보존된 수준의 효소 촉매 형성 (p) ppGpp15,17 Rel/Spo의 체 (RSH) 효소는 '긴' bifunctional (p) ppGpp 합성/hydrolases 휴식 자리 (p)를 그들의 유사성에 대 한 명명 된 ppGpp 신진 대사 대장균 에서 합성, 가수분해 효소, 및 규제 도메인, 작은 alarmone (SAS) 합성 효소는 짧은 monofunctional synthetases 그램 긍정적인 박테리아15, 에서 독점적으로 포함 하는 효소 17 , 18. 포자 형성 그람 양성 박테리아 클로스 트리 남과 어울리지 않 는 putative RSH 및 SAS 유전자19인코딩합니다. 여기, 선물이 C. 남과 어울리지 않 는 RSH 효소 촉매로 활성 (p) ppGpp 합성 인지 확인 하는 초기 활동 분석 실험.

<table>
	<tbody>
		<tr>
			<td>Inducible overexpression of a histidine-tagged protein</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Phusion polymerase</td>
			<td>New England Biolabs (NEB)</td>
			<td>M0530L</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAEX II DNA Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>20021</td>
			<td></td>
		</tr>
		<tr>
			<td>KpnI restriction enzyme</td>
			<td>NEB</td>
			<td>R0142S</td>
			<td></td>
		</tr>
		<tr>
			<td>PstI restriction enzyme</td>
			<td>NEB</td>
			<td>R0140S</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>NEB</td>
			<td>M0202</td>
			<td></td>
		</tr>
		<tr>
			<td>NEB&#174; 5-alpha Competent&#160;E. coli&#160;(High Efficiency)</td>
			<td>NEB</td>
			<td>C2987I</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 (DE3) Competent E. coli</td>
			<td>NEB</td>
			<td>C2527I</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>Sigma-Aldrich</td>
			<td>10724815001</td>
			<td></td>
		</tr>
		<tr>
			<td>JXN-26 centrifuge with JLA 10.500 rotor</td>
			<td>Beckman Coulter Avanti</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge with D3024/D3024R rotor</td>
			<td>Scilogex</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>MaxQ SHKE6000 Incubator</td>
			<td>Thermo Scientific</td>
			<td>-</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultrasonic processor</td>
			<td>Sonics</td>
			<td>VC-750</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein purification by nickel affinity chromatography</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA resin</td>
			<td>G Biosciences</td>
			<td>786-940/941</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce Disposable Gravity columns, 10 mL</td>
			<td>Thermo Scientific</td>
			<td>29924</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mL Spectra/ Por float-A-lyzer G2 dialysis device (MWCO: 20-kD)</td>
			<td>Spectrum</td>
			<td>G235033</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Electrophoresis Cell</td>
			<td>BioRad</td>
			<td>1658004</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein activity assay by thin layer chromatography</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Thin layer chromatograph (TLC) development tank</td>
			<td>General Glass Blowing Company</td>
			<td>80-3</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyethylenimine (PEI)-cellulose plates (20 cm x 20 cm, 100 um thickness) with polyester support</td>
			<td>Sigma-Aldrich</td>
			<td>Z122882-25EA</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP, [&#947;-32P]- 3000 Ci/mmol 10mCi/ml lead, 100 &#956;Ci</td>
			<td>Perkin Elmer</td>
			<td>NEG002A</td>
			<td></td>
		</tr>
		<tr>
			<td>Adenosine 5&#8217;-triphosphate (ATP) 100 mM</td>
			<td>Bio Basic Canada</td>
			<td>AB0311</td>
			<td></td>
		</tr>
		<tr>
			<td>Guanosine-5&#8217;-diphosphate disodium salt (GDP)</td>
			<td>Alfa Aesar</td>
			<td>AAJ61646MC/E</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage phosphor screen</td>
			<td>GE Healthcare Life Sciences</td>
			<td>BAS-IP TR 2040 E Tritium Screen</td>
			<td></td>
		</tr>
		<tr>
			<td>Storm 860 phosphorimager</td>
			<td>GE Healthcare Life Sciences</td>
			<td>-</td>
			<td></td>
		</tr>
	</tbody>
</table>

a purification and in vitro activity assay for a (p)ppgpp synthetase from clostridium difficile

키 및 pyrophosphokinase 효소 phosphorylated 제품을 기판에 뉴클레오티드 3 인산 염 선구자에서 감마 인산 염 또는 베타-감마 파이 인산 moiety를 전송. 사용 하는 γ-32-P NTP 선구자를 표시 하실 수 있습니다 방사선에 의해 기판 사용률 및 제품 대형의 동시 모니터링. 셀 룰 로스 판에 얇은 층 크로마토그래피 (TLC) 신속한 분리 및 기질과 제품의 민감한 정량화를 허용 한다. 우리는 얇은 층 크로마토그래피 정제 (p) ppGpp 합성의 pyrophosphokinase 활동 분석 결과를 활용 하는 방법을 제시. 이 방법은 주기적인 뉴클레오티드 및 디뉴클레오티드 synthetases의 활동 특성 사용 되었습니다 이전 이며 뉴클레오티드 3 인산 염 유대 hydrolyzes 또는 터미널 전송 하는 모든 효소의 활동을 특성화 하는 데 광범위 하 게 적합 인산 다른 분자를 염 인산 염 기증자 로부터

선물이 Clostridium 남과 어울리지 않는 그것의 효소 활동의 평가에서 (p) ppGpp 합성의 친 화력 정화 하는 방법. 그림 1 에 금속 친화성 크로마토그래피에 의해 달성 단백질 정화 방법을 보여 줍니다. 이 정화에서 두 번째 차입 (E2) 분수 dialyzed 고 효소 활동 분석 결과 대 한 사용. 그림 2 에 대 한 준비 하 고 얇은 층 크로마토그?...

Watch this Scientific Journal Video about A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile at JoVE.com

A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile

여기, 히스티딘 태그 pyrophosphokinase 효소 정화 및 radiolabelled 기질 그리고 효소 활동 체 외에 대 한 분석 결과를 제품의 얇은 층 크로마토그래피를 이용 하는 방법을 설명 합니다. 효소 활동 분석 결과 모든 키, 뉴클레오티드 있고, 또는 인광 체 전송 반응의 메커니즘 포함 뉴클레오티드 3 인산 염 가수분해에 광범위 하 게 적용 됩니다.

정화 및 체 외에서 활동 분석 결과 (p) ppGpp Clostridium 남과 어울리지 않 는에서 합성에 대 한

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to ...

이 방법은 효소 기판 특이성 및 반응 운동제를 포함하여 인전달 효소에 대한 주요 질문에 대답하는 데 도움이 될 수 있습니다. 이 기술의 주요 장점은 매우 일관된 여러 데이터 세트를 신속하게 수집하여 효소 활성의 통계적으로 강력한 정량화를 가능하게 한다는 것입니다. 이 방법의 시각적 데모는 TLC 플레이트에 대한 반응을 발견하고 반응에서 방사성 종을 정량화하는 것이 설명하는 것보다 훨씬 쉽게 입증되기 때문에 중요합니다.Astha 이외에, 절차를 보여주는 아시아 Poudel, 내 실험실에서 또 다른 대학원생이 될 것입니다. 텍스트 프로토콜에 설명된 바와 같이 히스티딘 태그 단백질의 유도할 수 없는 과발현으로 이 프로토콜을 시작합니다. 단백질을 정화하기 위해 중력 컬럼에 니켈 니릴로아세산 수지 1밀리리터를 준비합니다.사용하기 전날, 평형 버퍼의 두 밀리리터와 섭씨 4도에서 하룻밤 컬럼을 평형. 다음 날은 명확한 lysate를로드하기 전에 4섭씨에서 실온으로 기둥을 가져와 약 2 ~ 3 시간 동안 방치하십시오. 그런 다음 리시스 버퍼에서 펠릿을 다시 일시 중지합니다.10회 10초 간격으로 얼음 에 세포를 초음파 처리하여 펄스 사이에 30초 간 멈췄습니다. 미세 원심 분리기를 사용하여 섭씨 4도에서 30분 동안 3, 080배 g에서 원심분리로 lysate를 명확히 합니다. 동일한 양의 용해 버퍼로 명확히 된 lysate를 준비한 다음, 준비된 명확한 lysate를 열에 적용하고 흐름을 수집합니다.명확히 된 lysate 흐름을 컬럼에 다시 적용하고 보조 흐름을 수집합니다. 그런 다음 5 밀리리터의 세척 버퍼 1로 컬럼을 씻고 흐름을 수집합니다. 5밀리리터의 워시 버퍼 2로 컬럼을 다시 씻고 흐름을 수집합니다.이제 용출 버퍼의 두 밀리리터를 적용합니다. 각각 1 밀리리터의 두 분수로 흐름을 수집합니다. 단백질 정화 중에 정제 완충제에 염화물 마그네슘을 포함하면 제조업체의 프로토콜을 수정하는 것이 효소 활성에 필수적입니다.SDS-PAGE에 의한 단백질 정제를 질적으로 평가하기 위해 모든 컬럼 분획의 20마이크로리터 알리쿼트를 4%스태킹에 실행하고, 170볼트에서 60분 동안 폴리아크릴아미드 젤을 10% 실행합니다. 5시간 동안 실온에서 0.1% 쿠마시 블루로 젤을 더럽히고 벤치탑 로커를 부드럽게 흔들어 보냅니다. 그런 다음 40% 메탄올-10% 빙하 아세트산으로 밤새 실온에서 젤을 데스테인하여 벤치탑 로커에 흔들리고 있습니다.20킬로달톤의 분자량 컷오프가 섭씨 4도에서 하룻밤 사이에 1밀리리터 투석 장치를 사용하여 투석 버퍼에 대해 200:1 비율로 용출된 분획 2개를 투석합니다. 280 나노미터에서 흡광도를 측정하고 계산된 어금니 소멸 계수를 사용하여 투석 단백질 샘플의 농도를 결정합니다. 투석 단백질 샘플의 100 마이크로리터 알리쿼트를 사용 전까지 영하 80도에서 보관하십시오.반응을 수행하기 전에, 탈온 화 물에 그들을 세척하여 PEI 셀룰로오스 얇은 층 크로마토그래피 플레이트를 준비합니다. 접시를 이중 증류수가 있는 유리 챔버에 약 0.5cm 깊이로 놓습니다. 물이 접시 의 상단으로 이동 할 수 있도록 한 후, 유리 챔버에서 접시를 가지고 하룻밤 건조 벤치 탑 랙에 둡니다.말린 플레이트를 부드러운 연필로 한 가장자리에서 2센티미터 떨어진 곳에 표시하여 TLC에 시료가 적용되는 위치를 나타냅니다. 2마이크로리터 샘플의 경우 샘플을 1센티미터 이하로 적용합니다. 실험을 계획할 때는 항상 각 플레이트에 한 자리를 두어 샘플 정량화를 위한 빈 차선역할을 합니다.효소 활성 분석작업을 수행하려면 텍스트 프로토콜에 설명된 대로 감마 P32 ATP를 사용하여 개별 반응을 준비한다. 다른 성분이 혼합된 후 RSH를 첨가하고, 뉴클레오티드 함유 믹스에 RSH를 첨가하여 효소 활성 분석서를 개시한다. 핵활성을 오염시키는 ATP 가수분해를 제어하려면 단백질을 함유한 10마이크로리터 반응을 조립하고 병렬로 배양한다.T에서 2마이크로리터 샘플을 반점0과 실험이 끝날 때 ATP가 단백질이 없는 상태에서 가수분해되지 않았는지 확인합니다. RSH를 첨가한 즉시 2개의 마이크로리터를 제거하고 T가 0분 샘플과 같기 때문에 표지된 PEI 셀룰로오스 플레이트에 반점하십시오. 37°C의 반응에 따라 원하는 시점에서 2마이크로리터 알리쿼트를 제거합니다.모든 알리쿼트가 수집된 후, 크롬토그래피 챔버를 1.5m의 단백칼륨 인산염을 0.5센티미터 깊이로 채우어 얇은 층 크로마토그래피를 수행한다. 플레이트의 하단 가장자리를 용매에 담그고 용매가 약 90분 동안 플레이트 의 상단으로 이동할 수 있도록 합니다. 크롬 토그래피 탱크에서 접시를 제거하고 밤새 공기 건조 벤치 탑 건조 랙에 배치합니다.플레이트가 건조한 후, 방사성 물질의 방사성 물질을 이미징 카세트로 옮기지 않도록 플라스틱 필름으로 플레이트를 감싸고 사인방사선에 의해 분석한다. 실온에서 4시간 동안 인광상기 카세트에 분리된 반응을 포함하는 PEI 셀룰로오스 플레이트를 노출한다. 노출 후, 인산화기형기의 카세트를 이미지화합니다.그래픽 사용자 인터페이스가 있는 이미징 소프트웨어를 사용하여 먼저 사각형 그리기를 선택하여 관심 영역또는 ROI 영역을 그린 다음 마우스를 사용하여 전체 차선과 해당 차선에 포함된 ATP 및 구아노신 테트라포산염 반점 주위에 직사각형 ROI를 그립니다. 선택, 복사 및 붙여넣기 명령을 사용하여 다른 차선 내에서 동일한 ROI를 그려 ROI가 각 차선의 동일한 영역 내에서 신호를 측정하고 있는지 확인합니다. 비무장 차선에서 비무장 차선에서 ROI를 포함하여 공백으로 사용할 수 있습니다.분석, 도구, ROI 관리자, 이미징 소프트웨어의 추가 명령을 사용하여 PEI 셀룰로오스 플레이트에 그려진 모든 RO를 선택합니다. 이제 분석, 설정 측정, 측정 명령을 사용하여 각 ROI 내의 신호 강도를 정량화하고 측정값을 스프레드쉬에트로 내보냅니다. 스프레드시트에서 빈 ROI 값을 실험 신호에서 빼는 것입니다.데이터를 구아노신-테트라포산염 합성퍼센트로 변환하는 것은 단백질의 다른 배치 또는 다른 감마 P32 ATP를 사용하여 다른 날에 수집된 데이터 세트가 일관되고 통계적 엄격함을 위해 풀링될 수 있도록 하기 때문에 매우 중요합니다. 이 만화는 관심 있는 지역이 샘플및 방사성 ATP 및 구아노신 테트라포산염 지역에서 총 방사성 신호를 포함하는 차선을 정의하는 데 어떻게 사용되는지 보여줍니다. ATP 및 구아노신 테트라포산염 신호는 방사성 기판의 피펫팅 오차 또는 붕괴가 샘플내의 총 신호에 영향을 줄 수 있으나 효소 활성에 영향을 미치지 않기 때문에 절대 값을 보고하기보다는 총 신호로 정규화된다.여기에 는 정제된 C.difficile RSH를 사용하여 수행된 반응의 실제 TLC 플레이트가 도시된다. 단백질을 함유하지 않는 대조작용은 비촉매 ATP 가수분해의 정량화를 허용하며, 빈 차선은 정확한 신호 정량화를 가능하게 합니다. ATP와 구아노신 테트라포산염 반점에 있는 효소는 ATP 기판에서 GDP 전구체로 방사성 인산염을 전달하여 방사성 구아노신 테트라포산염을 생성합니다.이것은 C.difficile에서 putative guanosine tetraphosphate synthetase가 활성 효소이다는 것을 확인합니다. 간격으로 반응을 샘플링함으로써 진행상황을 관찰할 수 있다. 여기서 원시 신호는 매 시점에서 관찰된다.ATP는 감소하고 구아노신 테트라포산염이 증가하고 있다. 여기에 정규화된 데이터가 표시됩니다. 정규화는 모든 파이펫 팅 오류를 기록하기 때문에 오류 막대가 훨씬 작습니다.이 절차를 시도하는 동안 용매 마이그레이션을 방해할 수 있으므로 TLC 플레이트의 수지에 긁히지 않도록 주의해야 합니다. 이것은 효소 활성의 강력한 정량화를 신속하게 제공할 수 있는 간단한 데이터 분석을 가진 매우 접근가능한 기술입니다. 우리는 클로스트리듐 difficile 구아노신 테트라포산염을 합성하는 것을 확인하기 위해 그것을 사용했습니다, 이는 이전에 보고된 적이 없다.방사능으로 작업하는 것은 매우 위험할 수 있으며 이 절차를 수행하는 동안 방사성 물질의 저장 및 사용에 대한 기관의 규칙을 따라야 합니다. 이 방법은 구아노신 테트라포산염 합성에 대한 통찰력을 제공할 수 있지만 단백질 키나아제 활성 및 순환 diguanylate 합성을 포함한 다른 인트랜스전 반응에도 적용될 수 있다.

Research

JoVE Journal

Immunology and Infection

A Purification and In Vitro Activity Assay for a (p)ppGpp Synthetase from Clostridium difficile

In vitro Biofilm Formation in an 8-well Chamber Slide

In vitro Biofilm Formation in an 8-well Chamber Slide

8 잘 회의소 슬라이드에서 체외의 Biofilm 형성에

The chronic nature of many diseases is attributed to the formation of bacterial biofilms which are recalcitrant to traditional antibiotic therapy. ...

연구

면역학 및 감염병학

Measurement of Factor V Activity in Human Plasma Using a Microplate Coagulation Assay

Microplate 응고 분석을 사용하여 인간의 플라즈마에 반영 V 활동의 측정

 In response to injury, blood coagulation is activated and results in generation of the clotting protease, thrombin. Thrombin cleaves fibrinogen to fibrin ...

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

Ixodes Scapularis 진드기의 타액, 침샘 및 Hemolymph 컬렉션

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne ...

Culturing and Maintaining Clostridium difficile in an Anaerobic Environment

Culturing and Maintaining Clostridium difficile in an Anaerobic Environment

배양 및 유지<em&gt; 클로 스트 리듐 디피</em&gt; 혐기성 환경에서

Clostridium  difficile is a Gram-positive, anaerobic, sporogenic bacterium  that is primarily responsible for antibiotic associated diarrhea (AAD) and is ...

In vitro Coculture Assay to Assess Pathogen Induced Neutrophil Trans-epithelial Migration

In vitro Coculture Assay to Assess Pathogen Induced Neutrophil Trans-epithelial Migration

시험관 내 병원균 유도 호중구 트랜스 상피 이동을 평가하는 공동 문화 분석

Mucosal surfaces serve as protective barriers against pathogenic organisms.&#160;Innate immune responses are activated upon sensing pathogen leading to ...

Isolation, Identification, and Purification of Murine Thymic Epithelial Cells

격리, 식별 및 쥐과 흉선 상피 세포의 정화

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple ...

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

RNA 정제는 세포 내에서 재배<em&gt; 리스테리아</em&gt; 식세포 세포에

Analysis of the transcriptome of bacterial pathogens during mammalian infection is a valuable tool for studying genes and factors that mediate infection. ...

Flow Cytometric Analysis of Natural Killer Cell Lytic Activity in Human Whole Blood

인간의 전체 혈액 자연 살해 세포 용 균성 활동의 유세포 분석

NK cell cytotoxicity is a widely used measure to determine the effect of outside intervention on NK cell function. However, the accuracy and ...

Cefoperazone-treated Mouse Model of Clinically-relevant Clostridium difficile Strain R20291

Cefoperazone-treated Mouse Model of Clinically-relevant Clostridium difficile Strain R20291

의 Cefoperazone 처리 된 마우스 모델 임상 관련<em&gt; 클로스 트리 디움 디피</em&gt; 스트레인 R20291

Clostridium difficile is an anaerobic, gram-positive, spore-forming enteric pathogen that is associated with increasing morbidity and mortality and ...

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

형태 변화를 규명하기위한 프로토콜<em&gt; 클로스 트리 디움 디피 실</em&gt; 항생제 치료에 대한 반응

Assessment of antibiotic action with new drug development directed towards anaerobic bacteria is difficult and technically demanding. To gain insight into ...