Name: repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos
Uploaded: 2018-12-13T13:00:00
Description: Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

De auteurs bedanken de Lerner Research Institute proteomic, genomic, en imaging kernen voor hun hulp en steun. Financiering: Dit werk werd financieel ondersteund door de NIH/NCI subsidie R00 CA172292 (J.J.Z.) en start-up middelen (J.J.Z.) en de klinisch en translationeel wetenschap Collaborative (CTSC) van de Case Western Reserve University Core gebruik Pilot subsidie (J.J.Z.). Dit werk gebruikt de Leica SP8 confocal microscoop die is gekocht met financiële steun van de nationale instituten van gezondheid SIG verlenen 1S10OD019972-01.

Alle experimenten met dieren waren vooraf door de Cleveland Kliniek IACUC (institutionele Animal Care en gebruik Comité).
1. synthese van matiemaatschappij SWCNTs
<ol><li>Meng 1 mg SWCNTs, DSPE-PEG2000-Amine 5 mg en 5 mL van gesteriliseerde nuclease-gratis water in een glazen Scintillatie ampul (20 mL). Schud het goed te ontbinden alle reagentia volledig.</li>
	<li>Bewerk de ampul in een water bad ultrasoonapparaat bij een energieniveau van 40 W gedurende 1 uur bij kamertemperatuur ultrason...

<ol>
	<li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system:+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis.">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li><li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy.">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li><li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+protein+transporters:+generality+and+biological+functionality.">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing.">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA:+an+investigation+of+the+uptake+mechanism+and+pathway.">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li><li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies.">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li><li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bright+side+of+dark+matter:+lncRNAs+in+cancer.">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li><li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma.">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li><li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma.">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175 (2015).</li><li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth.">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li><li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT-1,+a+novel+noncoding+RNA,+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer.">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li><li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas.">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li><li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing.">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163 (2009).</li><li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression.">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809 (2014).</li><li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma.">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+MALAT1/PARP1/LIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma.">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li><li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides.">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li><li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction.">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li><li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells.">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li><li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+modifications+in+multiple+myeloma:+recent+advances+on+the+role+of+DNA+and+histone+methylation.">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li><li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma.">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li><li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity.">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li><li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+approves+fomivirsen,+famciclovir,+and+Thalidomide.+Food+and+Drug+Administration.">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li><li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+new+drugs+for+homozygous+familial+hypercholesterolemia:+managing+benefits+and+risks+in+a+rare+disorder.">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li><li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Eteplirsen+for+Muscular+Dystrophy.">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480 (2017).</li><li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery.">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li><li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics.">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li><li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomedical+applications+of+functionalised+carbon+nanotubes.">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), 571-577 (2005).</li><li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods.">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li><li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes.">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li><li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pH-sensitive+poly(histidine)-PEG/DSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery.">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li><li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages.">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li><li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA.">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li><li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+reduction+of+disulfide+bonds+in+lysosomes:+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+(GILT).">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li><li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Membrane+perturbation+by+carbon+nanotube+insertion:+pathways+to+internalization.">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li><li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers.">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li><li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells.">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li><li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes:+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles.">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li><li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paradoxical+glomerular+filtration+of+carbon+nanotubes.">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li></ol>

Bewijs heeft aangetoond dat lncRNAs deelnemen aan de regeling van verschillende fysiologische en pathofysiologische procedures in kanker, met inbegrip van MM7,8,9; ze hebben het potentieel om voor de behandeling van kanker, die kan worden gerealiseerd door antisense oligonucleotides20,21,22worden gericht. De Amerikaanse Food and Drug Ad...

De SWCNT is een roman nanomateriaal die met ideale verdraagbaarheid en minimale toxiciteit in vitro1 en in vivo2verschillende soorten drugs, zoals proteïnen, kleine molecules en nucleïnezuren, stabiel en efficiënt kan leveren. Een functionalized SWCNT grote biocompatibiliteit en water oplosbaarheid heeft, kan worden gebruikt als een shuttle voor kleinere moleculen en kan ze doordringen in het celmembraan3,4,5.
lncRNAs zijn een cluster van RNA (> 200 nt) dat van het genoom zijn herschreven als mRNA maar kan niet worden omgezet in eiwitten. Een groeiende hoeveelheid bewijs heeft aangetoond dat lncRNAs deelnemen aan de regulering van gen expressie6 en betrokken bij de inleiding en de progressie van de meeste vormen van kanker zijn, met inbegrip van MM7,8,9. MALAT1 is een nucleaire verrijkte noncoding transcript 2 (NEAT2) en een zeer geconserveerde lncRNA10. MALAT1 is in eerste instantie erkend in uitgezaaide niet-kleincellige longkanker kanker (NKCLK)11, maar heeft zijn overexpressie in talrijke tumoren5,12,,13; het is een van de meest uitgesproken lncRNAs en is gecorreleerd met een slechte prognose in MM8,14. Het niveau van de expressie van het MALAT1 is aanzienlijk hoger bij fatale cursus extramedullary MM patiënten vergeleken met die alleen gediagnosticeerd als MM15.
In een eerdere studie, wij hebben bevestigd dat oligos van de anti-MALAT1 krachtig tot DNA-beschadiging en apoptosis in MM16 leiden met behulp van gapmer DNA antisense oligonucleotides gericht op MALAT1 (anti-MALAT1) in MM cellen. Het gapmer-DNA is samengesteld uit antisense DNA en verbonden door 2'-OMe-RNAs, die kon MALAT1 decollete gevraagd door RNase H activiteit eenmaal gebonden17. De efficiëntie van de in vivo levering van antisense oligos beperkt nog steeds haar klinische gebruik.
Als u wilt testen de levering matiemaatschappij effect van SWCNT voor anti-MALAT1 gapmer oligos, de anti-MALAT1-gapmer DNA is geconjugeerd met DSPE-PEG2000-amine SWCNT. De SWCNT-anti-MALAT1 wordt daarna intraveneus geïnjecteerd in een gedissemineerde muismodel van MM; een opvallende remming wordt waargenomen na vier behandelingen.

<table border="0" cellpadding="0" cellspacing="0" style="width:1168px;" width="1167">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:324px;">SWCNTs</td>
			<td style="width:199px;">Millipore-Sigma</td>
			<td style="width:209px;">704113</td>
			<td style="width:436px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DSPE-PEG2000-Amine</td>
			<td>Avanti Polar Lipids</td>
			<td>880128</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">bath sonicator</td>
			<td>VWR</td>
			<td>97043-992</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">4 mL centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>Z740208-8EA</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">UV/VIS spectrometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sulfo-LC-SPDP</td>
			<td>ProteoChem</td>
			<td>c1118</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DTT solution</td>
			<td>Millipore-Sigma</td>
			<td>43815</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NAP-5 column</td>
			<td>GE Healthcare</td>
			<td>17-0853-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">in vivo imaging system</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NOD.CB17-Prkdcscid/J mice</td>
			<td>Charles River lab</td>
			<td>250</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Flow cytometer</td>
			<td>Becton Dickinso</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Lipofectamine</td>
			<td>Invitrogen</td>
			<td>11668019</td>
			<td>Lipofectamine2000</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Fetal bovine serum (FBS)</td>
			<td>Invitrogen</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RMPI-1640 medium</td>
			<td>Invitrogen</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- GTTCTGATCCCGCTGCTATT - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- TCCTCAACACTCAGCCTTTATC - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CAAGAGCACAAGAGGAAGAGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CTACATGGCAACTGTGAGGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Quantitative PCR using SYBR Green PCR master mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25780</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RevertAid first-stand cDNA synthesis kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-MALAT1</td>
			<td>synthesized by IDT Company</td>
			<td></td>
			<td>5&#8217;-mC*mG*mA*mA*mA*C*A*T*T 
			*G*G*C*A*C*A*mC*mA*mG*mC*mA-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Viability Assay Kit</td>
			<td>Promega Corporation</td>
			<td>G7570</td>
			<td>CellTiter-GloLuminescent Cell Viability Assay Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SPSS software</td>
			<td>IBM</td>
			<td>version 24.0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Luciferin</td>
			<td>Millipore-Sigma</td>
			<td>L9504</td>
			<td></td>
		</tr>
	</tbody>
</table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

De single-muur koolstof nanobuis (SWCNT) is een nieuw soort nanoparticle, die is gebruikt voor het leveren van meerdere soorten drugs in cellen, zoals eiwitten, oligonucleotides en synthetische drugs van de kleine-molecuul. De SWCNT heeft van aanpasbare afmetingen, een groot oppervlakkige gebied, en flexibel kunt binden met drugs door verschillende wijzigingen op het oppervlak; Daarom is het een ideaal systeem voor het vervoer van drugs in cellen. Lang noncoding RNAs (lncRNAs) zijn een cluster van noncoding RNA langer dan 200 nt, die niet kan worden vertaald naar eiwit, maar een belangrijke rol spelen in de biologische en pathofysiologische processen. Metastase-geassocieerde Long adenocarcinoom transcript 1 (MALAT1) is een zeer geconserveerde lncRNA. Het bleek dat hogere MALAT1 niveaus zijn gerelateerd aan de slechte prognose van verschillende soorten kanker, met inbegrip van multipel myeloom (MM). We hebben aangetoond dat MALAT1 DNA-reparatie en cel dood in MM regelt; MALAT1 kan dus worden beschouwd als een therapeutisch doel voor MM. De efficiënte levering van de antisense oligo aan remmen/knockdown MALAT1 in vivo is echter nog steeds een probleem. In deze studie, wij wijzigen de SWCNT met PEG-2000 en conjugaat van een anti-MALAT1-oligo ernaar, de levering van dit samengestelde in vitro testen, het intraveneus te injecteren in een gedissemineerde muismodel van MM en observeren een significante remming van MM progressie, waarmee wordt aangegeven dat SWCNT is een ideale levering shuttle voor anti-MALAT1 gapmer DNA.

Om aan te tonen het effect van remming van anti-MALAT1 gapmer DNA in MM, we neergeslagen op de uitdrukking van MALAT1 en gebruikte het in H929 en MM.1S cellen. Achtenveertig uur later cellen werden verzameld voor de analyse van de efficiëntie van de knock-down en de status van apoptosis in cellen transfected met anti-MALAT1 gapmer of besturingselement DNA. qRT-PCR resultaten toonden dat anti-MALAT1 gapmer DNA de expressie van de MALAT1 in H929 en MM.1S cellen efficiënt neergeslagen<stro...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

Dit manuscript beschrijft de synthese van een single-muur koolstof nanobuis (SWCNT)-geconjugeerd MALAT1 antisense gapmer DNA oligonucleotide (SWCNT-anti-MALAT1), waaruit blijkt hoe de betrouwbare levering van de SWCNT en het krachtige therapeutische effect van anti-MALAT1 in vitro en in vivo. Methoden voor synthese, wijziging, conjugatie, en injectie van SWCNT-anti-MALAT1 worden beschreven.

Onderdrukking van Multiple Myeloma celgroei In Vivo door Single-muur koolstof nanobuis (SWCNT)-MALAT1 Antisense Oligos geleverd

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

De methode die we hier gebruiken kan helpen om oligonucleotide te verpakken met single-wall koolstof nanobuis, dat is een nieuw type nanodeeltje voor de levering van geneesmiddelen. Het belangrijkste voordeel van deze techniek is een efficiëntere levering van oligonucleotidegeneesmiddelen in cellen in vivo. De implicaties van deze techniek breiden zich uit tot onderzoek multipel myeloom, omdat het nanodeeltjes heeft geïntroduceerd om de levering van oligonucleotidegeneesmiddelen te verbeteren.Via deze methode kan inzicht geven in de behandeling van multipel myeloom. Het kan ook worden toegepast op andere ziekten en geconjugeerd met andere lading, zoals eiwitten en kleine moleculen. Meng eerst een milligram koolstofnanobuisjes met één muur, vijf milligram DSPE-PEG 2000 amine en vijf milliliter gesteriliseerd nucleasevrij water in een 20-milliliter glassnitel flacon.Soniceer de flacon in een waterbad sonicator op een vermogensniveau van 90 watt gedurende een uur bij kamertemperatuur. Na de sonicatie, centrifuge de flacon op 24,000 keer g gedurende zes uur. Verzamel vervolgens de supernatant oplossing.Voeg een milliliter van de single-wall koolstof nanobuis oplossing aan een 100-kilodalton moleculair gewicht cutoff centrifugaal filter apparaat gevolgd door vier milliliter gesteriliseerd nuclease-vrij water. Centrifuge gedurende 10 minuten bij 4.000 keer g bij kamertemperatuur om de overtollige amine te verwijderen. Voeg 0,5 milligram Sulfo-LC-SPDP toe aan 450 microliter van de amine-gefunctionaliseerde koolstofnanobuis met één muur.Voeg vervolgens 50 microliter van 10x PBS toe en broed gedurende twee uur bij kamertemperatuur. Voeg vervolgens het reactiemengsel toe aan een 100 kilodalton moleculair gewicht cutoff centrifugaalfilterapparaat, gevolgd door vier milliliter nuclease-vrij water. Centrifugeren het monster gedurende 10 minuten bij 4.000 keer g bij kamertemperatuur om het overtollige Sulfo-LC-SPDP te verwijderen.Verzamel de Sulfo-LC-SPDP-behandelde amine single-wall koolstofnanobuisoplossing die nog in het filter zit en verdun deze met 500 microliter eerder bereide anti-MALAT1-Cy3-oplossing. Dan incubeer het monster op vier graden Celsius 's nachts. Om de beste resultaten van vergelijking te bereiken, rangschik je willekeurig 14 muizen in proef- of controlegroepen met zeven in elke groep en met dezelfde man-vrouwverhouding in elke groep.Maak vervolgens de operatiebank schoon en steriliseer deze met 70% ethylalcohol. Gebruik een verwarmingslamp om een van de muizen op te warmen om de staartader te helpen verschijnen. Beperk de muis goed met een staartinjectie restrainer.Injecteer MM.1S-luc/mCherry cellen in 50 microliter PBS via de staartader. Druk 30 seconden met een alcoholuitstrijkje op de injectieplaats. Markeer vervolgens de geïnjecteerde muis en breng deze terug naar een schone kooi.Injecteer op dag zeven, na de MM1S-celinjectie, 50 microliter PBS met single-wall koolstofnanobuis anti-MALAT1 in de staartader van de muis. Druk vervolgens 30 seconden met een alcoholuitstrijkje op de injectieplaats. Observeer de lokale bloedingen op de staart en het algemene gedrag van de muis gedurende een minuut, en breng het vervolgens terug naar een schone kooi.Observeer alle geïnjecteerde muizen opnieuw voordat u de kooi terugbrengt naar het rek om ervoor te zorgen dat de injecties goed worden verdragen. Weeg elke muis voor dissectie. Verzamel perifeer bloed uit het hart voor een volledige bloedtelling test uitgevoerd door een bloedcel teller machine.Verzamel vervolgens de weefsels van het beenmerg, milt, lymfeklier, nier en het weefsel met zichtbare metastase. Haal RNA en eiwit uit de beenmergmonsters. Fix alle resterende weefsels in formaline.Na 24 uur fixatie, dompel de botmonsters gedurende vijf dagen onder in een EDTA-oplossing van 0,5 molar voor ontkalking. Dompel vervolgens alle monsters onder in 75% ethylalcohol voor langdurige opslag. QRT PCR resultaten toonden aan dat anti-MALAT1 gapmeR DNA de MALAT1-expressie neerhaalde en apoptose aanzienlijk veroorzaakte in H929- en MM.1S-cellen.Single-wall carbon nanotube anti-MALAT1-Cy3 werd geleverd in de kern van MM cellen, en aanzienlijk onderdrukt de endogene MALAT1 niveau in zowel H929 en MM.1S cellen. De levensvatbaarheid van BMEC-1 cel heeft geen significant verschil na de behandeling van single-wall koolstof nanobuis anti-MALAT1-Cy3 of controle bij verschillende doseringen en tijdpunten. Dit geeft aan dat de toxiciteit van single-wall koolstof nanobuis anti-MALAT1-Cy3 heeft een beperkte en aanvaardbare toxiciteit voor normale cellen bij hoge dosering.Er werd een menselijk MM-verspreid muismodel opgesteld om de behandelingseffecten van single-wall koolstofnanobuis anti-MALAT1 in vivo te evalueren. De luciferon signalen van muizen in de single-wall koolstof nanobuis anti-MALAT1 behandeling groep waren opmerkelijk lager in vergelijking met de controle na 21 dagen van de behandeling. Uit deze resultaten werd geconcludeerd dat de single-wall koolstofnanobuis anti-MALAT1 behandeling via intraveneuze injectie de anti-MALAT1 oligo's effectief aan tumorcellen kon leveren.Er werden geen significante bijwerkingen van de behandeling waargenomen, wat aangeeft dat single-wall koolstofnanobuis anti-MALAT1-injectie een veilige behandeling is voor muizen. Tijdens een poging tot deze procedure, is het belangrijk om te onthouden dat de celmolecuul samenstelling zal de levering, efficiëntie, en therapeutisch effect van de oligonucleotide drugs beïnvloeden. Na deze procedure kunnen andere methoden worden uitgevoerd, zoals vervoeging van eiwitten of kleine moleculen om aanvullende vragen te beantwoorden.Zoals het gebruik van single-wall koolstof nanobuisjes om andere medicijnen te leveren.

Research

JoVE Journal

Cancer Research

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma (DIPG)

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma DIPG

Een protocol voor snelle post-mortem Cell Culture of Diffuse Intrinsieke Pontine glioom (DIPG)

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a ...

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo EPR beoordeling van pH, pO2, Redox Status, en concentraties van fosfaat en glutathion in de communicatie van de Tumor

This protocol demonstrates the capability of low-field electron paramagnetic resonance (EPR)-based techniques in combination with functional paramagnetic ...

Multimodal Bioluminescent and Positronic-emission Tomography/Computational Tomography Imaging of Multiple Myeloma Bone Marrow Xenografts in NOG Mice

Multimodale bioluminescente en positronisch-emissie tomografie/computationele Tomography Imaging van Multiple Myeloma beenmerg Xenografts in NOG muizen

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular ...

Neutrophil Extracellular Traps Generated by Low Density Neutrophils Obtained from Peritoneal Lavage Fluid Mediate Tumor Cell Growth and Attachment

Neutrofiele extracellulaire Traps gegenereerd door lage dichtheid neutrofielen verkregen peritoneale Lavage vloeistof bemiddelen Tumor celgroei en bijlage

Activated neutrophils release neutrophil extracellular traps (NETs), which can capture and destroy microbes. Recent studies suggest that NETs are involved ...

Evaluation of Biomarkers in Glioma by Immunohistochemistry on Paraffin-Embedded 3D Glioma Neurosphere Cultures

Evaluatie van Biomarkers in Glioma door Immunohistochemistry op 3D Glioma paraffine-ingebedde Neurosphere culturen

Analysis of protein expression in glioma is relevant for several aspects in the study of its pathology. Numerous proteins have been described as ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

In vivo remming van MicroRNA te verminderen tumor groei bij muizen

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

Een muismodel om de rol van kanker-geassocieerde fibroblasten in tumorgroei te onderzoeken

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role ...

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

Een ex vivo hersenschijfmodel om borstkanker te bestuderen en te targeten Hersen gemetastaseerde tumorgroei

Brain metastasis is a serious consequence of breast cancer for women as these tumors are difficult to treat and are associated with poor clinical ...

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Het definiëren van genfuncties in tumorigenese door ex vivo ablatie van gevlochten allelen in kwaadaardige perifere zenuwschedetumorcellen

The development of new drugs that precisely target key proteins in human cancers is fundamentally altering cancer therapeutics. However, before these ...

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In vivo Immunogeniciteitsscreening van tumor-afgeleide extracellulaire blaasjes door flowcytometrie van milt-T-cellen

Immunogenic cell death of tumors, caused by chemotherapy or irradiation, can trigger tumor-specific T cell responses by releasing danger-associated ...