Name: repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos
Uploaded: 2018-12-13T13:00:00
Description: Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Les auteurs remercient l’Institut de recherche Lerner de protéomique, génomique et carottes d’imagerie pour leur aide et soutien. Financement : Ce travail a été soutenu financièrement par subvention de NIH/NCI R00 CA172292 (pour J.J.Z.) et fonds d’amorçage (à J.J.Z.) et la clinique et translationnelle Science Collaborative (CNTC) de la Case Western Reserve University Core utilisation pilote Grant (à J.J.Z.). Ce travail a utilisé le microscope confocal Leica SP8 qui a été acheté grâce à un financement des instituts nationaux de santé SIG grant 1S10OD019972-01.

Toutes les expériences impliquant des animaux ont été pré-approuvé par le Cleveland Clinic IACUC (Comité de l’emploi et animalier institutionnel).
1. synthèse du simple couche fonctionnalisés
<ol><li>Mélanger 1 mg de simple couche, 5 mg de DSPE-PEG2000-Amine et 5 mL d’eau exempte de nucléase stérilisée dans un flacon en verre de scintillation (20 mL). Secouez bien pour dissoudre tous les réactifs complètement.</li>
	<li>Laisser agir le flacon dans un sonicateur de bain d’...

<ol>
	<li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system:+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis.">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li><li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy.">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li><li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+protein+transporters:+generality+and+biological+functionality.">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing.">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA:+an+investigation+of+the+uptake+mechanism+and+pathway.">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li><li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies.">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li><li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bright+side+of+dark+matter:+lncRNAs+in+cancer.">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li><li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma.">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li><li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma.">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175 (2015).</li><li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth.">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li><li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT-1,+a+novel+noncoding+RNA,+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer.">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li><li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas.">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li><li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing.">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163 (2009).</li><li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression.">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809 (2014).</li><li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma.">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+MALAT1/PARP1/LIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma.">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li><li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides.">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li><li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction.">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li><li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells.">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li><li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+modifications+in+multiple+myeloma:+recent+advances+on+the+role+of+DNA+and+histone+methylation.">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li><li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma.">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li><li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity.">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li><li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+approves+fomivirsen,+famciclovir,+and+Thalidomide.+Food+and+Drug+Administration.">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li><li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+new+drugs+for+homozygous+familial+hypercholesterolemia:+managing+benefits+and+risks+in+a+rare+disorder.">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li><li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Eteplirsen+for+Muscular+Dystrophy.">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480 (2017).</li><li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery.">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li><li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics.">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li><li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomedical+applications+of+functionalised+carbon+nanotubes.">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), 571-577 (2005).</li><li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods.">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li><li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes.">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li><li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pH-sensitive+poly(histidine)-PEG/DSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery.">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li><li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages.">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li><li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA.">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li><li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+reduction+of+disulfide+bonds+in+lysosomes:+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+(GILT).">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li><li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Membrane+perturbation+by+carbon+nanotube+insertion:+pathways+to+internalization.">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li><li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers.">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li><li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells.">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li><li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes:+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles.">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li><li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paradoxical+glomerular+filtration+of+carbon+nanotubes.">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li></ol>

Preuve a démontré que les lncRNAs participent à la régulation de nombreuses procédures physiologiques et physiopathologiques dans les cancers, y compris MM7,8,9; Ils ont le potentiel d’être la cible pour le traitement du cancer, qui peut être réalisé par oligonucléotides antisens20,21,22. La U.S. Food and la Drug Administrat...

Le NCM est un nanomatériau roman qui peut fournir différents types de médicaments, comme les acides nucléiques, protéines et petites molécules stablement et efficacement avec la tolérabilité idéale et toxicité minimale1 de la vitro et in vivo2. Un SWCNT fonctionnalisé a grande solubilité de biocompatibilité et de l’eau, peut être utilisé comme un service de navette pour les molécules plus petites et peut transporter pour pénétrer la membrane de la cellule3,4,5.
lncRNAs sont un amas d’ARN (> 200 nt) qui sont transcrits à partir du génome à l’ARNm, mais ne peut pas être traduit en protéines. Augmentant la preuve a démontré que les lncRNAs participent à la régulation de l' expression de gène6 et sont impliqués dans l’apparition et la progression de la plupart des types de cancer, y compris MM7,8,9. MALAT1 est une transcription non codante nucléaire enrichi 2 (NEAT2) et un lncRNA hautement conservée10. MALAT1 est initialement reconnu métastatique pulmonaire non à petites cellules (NSCLC) le cancer11, mais a été surexprimé dans nombreuses tumeurs5,12,13; Il est l’un de le lncRNAs plus fortement exprimée et est corrélé à un mauvais pronostic en MM8,14. Le niveau d’expression de MALAT1 est significativement plus élevé chez les cours fatal extramédullaire MM par rapport à ceux diagnostiqués uniquement sous la forme MM15.
Dans une étude précédente, nous avons confirmé qu’anti-MALAT1 oligos conduire fermement pour dommages à l’ADN et l’apoptose dans MM16 en utilisant des oligonucléotides antisens d’ADN gapmer ciblage MALAT1 (anti-MALAT1) dans les cellules MM. L’ADN de gapmer est composé d’ADN antisens et relié par 2'-OMe-ARN, qui pourrait inciter un clivage MALAT1 par la RNase H activité liée une fois17. L’efficacité de livraison in vivo des oligonucléotides antisens limite toujours son utilisation clinique.
Pour tester la livraison effet de SWCNT pour anti-MALAT1 gapmer oligos, l’anti-MALAT1 gapmer ADN est conjugué à la DSPE-PEG2000-amine fonctionnalisés NCM. Le NCM-anti-MALAT1 est ensuite injectée par voie intraveineuse dans un modèle de souris disséminée MM ; On observe une inhibition frappante après quatre traitements.

<table border="0" cellpadding="0" cellspacing="0" style="width:1168px;" width="1167">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:324px;">SWCNTs</td>
			<td style="width:199px;">Millipore-Sigma</td>
			<td style="width:209px;">704113</td>
			<td style="width:436px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DSPE-PEG2000-Amine</td>
			<td>Avanti Polar Lipids</td>
			<td>880128</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">bath sonicator</td>
			<td>VWR</td>
			<td>97043-992</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">4 mL centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>Z740208-8EA</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">UV/VIS spectrometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sulfo-LC-SPDP</td>
			<td>ProteoChem</td>
			<td>c1118</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DTT solution</td>
			<td>Millipore-Sigma</td>
			<td>43815</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NAP-5 column</td>
			<td>GE Healthcare</td>
			<td>17-0853-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">in vivo imaging system</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NOD.CB17-Prkdcscid/J mice</td>
			<td>Charles River lab</td>
			<td>250</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Flow cytometer</td>
			<td>Becton Dickinso</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Lipofectamine</td>
			<td>Invitrogen</td>
			<td>11668019</td>
			<td>Lipofectamine2000</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Fetal bovine serum (FBS)</td>
			<td>Invitrogen</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RMPI-1640 medium</td>
			<td>Invitrogen</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- GTTCTGATCCCGCTGCTATT - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- TCCTCAACACTCAGCCTTTATC - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CAAGAGCACAAGAGGAAGAGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CTACATGGCAACTGTGAGGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Quantitative PCR using SYBR Green PCR master mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25780</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RevertAid first-stand cDNA synthesis kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-MALAT1</td>
			<td>synthesized by IDT Company</td>
			<td></td>
			<td>5&#8217;-mC*mG*mA*mA*mA*C*A*T*T 
			*G*G*C*A*C*A*mC*mA*mG*mC*mA-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Viability Assay Kit</td>
			<td>Promega Corporation</td>
			<td>G7570</td>
			<td>CellTiter-GloLuminescent Cell Viability Assay Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SPSS software</td>
			<td>IBM</td>
			<td>version 24.0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Luciferin</td>
			<td>Millipore-Sigma</td>
			<td>L9504</td>
			<td></td>
		</tr>
	</tbody>
</table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

Le nanotube de carbone monoparoi (NCM) est un nouveau type de nanoparticules, qui a été utilisé pour livrer plusieurs sortes de drogues dans les cellules, tels que des protéines, des oligonucléotides et médicaments à petites molécules synthétiques. Le NCM a dimensions personnalisables, une vaste zone superficielle et peut se lier avec souplesse avec des médicaments par le biais de différentes modifications sur sa surface ; par conséquent, c’est un système idéal pour transporter les médicaments dans les cellules. ARN long non codantes (lncRNAs) est un amas d’ARN non codant plu de 200 nt, qui ne peut pas être traduit en protéine, mais joue un rôle important dans les processus biologiques et physiopathologiques. Associées aux métastases pulmonaires adénocarcinome transcription 1 (MALAT1) est une lncRNA hautement conservée. Il a été démontré que des niveaux plus élevés de MALAT1 concernent le mauvais pronostic de divers cancers, notamment le myélome multiple (MM). Nous avons révélé que MALAT1 régule l’ADN réparation et la mort cellulaire en MM ; ainsi, MALAT1 peut être considéré comme une cible thérapeutique pour MM. Cependant, l’efficience de l’oligo antisens pour inhiber/knockdown MALAT1 in vivo est toujours un problème. Dans cette étude, nous modifier le NCM avec PEG-2000 et conjugué un oligo anti-MALAT1 à elle, tester la livraison de ce composé in vitro, injecter par voie intraveineuse dans un modèle de souris MM disséminé et observer une inhibition significative de la progression de MM, ce qui indique cette SWCNT est une navette de livraison idéal pour anti-MALAT1 gapmer ADN.

Pour démontrer l’effet d’inhibition de l’anti-MALAT1 gapmer ADN en MM, nous renversé l’expression de MALAT1 et utilisé dans les cellules H929 et MM.1S. Quarante-huit heures plus tard, les cellules ont été prélevés pour l’analyse de l’efficacité de la précipitation et le statut de l’apoptose dans les cellules transfectées avec gapmer anti-MALAT1 ou contrôle ADN. résultats qRT-PCR ont montré que les anti-MALAT1 gapmer ADN renversé efficacement l’expression de M...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

Ce manuscrit décrit la synthèse d’un nanotube de carbone monoparoi (NCM)-conjugué MALAT1 gapmer antisens ADN d’oligonucléotide (SWCNT-anti-MALAT1), qui montre la remise fiable du NCM et le puissant effet thérapeutique de anti-MALAT1 in vitro et in vivo. Méthodes utilisées pour la synthèse, de modification, de conjugaison, et injection de SWCNT-anti-MALAT1 sont décrites.

Répression de la croissance de cellules de myélome Multiple In Vivo par Nanotube de carbone monoparoi (NCM)-livré MALAT1 oligonucléotides antisens

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

La méthode que nous utilisons ici peut aider à emballer l’oligonucléotide avec nanotube de carbone à paroi unique, qui est un nouveau type de nanoparticule pour l’administration de médicaments. Le principal avantage de cette technique est la livraison plus efficace de médicaments oligonucléotides dans les cellules in vivo. Les implications de cette technique s’étendent à la recherche myélome multiple, parce qu’il est introduit nanoparticule pour améliorer la livraison de médicaments oligonucléotides.Grâce à cette méthode peut fournir un aperçu du traitement du myélome multiple. Il peut également être appliqué à d’autres maladies et conjugué avec d’autres cargaisons, telles que les protéines et les petites molécules. Tout d’abord, mélangez un milligramme de nanotubes de carbone à paroi unique, cinq milligrammes d’amine DSPE-PEG 2000 et cinq millilitres d’eau stérilisée sans nucléase dans un flacon de scintillation en verre de 20 millilitres.Sonicate le flacon dans un sonicator bain d’eau à un niveau de puissance de 90 watts pendant une heure à température ambiante. Après la sonication, centrifuger le flacon à 24 000 fois g pendant six heures. Ensuite, collecter la solution supernatant.Ajoutez un millilitre de la solution nanotube de carbone à paroi unique à un dispositif de filtre centrifuge de coupure de poids moléculaire de 100 kilodaltons suivi de quatre millilitres d’eau nucléase-libre stérilisée. Centrifugeuse pendant 10 minutes à 4000 fois g à température ambiante pour enlever l’excès d’amine. Ajouter 0,5 milligramme de Sulfo-LC-SPDP à 450 microlitres du nanotube de carbone à paroi unique fonctionnalisé par amine.Ajouter ensuite 50 microlitres de 10x PBS, et incuber pendant deux heures à température ambiante. Ensuite, ajoutez le mélange de réaction à un dispositif de filtre centrifuge de coupure de poids moléculaire de 100 kilodalton, suivi de quatre millilitres d’eau sans nucléase. Centrifuger l’échantillon pendant 10 minutes à 4000 fois g à température ambiante pour enlever l’excès Sulfo-LC-SPDP.Recueillir la solution nanotube de carbone à paroi unique Sulfo-LC-SPDP laissée dans le filtre et la diluer avec 500 microlitres de solution anti-MALAT1-Cy3 précédemment préparée. Puis incuber l’échantillon à quatre degrés Celsius pendant la nuit. Pour obtenir les meilleurs résultats de comparaison, organisez au hasard 14 souris en groupes d’essai ou de contrôle avec sept dans chaque groupe, et avec le même rapport homme-femme dans chaque groupe.Ensuite, nettoyez le banc d’opération et stérilisez-le avec 70% d’alcool éthylique. Utilisez une lampe chauffante pour réchauffer l’une des souris pour aider la veine de la queue à apparaître. Retenez la souris correctement à l’aide d’un restrainer d’injection de queue.Injecter des cellules MM.1S-luc/mCherry dans 50 microlitres de PBS par la veine de la queue. Appuyez sur le site d’injection avec un écouvillon d’alcool pendant 30 secondes. Ensuite, marquez la souris injectée et retournez-la dans une cage propre.Le septième jour, après l’injection de cellules MM1S, injectez 50 microlitres de PBS contenant un nanotube de carbone à paroi unique anti-MALAT1 dans la veine arrière de la souris. Appuyez ensuite sur le site d’injection avec un écouvillon d’alcool pendant 30 secondes. Observez le saignement local sur la queue et le comportement général de la souris pendant une minute, puis retournez-le dans une cage propre.Observez à nouveau toutes les souris injectées avant de retourner la cage sur la grille pour vous assurer que les injections sont bien tolérées. Pesez chaque souris avant la dissection. Recueillir le sang périphérique du cœur pour un test complet de dénombrement du sang effectué par une machine de compteur de cellules sanguines.Ensuite, recueillir les tissus de la moelle osseuse, la rate, le ganglion lymphatique, les reins, et le tissu avec des métastases visibles. Extraire l’ARN et les protéines des échantillons de moelle osseuse. Fixer tous les tissus restants dans la formaline.Après 24 heures de fixation, plonger les échantillons d’os dans une solution EDTA 0,5 molaire pendant cinq jours pour la décalcification. Plongez ensuite tous les échantillons dans de l’alcool éthylique à 75 % pour un entreposage à long terme. Les résultats de PCR de QRT ont prouvé que l’ADN gapmeR anti-MALAT1 a renversé l’expression malat1 et induit l’apoptose de manière significative dans les cellules H929 et MM.1S.Nanotube de carbone à paroi unique anti-MALAT1-Cy3 a été livré dans le noyau des cellules MM, et significativement supprimé le niveau endogène MALAT1 dans les cellules H929 et MM.1S. La viabilité de la cellule BMEC-1 n’a pas de différence significative après le traitement du nanotube de carbone à paroi unique anti-MALAT1-Cy3 ou le contrôle à différents dosages et points de temps. Cela indique que la toxicité du nanotube de carbone à paroi unique anti-MALAT1-Cy3 a une toxicité limitée et acceptable pour les cellules normales à forte dose.Un modèle humain de souris disséminées par MM a été établi pour évaluer les effets de traitement du nanotube de carbone à paroi unique anti-MALAT1 in vivo. Les signaux luciferon des souris dans le groupe de traitement anti-MALAT1 de nanotube de carbone à paroi unique étaient remarquablement inférieurs comparés au contrôle après 21 jours de traitement. De ces résultats, il a été conclu que le traitement anti-MALAT1 à nanotube de carbone à paroi unique par injection intraveineuse pourrait fournir efficacement les oligos anti-MALAT1 aux cellules tumorales.Aucun effet secondaire significatif du traitement n’a été observé, indiquant que l’injection anti-MALAT1 de nanotube de carbone à paroi unique est un traitement sûr pour des souris. Tout en essayant cette procédure, il est important de se rappeler que la composition de molécule cellulaire influencera la livraison, l’efficacité, et l’effet thérapeutique des drogues d’oligonucléotide. Suite à cette procédure, d’autres méthodes comme la conjugaison de protéines ou de petites molécules peuvent être réalisées afin de répondre à d’autres questions.Comme l’utilisation de nanotubes de carbone à paroi unique pour livrer d’autres médicaments.

Research

JoVE Journal

Cancer Research

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma (DIPG)

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma DIPG

Un protocole pour Rapid Post-mortem Culture cellulaire de Diffuse Intrinsic Pontine gliome (DIPG)

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a ...

Recherche

Recherche en cancérologie

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo Évaluation des EPR du pH, pO2, statut Redox et les Concentrations de Phosphate et de glutathion dans le microenvironnement tumoral

This protocol demonstrates the capability of low-field electron paramagnetic resonance (EPR)-based techniques in combination with functional paramagnetic ...

Multimodal Bioluminescent and Positronic-emission Tomography/Computational Tomography Imaging of Multiple Myeloma Bone Marrow Xenografts in NOG Mice

Multimodal bioluminescentes et émission positronique tomographie/Computational imagerie par tomographie des xénogreffes de moelle osseuse de myélome Multiple chez les souris NOG

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular ...

Neutrophil Extracellular Traps Generated by Low Density Neutrophils Obtained from Peritoneal Lavage Fluid Mediate Tumor Cell Growth and Attachment

Neutrophiles pièges extracellulaires générées par les neutrophiles faible densité obtient du liquide de Lavage péritonéal médiat attachement et la croissance des cellules tumorales

Activated neutrophils release neutrophil extracellular traps (NETs), which can capture and destroy microbes. Recent studies suggest that NETs are involved ...

Evaluation of Biomarkers in Glioma by Immunohistochemistry on Paraffin-Embedded 3D Glioma Neurosphere Cultures

Évaluation de biomarqueurs dans les gliomes par immunohistochimie sur la paraffine 3D gliome Neurosphère Cultures

Analysis of protein expression in glioma is relevant for several aspects in the study of its pathology. Numerous proteins have been described as ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice In Vivo

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

Un modèle murin pour étudier le rôle des fibroblastes associés au cancer dans la croissance tumorale

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role ...

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

Un modèle de tranche cérébrale ex vivo pour étudier et cibler la croissance tumorale métastatique du cancer du sein

Brain metastasis is a serious consequence of breast cancer for women as these tumors are difficult to treat and are associated with poor clinical ...

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Définition des fonctions géniques dans la tumorigenèse par ablation ex vivo d’allèles floxés dans des cellules tumorales malignes de la gaine nerveuse périphérique

The development of new drugs that precisely target key proteins in human cancers is fundamentally altering cancer therapeutics. However, before these ...

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In vivo Dépistage de l’immunogénicité des vésicules extracellulaires dérivées de tumeurs par cytométrie en flux de lymphocytes T spléniques

Immunogenic cell death of tumors, caused by chemotherapy or irradiation, can trigger tumor-specific T cell responses by releasing danger-associated ...