Name: repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos
Uploaded: 2018-12-13T13:00:00
Description: Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

يشكر المؤلفون بمعهد أبحاث ليرنر البروتين، الجينوم، وأساسيات التصوير لما قدمته من المساعدة ودعم. التمويل: كان يؤيد هذا العمل ماليا بالمعاهد الوطنية للصحة/NCI منحة R00 CA172292 (J.J.Z.) وأموال بدء التشغيل (ل J.J.Z.) والسريرية ومتعدية العلوم التعاونية (كتس) قضية Western Reserve جامعة الأساسية استخدام الطيار غرانت (إلى J.J.Z.). هذا العمل استخدام المجهر SP8 إيكا [كنفوكل] التي تم شراؤها بتمويل من "المعاهد الوطنية للصحة سيج" المنح 1S10OD019972-01.

ووافق جميع التجارب التي تنطوي على الحيوانات قبل IACUC عيادة كليفلاند (رعاية الحيوان المؤسسية واستخدام اللجنة).
1-تجميع سوكنتس فونكتيوناليزيد
<ol><li>ميكس 1 ملغ من سوكنتس و 5 ملغ من دسب-PEG2000-أمين و 5 مل من الماء المعقم نوكلاس خالية في قنينة زجاج التﻷلؤ (20 مل). اهتز جيدا لحل جميع الموا?...

<ol>
	<li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system:+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis.">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li><li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy.">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li><li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+protein+transporters:+generality+and+biological+functionality.">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing.">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA:+an+investigation+of+the+uptake+mechanism+and+pathway.">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li><li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies.">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li><li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bright+side+of+dark+matter:+lncRNAs+in+cancer.">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li><li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma.">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li><li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma.">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175 (2015).</li><li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth.">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li><li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT-1,+a+novel+noncoding+RNA,+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer.">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li><li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas.">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li><li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing.">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163 (2009).</li><li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression.">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809 (2014).</li><li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma.">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+MALAT1/PARP1/LIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma.">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li><li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides.">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li><li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction.">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li><li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells.">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li><li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+modifications+in+multiple+myeloma:+recent+advances+on+the+role+of+DNA+and+histone+methylation.">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li><li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma.">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li><li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity.">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li><li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+approves+fomivirsen,+famciclovir,+and+Thalidomide.+Food+and+Drug+Administration.">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li><li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+new+drugs+for+homozygous+familial+hypercholesterolemia:+managing+benefits+and+risks+in+a+rare+disorder.">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li><li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Eteplirsen+for+Muscular+Dystrophy.">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480 (2017).</li><li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery.">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li><li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics.">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li><li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomedical+applications+of+functionalised+carbon+nanotubes.">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), 571-577 (2005).</li><li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods.">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li><li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes.">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li><li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pH-sensitive+poly(histidine)-PEG/DSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery.">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li><li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages.">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li><li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA.">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li><li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+reduction+of+disulfide+bonds+in+lysosomes:+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+(GILT).">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li><li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Membrane+perturbation+by+carbon+nanotube+insertion:+pathways+to+internalization.">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li><li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers.">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li><li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells.">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li><li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes:+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles.">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li><li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paradoxical+glomerular+filtration+of+carbon+nanotubes.">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li></ol>

وتبين الأدلة أن لنكرناس المشاركة في تنظيم العديد من إجراءات الفسيولوجية والفيزيولوجية المرضية في حالات السرطان، بما في ذلك مم7،،من89؛ لديهم القدرة على أن تكون هدفا لعلاج السرطان، التي يمكن أن تتحقق بالعقاقير النوكليوتيد20<sup...

سوكنت هو نانوماتيريال رواية التي يمكنها توفير أنواع مختلفة من المخدرات، مثل البروتينات، والجزيئات الصغيرة، والأحماض النووية، ستابلي وكفاءة مع قابلية التحمل مثالية وسمية الحد الأدنى في المختبر1 و المجراة في2. سوكنت فونكتيوناليزيد كبيرة ذات قابلية الذوبان في توافق مع الحياة والمياه ويمكن استخدامها مكوك لجزيئات أصغر، ويمكن حملها على اختراق غشاء الخلية3،،من45.
لنكرناس مجموعة من الحمض النووي الريبي (> 200 nt) التي يتم نسخها من الجينوم مرناً ولكن لا يمكن ترجمتها إلى بروتينات. تزايد الأدلة أظهرت أن لنكرناس المشاركة في تنظيم التعبير الجيني6 ويشاركون في البدء والتقدم لمعظم أنواع السرطان، بما في ذلك مم7،8،9. MALAT1 نسخة فضله التخصيب النووي 2 (NEAT2) و حفظت عاليا لنكرنا10. MALAT1 معترف بها في البداية في المنتشر الخلية الصغيرة غير الرئة السرطان (NSCLC)11، ولكن قد تم overexpressed في عدة أورام5،،من1213؛ هو واحد من لنكرناس أعرب عن أشد ويرتبط مع سوء تشخيص في مم8،14. مستوى التعبير MALAT1 أعلى بكثير في دورة فادح extramedullary مم المرضى مقارنة بتلك التي شخصت فقط ملم15.
في دراسة سابقة، وقد أكدنا أن أوليجوس MALAT1 مكافحة قوة تؤدي إلى تلف الحمض النووي والمبرمج في مم16 باستخدام الحمض النووي جابمير النوكليوتيد العقاقير تستهدف MALAT1 (مكافحة-MALAT1) في الخلايا ملم. الحمض النووي جابمير تتألف من الحمض النووي العقاقير وربط 2 '--OMe-الكشف، الذي يمكن أن يدفع الانقسام MALAT1 ب النشاط مرة ملزمة"رناسي ح"17. لا تزال حدود كفاءة المجراة في تسليم العقاقير أوليجوس في الاستخدام السريري.
لاختبار أداء فونكتيوناليزيد أثر سوكنت لمكافحة MALAT1 جابمير أوليجوس، جابمير MALAT1 المضادة هو مترافق الحمض النووي إلى دسبي-PEG2000-أمين سوكنت. ثم يتم حقن سوكنت-ضد-MALAT1 عن طريق الوريد في نموذج نشر ماوس مم؛ ويلاحظ تثبيط ملفتة للنظر بعد أربعة علاجات.

<table border="0" cellpadding="0" cellspacing="0" style="width:1168px;" width="1167">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:324px;">SWCNTs</td>
			<td style="width:199px;">Millipore-Sigma</td>
			<td style="width:209px;">704113</td>
			<td style="width:436px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DSPE-PEG2000-Amine</td>
			<td>Avanti Polar Lipids</td>
			<td>880128</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">bath sonicator</td>
			<td>VWR</td>
			<td>97043-992</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">4 mL centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>Z740208-8EA</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">UV/VIS spectrometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sulfo-LC-SPDP</td>
			<td>ProteoChem</td>
			<td>c1118</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DTT solution</td>
			<td>Millipore-Sigma</td>
			<td>43815</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NAP-5 column</td>
			<td>GE Healthcare</td>
			<td>17-0853-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">in vivo imaging system</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NOD.CB17-Prkdcscid/J mice</td>
			<td>Charles River lab</td>
			<td>250</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Flow cytometer</td>
			<td>Becton Dickinso</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Lipofectamine</td>
			<td>Invitrogen</td>
			<td>11668019</td>
			<td>Lipofectamine2000</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Fetal bovine serum (FBS)</td>
			<td>Invitrogen</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RMPI-1640 medium</td>
			<td>Invitrogen</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- GTTCTGATCCCGCTGCTATT - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- TCCTCAACACTCAGCCTTTATC - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CAAGAGCACAAGAGGAAGAGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CTACATGGCAACTGTGAGGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Quantitative PCR using SYBR Green PCR master mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25780</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RevertAid first-stand cDNA synthesis kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-MALAT1</td>
			<td>synthesized by IDT Company</td>
			<td></td>
			<td>5&#8217;-mC*mG*mA*mA*mA*C*A*T*T 
			*G*G*C*A*C*A*mC*mA*mG*mC*mA-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Viability Assay Kit</td>
			<td>Promega Corporation</td>
			<td>G7570</td>
			<td>CellTiter-GloLuminescent Cell Viability Assay Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SPSS software</td>
			<td>IBM</td>
			<td>version 24.0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Luciferin</td>
			<td>Millipore-Sigma</td>
			<td>L9504</td>
			<td></td>
		</tr>
	</tbody>
</table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

أنبوب نانوي واحد-الجدار الكربون (سوكنت) هو نوع جديد من نانوحبيبات، التي كانت تستخدم لتقديم أنواع متعددة من المخدرات داخل الخلايا، مثل البروتينات والنوكليوتيد والعقاقير الاصطناعية جزيء صغير. سوكنت أبعادا قابلة للتخصيص، مساحة سطحية كبيرة، ويمكن ربط مرونة مع المخدرات من خلال تعديلات مختلفة على سطحه؛ ولذلك، نظام مثالي لنقل الأدوية إلى خلايا. الكشف فضله منذ فترة طويلة (لنكرناس) مجموعة من الجيش الملكي النيبالي فضله أطول من 200 nt, التي لا يمكن ترجمتها إلى البروتين ولكنها تلعب دوراً هاما في العمليات البيولوجية والفيزيولوجية المرضية. الرئة المرتبطة بورم خبيث غدية نسخة 1 (MALAT1) لنكرنا عالية مصانة. وثبت أن مستويات أعلى من MALAT1 المرتبطة بسوء التشخيص لأنواع السرطان المختلفة، بما في ذلك الورم النخاعي المتعدد (مم). ونحن قد كشفت عن أن ينظم MALAT1 الموت خلية وإصلاح الحمض النووي في مم؛ وهكذا، يمكن اعتبار MALAT1 كهدف علاجي ملم. ومع ذلك، الكفاءة في تقديم اليغو العقاقير لتمنع/ضربة قاضية MALAT1 الحية في ما زال مشكلة. في هذه الدراسة، نحن تعديل سوكنت مع الوتد-2000 ومترافق اليغو MALAT1 المضادة لأنه اختبار إنجاز هذا المركب في المختبر، حقن الوريد مع نموذج ماوس مم نشرها والتقيد تثبيط كبيرة لتطور مم، مما يشير إلى أن سوكنت مكوكية تسليم مثالي لمكافحة MALAT1 جابمير الحمض النووي.

لإظهار تأثير تثبيط المضادة-MALAT1 جابمير الحمض النووي في مم، نحن ترسيتها على التعبير عن MALAT1 واستخدمه في الخلايا H929 و MM.1S. ثمان وأربعين ساعة في وقت لاحق، تم جمع الخلايا لتحليل كفاءة تدق لأسفل ووضع المبرمج في الخلايا transfected مع المضادة-MALAT1 جابمير أو مراقبة الحمض النووي. وأظهرت أ...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

توضح هذه المخطوطة توليف أنبوب نانوي واحد-الجدار الكربون (سوكنت)-مترافق MALAT1 جابمير العقاقير الحمض النووي اليغنوكليوتيد (سوكنت-ضد-MALAT1)، مما يدل على إيصال موثوقة سوكنت وقوية التأثير العلاجي ل مكافحة--MALAT1 في المختبر والمجراه. الأساليب المستخدمة للتوليف، والتعديل، والتصريف، وشرح لحقن سوكنت-مكافحة--MALAT1.

القمع لنمو الخلايا الورم النخاعي المتعدد في فيفو بالكربون واحد-جدار أنبوب نانوي (سوكنت)--تسليم العقاقير أوليجوس MALAT1

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

الطريقة التي نستخدمها هنا يمكن أن تساعد على حزمة oligonucleotide مع نانوتيوب الكربون واحد الجدار، وهو نوع جديد من الجسيمات النانوية لتسليم المخدرات. والميزة الرئيسية لهذه التقنية هي أكثر كفاءة تسليم الأدوية oligonucleotide في الخلايا في الجسم الحي. تمتد الآثار المترتبة على هذه التقنية إلى البحث في المايلوما المتعددة ، لأنها أدخلت جسيمات نانوية لتحسين تسليم أدوية oligonucleotide.من خلال هذه الطريقة يمكن أن توفر نظرة ثاقبة في علاج المايلوما المتعددة. ويمكن أيضا أن تطبق على الأمراض الأخرى ومترافقة مع غيرها من البضائع، مثل البروتينات والجزيئات الصغيرة. أولاً، اخلطي مليغراماً واحداً من الأنابيب النانوية الكربونية ذات الجدار الواحد، وخمس ملليغرام من قنين DSPE-PEG 2000، وخمس ملليلترات من المياه الخالية من النوى المعقمة في قارورة زجاجية من 20 ملليلتر.سونيكات القارورة في sonicator حمام مائي على مستوى الطاقة من 90 واط لمدة ساعة واحدة في درجة حرارة الغرفة. بعد سونيكيشن، الطرد المركزي القارورة في 24، 000 مرات ز لمدة ست ساعات. ثم جمع حل فائقة.إضافة ملليلتر واحد من حل نانوتيوب الكربون واحد الجدار إلى 100 كيلودالتون الجزيئية خفض الوزن المركزي جهاز تصفية تليها أربعة ملليلتر من المياه الخالية من النوى معقمة. جهاز طرد مركزي لمدة 10 دقائق في 4،000 ز مرات في درجة حرارة الغرفة لإزالة أمين الزائدة. إضافة 0.5 ملليغرام من Sulfo-LC-SPDP إلى 450 ميكرولترات من الأنابيب النانوية الكربونية أحادية الجدار ذات الجدار الواحد.ثم إضافة 50 ميكرولترات من برنامج تلفزيوني 10x، واحتضان لمدة ساعتين في درجة حرارة الغرفة. بعد ذلك، أضف خليط التفاعل إلى جهاز تصفية الطرد المركزي للوزن الجزيئي 100 كيلودالتون، يليه أربعة ملليلترات من المياه الخالية من النوى. الطرد المركزي العينة لمدة 10 دقائق في 4،000 ز مرات في درجة حرارة الغرفة لإزالة الزائدة Sulfo-LC-SPDP.جمع سولفو-LC-SPDP-معالجة أمين واحد جدار الكربون نانوتيتوب حل اليسار في التصفية، وتمييع مع 500 ميكرولترات من قبل أعدت المضادة لملا 1-Cy3 الحل. ثم احتضان العينة في أربع درجات مئوية بين عشية وضحاها. لتحقيق أفضل النتائج للمقارنة، وترتيب عشوائيا 14 الفئران في مجموعات تجريبية أو السيطرة مع سبعة في كل مجموعة، وبنفس نسبة الذكور إلى الإناث في كل مجموعة.المقبل، وتنظيف مقاعد البدلاء عملية وتعقيمه مع 70٪ إيثيل الكحول. استخدم مصباح تدفئة لتدفئة أحد الفئران لمساعدة الوريد الذيل على الظهور. تقييد الماوس بشكل صحيح مع حقن الذيل كبحة.حقن MM.1S-لوك/ mCherry الخلايا في 50 ميكرولترات من برنامج تلفزيوني من خلال الوريد الذيل. اضغط على موقع الحقن مع مسحة الكحول لمدة 30 ثانية. ثم وضع علامة على الفأرة المحقونة وإعادته إلى قفص نظيف.في اليوم السابع، بعد حقن الخلية MM1S، حقن 50 ميكرولترات من برنامج تلفزيوني يحتوي على أنبوب نانوي الكربون واحد الجدار المضادة لملا 1 في الوريد الذيل من الماوس. ثم اضغط على موقع الحقن مع مسحة الكحول لمدة 30 ثانية. مراقبة نزيف المحلية على الذيل والسلوك العام للماوس لمدة دقيقة واحدة، ومن ثم إعادته إلى قفص نظيف.مراقبة جميع الفئران حقن مرة أخرى قبل العودة القفص إلى الرف للتأكد من أن يتم التسامح مع الحقن بشكل جيد. وزن كل فأر قبل تشريح. جمع الدم المحيطي من القلب لإجراء فحص كامل لعدد الدم الذي يقوم به جهاز عداد خلايا الدم.بعد ذلك، جمع أنسجة نخاع العظام والطحال والعقدة الليمفاوية والكلى والأنسجة مع الانبثاث مرئية. استخراج الحمض النووي الريبي والبروتين من عينات نخاع العظام. إصلاح جميع الأنسجة المتبقية في formalin.بعد 24 ساعة من التثبيت، غمر عينات العظام في محلول EDTA 0.5 مولر لمدة خمسة أيام للتخويل. ثم تزج جميع العينات في 75٪ إيثيل الكحول للتخزين على المدى الطويل. أظهرت نتائج QRT PCR أن الحمض النووي مضادة لـ MALAT1 gapmeR أسقطت تعبير MALAT1 ومستحثة بمضادات المبرمجين بشكل كبير في خلايا H929 وMM.1S.تم تسليم أنبوب نانوي كربوني أحادي الجدار مضاد لملا 1-Cy3 في نواة خلايا MM ، وقمع بشكل كبير مستوى MALAT1 الداخلي في كل من خلايا H929 وMM.1S. إن قابلية الخلية BMEC-1 للبقاء ليس لها فرق كبير بعد علاج أنبوب الكربون النانوية المضاد لملا 1-Cy3 أو التحكم في جرعات ونقاط زمنية مختلفة. وهذا يشير إلى أن سمية أحادية الجدار الكربون نانوتيتوب المضادة ل-مالات1-Cy3 له سمية محدودة ومقبولة للخلايا الطبيعية في جرعة عالية.تم إنشاء نموذج فأرة نشرها MM الإنسان لتقييم آثار العلاج من الكربون أحادي الجدار نانوتيتوب مضادة لملا 1 في الجسم الحي. كانت إشارات لوسيفيرون للفئران في مجموعة المعالجة المضادة لـ MALAT1 أحادية الجدار منخفضة بشكل ملحوظ مقارنة بالتحكم بعد 21 يومًا من العلاج. من هذه النتائج، تم التوصل إلى أن وحيد الجدار الكربون نانوتيتوب المضادة لـ MALAT1 العلاج عن طريق الحقن الوريدي يمكن أن تقدم oligos المضادة لملاط1 إلى الخلايا السرطانية بشكل فعال.لم تلاحظ أي آثار جانبية كبيرة للعلاج ، مما يشير إلى أن حقنة نانوتيوب الكربون أحادية الجدار المضادة لملاT1 هي علاج آمن للفئران. أثناء محاولة هذا الإجراء، من المهم أن نتذكر أن تكوين جزيء الخلية سوف تؤثر على التسليم، والكفاءة، والتأثير العلاجي للعقاقير oligonucleotide. بعد هذا الإجراء، يمكن تنفيذ طرق أخرى مثل اقتران البروتينات أو الجزيئات الصغيرة من أجل الإجابة على أسئلة إضافية.مثل استخدام الأنابيب النانوية الكربونية ذات الجدار الواحد لتسليم أدوية أخرى.

Research

JoVE Journal

Cancer Research

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma (DIPG)

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma DIPG

بروتوكول للثقافة السريع بعد الوفاة خلية من منتشر الجوهرية جسري بالورم الدبقي (DIPG)

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a ...

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

في فيفو تقييم الجيش الشعبي الثوري لدرجة الحموضة، فس2، حالة الأكسدة والاختزال، وتركيزات الفوسفات والجلوتاثيون في "ورم المكروية"

This protocol demonstrates the capability of low-field electron paramagnetic resonance (EPR)-based techniques in combination with functional paramagnetic ...

Multimodal Bioluminescent and Positronic-emission Tomography/Computational Tomography Imaging of Multiple Myeloma Bone Marrow Xenografts in NOG Mice

التصوير التصوير المقطعي المتعدد الوسائط طرحه والانبعاثات Positronic التصوير المقطعي/الحسابية للورم النخاعي المتعدد تكثيفها نخاع العظام في الفئران وتد

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular ...

Neutrophil Extracellular Traps Generated by Low Density Neutrophils Obtained from Peritoneal Lavage Fluid Mediate Tumor Cell Growth and Attachment

الحصول على العَدلات الفخاخ خارج الخلية التي تم إنشاؤها بواسطة العَدلات منخفض الكثافة من الغسل البريتوني السوائل التوسط نمو الخلايا السرطانية والمرفقات

Activated neutrophils release neutrophil extracellular traps (NETs), which can capture and destroy microbes. Recent studies suggest that NETs are involved ...

Evaluation of Biomarkers in Glioma by Immunohistochemistry on Paraffin-Embedded 3D Glioma Neurosphere Cultures

تقييم المؤشرات الحيوية في الدبقي التي Immunohistochemistry على الثقافات نيوروسفيري جزءا لا يتجزأ من البارافين الدبقي 3D

Analysis of protein expression in glioma is relevant for several aspects in the study of its pathology. Numerous proteins have been described as ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

في تثبيط فيفو من MicroRNA لتقليل نمو الورم في الفئران

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

نموذج فأر للتحقيق في دور الخلايا الليفية المرتبطة بالسرطان في نمو الورم

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role ...

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

نموذج شريحة الدماغ خارج الجسم الحي لدراسة واستهداف سرطان الثدي نمو الورم النقيلي في الدماغ

Brain metastasis is a serious consequence of breast cancer for women as these tumors are difficult to treat and are associated with poor clinical ...

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

تحديد وظائف الجينات في تكوين الأورام عن طريق الاستئصال خارج الجسم الحي للأليلات المفلطحة في الخلايا السرطانية الخبيثة للغمد العصبي المحيطي

The development of new drugs that precisely target key proteins in human cancers is fundamentally altering cancer therapeutics. However, before these ...

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

في فيفو فحص المناعة للحويصلات خارج الخلية المشتقة من الورم عن طريق قياس التدفق الخلوي للخلايا التائية الطحالية

Immunogenic cell death of tumors, caused by chemotherapy or irradiation, can trigger tumor-specific T cell responses by releasing danger-associated ...