Name: repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos
Uploaded: 2018-12-13T13:00:00
Description: Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Die Autoren der Lerner Forschungsinstitut Proteomik, genomische, und bildgebenden Kerne für ihre Hilfe und Unterstützung danken. Finanzierung: Diese Arbeit wurde von NIH/NCI Stipendium R00 CA172292 (J.J.Z.) und Startkapital (zu J.J.Z.) und die klinische und translationale Wissenschaft Collaborative (CTSC) der Case Western Reserve University Core Auslastung Pilot Grant (zu J.J.Z.) finanziell unterstützt. Dabei verwendet der Leica SP8 confocal Mikroskop, das gekauft wurde, mit finanzieller Unterstützung von nationale Institute der Gesundheit SIG Grant 1S10OD019972-01.

Alle Experimente mit Tieren wurden vorab von der Cleveland Clinic IACUC (institutionelle Animal Care und Use Committee) genehmigt.
1. Synthese funktionalisierter SWCNTs
<ol><li>Mischen Sie 1 mg SWCNTs, 5 mg DSPE-PEG2000-Amin und 5 mL sterilisiert Nuklease-freies Wasser in ein Glas funkeln Fläschchen (20 mL). Schütteln Sie es gut auf alle Reagenzien vollständig auflösen.</li>
	<li>Beschallen Sie das Fläschchen in einem Wasser-Bad-Sonikator einer Sendeleistung von 40 Watt für 1 h bei Rau...

<ol>
	<li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system:+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis.">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li><li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy.">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li><li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+protein+transporters:+generality+and+biological+functionality.">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing.">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA:+an+investigation+of+the+uptake+mechanism+and+pathway.">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li><li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies.">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li><li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bright+side+of+dark+matter:+lncRNAs+in+cancer.">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li><li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma.">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li><li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma.">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175 (2015).</li><li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth.">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li><li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT-1,+a+novel+noncoding+RNA,+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer.">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li><li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas.">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li><li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing.">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163 (2009).</li><li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression.">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809 (2014).</li><li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma.">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+MALAT1/PARP1/LIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma.">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li><li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides.">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li><li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction.">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li><li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells.">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li><li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+modifications+in+multiple+myeloma:+recent+advances+on+the+role+of+DNA+and+histone+methylation.">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li><li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma.">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li><li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity.">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li><li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+approves+fomivirsen,+famciclovir,+and+Thalidomide.+Food+and+Drug+Administration.">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li><li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+new+drugs+for+homozygous+familial+hypercholesterolemia:+managing+benefits+and+risks+in+a+rare+disorder.">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li><li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Eteplirsen+for+Muscular+Dystrophy.">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480 (2017).</li><li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery.">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li><li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics.">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li><li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomedical+applications+of+functionalised+carbon+nanotubes.">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), 571-577 (2005).</li><li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods.">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li><li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes.">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li><li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pH-sensitive+poly(histidine)-PEG/DSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery.">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li><li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages.">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li><li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA.">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li><li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+reduction+of+disulfide+bonds+in+lysosomes:+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+(GILT).">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li><li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Membrane+perturbation+by+carbon+nanotube+insertion:+pathways+to+internalization.">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li><li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers.">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li><li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells.">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li><li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes:+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles.">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li><li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paradoxical+glomerular+filtration+of+carbon+nanotubes.">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li></ol>

Beweis hat gezeigt, dass bei der Regulierung der zahlreiche physiologische und pathophysiologische Prozesse im Krebs, einschließlich MM7,8,9LncRNAs teilnehmen; Sie haben das Potenzial für die Krebsbehandlung, ausgerichtet werden, die von antisense Oligonukleotide20,21,22realisiert werden können. Die US Food and Drug Administration (F...

Die SWCNT ist eine neuartige Nanomaterialien, die verschiedenen Arten von Drogen, wie Proteine, kleine Moleküle und Nukleinsäuren, stabil und effizient mit ideale Verträglichkeit und minimale Toxizität in Vitro1 und in-vivo2liefern kann. Funktionalisierten SWCNT kann hat große Biokompatibilität und Wasser Löslichkeit, kann als ein Shuttle für kleinere Moleküle verwendet werden, und sie dringen in die Zellmembran3,4,5.
LncRNAs sind eine Gruppe von RNA (> 200 nt), die aus dem Genom zu mRNA transkribiert werden, aber nicht in Proteine übersetzt werden. Erhöhung der Beweis hat gezeigt, dass LncRNAs in der Regulation der Gene Expression6 beteiligen und engagieren sich in der Initiierung und Progression der meisten Arten von Krebs, einschließlich MM7,8,9. MALAT1 ist ein nuklearer bereichert forensisches Transkript 2 (NEAT2) und einer hoch konservierten LncRNA10. MALAT1 wird zunächst im metastasierten nicht-kleinzelligen Lungenkrebs (NSCLC) Krebs11erkannt, aber hat in zahlreichen Tumoren5,12,13überexprimiert wurden; Es ist eines der höchst exprimierten LncRNAs und korreliert mit einer schlechten Prognose in MM8,14. Die Expression des MALAT1 ist signifikant höher bei tödlichen Kurs extramedulläre MM Patienten im Vergleich zu denen nur als MM15diagnostiziert.
In einer früheren Studie haben wir bestätigt, dass Anti-MALAT1 Oligos robust zu DNA-Schäden und Apoptose in MM16 führen mithilfe von Gapmer DNA antisense Oligonucleotides targeting MALAT1 (Anti-MALAT1) in MM-Küvetten. Die Gapmer DNA besteht aus antisense-DNA und verbunden durch 2'-OMe-RNAs, die MALAT1 Spaltung durch RNase H-Aktivität nach der Bindung17veranlassen könnte. Die in-vivo Transporteffizienz antisense Oligos begrenzt noch seiner klinischen Verwendung.
Um die Lieferung zu testen SWCNT-Effekt für Anti-MALAT1 Gapmer Oligos, die Anti-MALAT1-Gapmer, die DNA zu DSPE-PEG2000-Amin konjugiert wird funktionalisiert SWCNT. SWCNT-Anti-MALAT1 wird in einem MM disseminierter Mausmodell dann intravenös injiziert; eine markante Hemmung wird nach vier Behandlungen beobachtet.

<table border="0" cellpadding="0" cellspacing="0" style="width:1168px;" width="1167">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:324px;">SWCNTs</td>
			<td style="width:199px;">Millipore-Sigma</td>
			<td style="width:209px;">704113</td>
			<td style="width:436px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DSPE-PEG2000-Amine</td>
			<td>Avanti Polar Lipids</td>
			<td>880128</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">bath sonicator</td>
			<td>VWR</td>
			<td>97043-992</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">4 mL centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>Z740208-8EA</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">UV/VIS spectrometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sulfo-LC-SPDP</td>
			<td>ProteoChem</td>
			<td>c1118</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DTT solution</td>
			<td>Millipore-Sigma</td>
			<td>43815</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NAP-5 column</td>
			<td>GE Healthcare</td>
			<td>17-0853-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">in vivo imaging system</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NOD.CB17-Prkdcscid/J mice</td>
			<td>Charles River lab</td>
			<td>250</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Flow cytometer</td>
			<td>Becton Dickinso</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Lipofectamine</td>
			<td>Invitrogen</td>
			<td>11668019</td>
			<td>Lipofectamine2000</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Fetal bovine serum (FBS)</td>
			<td>Invitrogen</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RMPI-1640 medium</td>
			<td>Invitrogen</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- GTTCTGATCCCGCTGCTATT - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- TCCTCAACACTCAGCCTTTATC - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CAAGAGCACAAGAGGAAGAGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CTACATGGCAACTGTGAGGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Quantitative PCR using SYBR Green PCR master mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25780</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RevertAid first-stand cDNA synthesis kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-MALAT1</td>
			<td>synthesized by IDT Company</td>
			<td></td>
			<td>5&#8217;-mC*mG*mA*mA*mA*C*A*T*T 
			*G*G*C*A*C*A*mC*mA*mG*mC*mA-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Viability Assay Kit</td>
			<td>Promega Corporation</td>
			<td>G7570</td>
			<td>CellTiter-GloLuminescent Cell Viability Assay Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SPSS software</td>
			<td>IBM</td>
			<td>version 24.0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Luciferin</td>
			<td>Millipore-Sigma</td>
			<td>L9504</td>
			<td></td>
		</tr>
	</tbody>
</table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

Die einwandigen Kohlenstoff-Nanoröhrchen (SWCNT) ist eine neue Art von Nanopartikel, die verwendet wurde, um mehrere Arten von Drogen in Zellen, wie Proteine, Oligonukleotide und synthetischen kleinen Molekül-Drogen zu liefern. Die SWCNT verfügt über anpassbare Dimensionen, oberflächliche großflächig und kann flexibel mit Drogen durch verschiedene Modifikationen an seiner Oberfläche binden; Daher ist es ein ideales System, Medikamente in die Zellen zu transportieren. Lange forensisches RNAs (LncRNAs) sind eine Gruppe von mehr als 200 nichtcodierender RNA nt, die nicht in Protein übersetzt werden, sondern spielen eine wichtige Rolle in biologischen und pathophysiologischen Prozessen. Metastasen-assoziierten Lunge Adenokarzinom Transkript 1 (MALAT1) ist eine hoch konservierte LncRNA. Es konnte gezeigt werden, dass höhere MALAT1 die schlechte Prognose der verschiedenen Krebsarten, einschließlich Multiples Myelom (MM) verbunden sind. Wir haben gezeigt, dass MALAT1 DNA-Reparatur und Zelle Tod im MM regelt; So können MALAT1 als ein therapeutisches Ziel für MM betrachtet werden. Die effiziente Bereitstellung von antisense Oligo zu hemmen/Zuschlag MALAT1 in-vivo ist jedoch nach wie vor ein Problem. In dieser Studie wir SWCNT mit PEG-2000 zu ändern und eine Anti-MALAT1-Oligo zu konjugieren, testen die Lieferung dieses mittels in-vitro-injizieren es intravenös in einem verbreiteten MM-Maus-Modell und beobachten eine deutliche Hemmung der MM-Progression, was darauf hindeutet Diese SWCNT ist eine ideale Lieferung-Shuttle für Anti-MALAT1 Gapmer DNA.

Um die Wirkung der Hemmung der Anti-MALAT1 Gapmer DNA in MM zu demonstrieren, wir die Expression von MALAT1 abgerissen und in H929 und MM.1S Zellen verwendet. Achtundvierzig Stunden später wurden Zellen für die Analyse der Knock-down Effizienz und der Status der Apoptose in Zellen mit Anti-MALAT1 Gapmer oder Kontrolle DNA transfiziert. qRT-PCR-Ergebnisse zeigten, dass der MALAT1 Ausdruck in H929 und MM.1S Zellen effizient Anti-MALAT1 Gapmer DNA abgerissen (Abb. 2</s...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

Dieses Manuskript beschreibt die Synthese von einem einwandigen Kohlenstoff-Nanoröhrchen (SWCNT)-konjugiert MALAT1 antisense Gapmer DNA-Oligonukleotid (SWCNT-Anti-MALAT1), welche die zuverlässige Zustellung der SWCNT und potente Wirkung des zeigt Anti-MALAT1 in vitro und in vivo. Methoden zur Synthese, Modifikation, Konjugation und Injektion von SWCNT-Anti-MALAT1 werden beschrieben.

Unterdrückung des multiplen Myeloms Zellwachstum In Vivo durch Single-Wall Carbon Nanotube (SWCNT)-MALAT1 Antisense Oligos geliefert

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

Die Methode, die wir hier verwenden, kann helfen, Oligonukleotid mit einwandigem Kohlenstoff-Nanorohr zu verpacken, das eine neue Art von Nanopartikeln für die Medikamentenabgabe ist. Der Hauptvorteil dieser Technik ist eine effizientere Abgabe von Oligonukleotid-Medikamenten in Zellen in vivo. Die Implikationen dieser Technik erstrecken sich auf die Forschung multiples Myelom, weil es Nanopartikel eingeführt hat, um die Abgabe von Oligonukleotid-Medikamenten zu verbessern.Durch diese Methode kann Einblick in die Behandlung von multiplem Myelom geben. Es kann auch auf andere Krankheiten angewendet und mit anderen Ladungen konjugiert werden, wie Proteine und kleine Moleküle. Mischen Sie zunächst ein Milligramm einwandiges Kohlenstoff-Nanoröhren, fünf Milligramm DSPE-PEG 2000-Amin und fünf Milliliter sterilisiertes Nuklease-freies Wasser in einer 20-Milliliter-Glas-Szintillationsdurchstechflasche.Beschallen Sie die Durchstechflasche in einem Wasserbad-Sonicator bei einem Leistungsniveau von 90 Watt für eine Stunde bei Raumtemperatur. Zentrieren Sie die Durchstechflasche nach der Beschallung sechs Stunden lang mit 24.000 mal g. Dann sammeln Sie die Überstand-Lösung.Fügen Sie einen Milliliter der einwandigen Kohlenstoff-Nanoröhrenlösung zu einem 100-Kilodalton-Molekulargewichts-Cutoff-Zentrifugalfiltergerät hinzu, gefolgt von vier Millilitern sterilisiertem nukleasefreiem Wasser. Zentrifuge für 10 Minuten bei 4.000 mal g bei Raumtemperatur, um den überschüssigen Amin zu entfernen. Fügen Sie 0,5 Milligramm Sulfo-LC-SPDP zu 450 Mikrolitern der amin-funktionalisierten einwandigen Kohlenstoff-Nanoröhre hinzu.Dann 50 Mikroliter 10x PBS hinzufügen und zwei Stunden bei Raumtemperatur inkubieren. Als nächstes fügen Sie das Reaktionsgemisch zu einem 100-Kilodalton-Molekulargewichts-Cutoff-Zentrifugalfiltergerät hinzu, gefolgt von vier Millilitern nukleasefreiem Wasser. Zentrifugieren Sie die Probe für 10 Minuten bei 4.000 mal g bei Raumtemperatur, um den überschüssigen Sulfo-LC-SPDP zu entfernen.Sammeln Sie die Sulfo-LC-SPDP-behandelte Amin-Einwand-Kohlenstoff-Nanoröhrenlösung, die im Filter verbleibt, und verdünnen Sie sie mit 500 Mikrolitern zuvor hergestellter Anti-MALAT1-Cy3-Lösung. Dann inkubieren Sie die Probe bei vier Grad Celsius über Nacht. Um die besten Vergleichsergebnisse zu erzielen, ordnen Sie nach dem Zufallsprinzip 14 Mäuse in Versuchs- oder Kontrollgruppen mit sieben in jeder Gruppe und mit dem gleichen Verhältnis von Mann zu Frau in jeder Gruppe an.Als nächstes reinigen Sie die Operationsbank und sterilisieren Sie sie mit 70% Ethylalkohol. Verwenden Sie eine Heizlampe, um eine der Mäuse zu erwärmen, um die Schwanzvene erscheinen zu helfen. Halten Sie die Maus richtig mit einem Schwanz Injektion Restrainer.Injizieren Sie MM.1S-luc/mCherry-Zellen in 50 Mikroliter PBS durch die Schwanzvene. Drücken Sie die Injektionsstelle mit einem Alkoholtupfer für 30 Sekunden. Markieren Sie dann die injizierte Maus und geben Sie sie in einen sauberen Käfig zurück.Am siebten Tag, nach der MM1S-Zellinjektion, injizieren Sie 50 Mikroliter PBS, die einwandige Kohlenstoff-Nanoröhren anti-MALAT1 enthalten, in die Schwanzvene der Maus. Drücken Sie dann die Injektionsstelle mit einem Alkoholtupfer für 30 Sekunden. Beobachten Sie die lokale Blutung am Schwanz und das allgemeine Verhalten der Maus für eine Minute, und geben Sie sie dann in einen sauberen Käfig zurück.Beobachten Sie alle injizierten Mäuse erneut, bevor Sie den Käfig ins Rack zurückbringen, um sicherzustellen, dass die Injektionen gut vertragen werden. Wägen Sie jede Maus vor der Zerlegung. Sammeln Sie peripheres Blut aus dem Herzen für einen vollständigen Blutbild-Assay, der von einer Blutkörperchen-Zählermaschine durchgeführt wird.Als nächstes sammeln Sie die Gewebe des Knochenmarks, der Milz, des Lymphknotens, der Niere und des Gewebes mit sichtbarer Metastasierung. Extrahieren Sie RNA und Protein aus den Knochenmarkproben. Fixieren Sie alle verbleibenden Gewebe in Formalin.Nach 24 Stunden Fixierung die Knochenproben zur Entkalkung fünf Tage lang in eine 0,5-molar-EDTA-Lösung eintauchen. Dann tauchen Sie alle Proben in 75%Ethylalkohol für die langfristige Lagerung. QRT PCR-Ergebnisse zeigten, dass Anti-MALAT1-GapmeR-DNA die MALAT1-Expression niederschlug und Apoptose in H929- und MM.1S-Zellen signifikant induzierte.Einwandiges Kohlenstoff-Nanorohr-Anti-MALAT1-Cy3 wurde in den Zellkern von MM-Zellen geliefert und unterdrückte den endogenen MALAT1-Spiegel sowohl in H929- als auch mm.1S-Zellen signifikant. Die Lebensfähigkeit der BMEC-1-Zelle hat keinen signifikanten Unterschied nach der Behandlung von einwandigen Kohlenstoff-Nanoröhren-Anti-MALAT1-Cy3 oder Kontrolle bei verschiedenen Dosierungen und Zeitpunkten. Dies deutet darauf hin, dass die Toxizität von einwandigen Kohlenstoff-Nanoröhren anti-MALAT1-Cy3 hat eine begrenzte und akzeptable Toxizität für normale Zellen bei hoher Dosierung.Ein menschliches MM-disseminiertes Mausmodell wurde erstellt, um die Behandlungseffekte von einwandigen Kohlenstoff-Nanoröhren anti-MALAT1 in vivo zu bewerten. Die Luziferonsignale von Mäusen in der einwandigen Kohlenstoff-Nanoröhren-Anti-MALAT1-Behandlungsgruppe waren im Vergleich zur Kontrolle nach 21 Behandlungstagen deutlich niedriger. Aus diesen Ergebnissen wurde geschlossen, dass die einwandige Kohlenstoff-Nanorohr-Anti-MALAT1-Behandlung mittels intravenöser Injektion die Anti-MALAT1-Oligos effektiv an Tumorzellen liefern könnte.Es wurden keine signifikanten Nebenwirkungen der Behandlung beobachtet, was darauf hindeutet, dass einwandige Kohlenstoff-Nanoröhren-Anti-MALAT1-Injektion eine sichere Behandlung für Mäuse ist. Beim Versuch dieses Verfahrens ist es wichtig, sich daran zu erinnern, dass die Zusammensetzung des Zellmoleküls die Lieferung, Effizienz und therapeutische Wirkung der Oligonukleotid-Medikamente beeinflussen wird. Nach diesem Verfahren können andere Methoden wie die Konjugation von Proteinen oder kleinen Molekülen durchgeführt werden, um zusätzliche Fragen zu beantworten.Wie die Verwendung von einwandigen Kohlenstoff-Nanoröhren, um andere Medikamente zu liefern.

Research

JoVE Journal

Cancer Research

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma (DIPG)

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma DIPG

Ein Protokoll für schnelle Post-mortem-Zellkultur von Diffuse Intrinsic Ponsgliom (DIPG)

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a ...

Forschung

Krebsforschung

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo EPR-Bewertung der pH, pO2, Redox-Status, und Konzentrationen von Phosphat und Glutathion in der Tumor-Mikroumgebung

This protocol demonstrates the capability of low-field electron paramagnetic resonance (EPR)-based techniques in combination with functional paramagnetic ...

Multimodal Bioluminescent and Positronic-emission Tomography/Computational Tomography Imaging of Multiple Myeloma Bone Marrow Xenografts in NOG Mice

Multimodale Biolumineszenz und Positronic-Emissions-Tomographie/Computational Tomographie Bildgebung des multiplen Myeloms Knochenmark Xenotransplantate NOG Mäuse

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular ...

Neutrophil Extracellular Traps Generated by Low Density Neutrophils Obtained from Peritoneal Lavage Fluid Mediate Tumor Cell Growth and Attachment

Neutrophilenzahl extrazelluläre fallen durch geringe Dichte Neutrophilen erzeugt gewonnenen Peritoneal Lavage Fluid vermitteln Tumor Zellwachstum und Anlage

Activated neutrophils release neutrophil extracellular traps (NETs), which can capture and destroy microbes. Recent studies suggest that NETs are involved ...

Evaluation of Biomarkers in Glioma by Immunohistochemistry on Paraffin-Embedded 3D Glioma Neurosphere Cultures

Bewertung von Biomarkern in Gliom von Immunohistochemistry auf Paraffin-eingebetteten 3D Gliom Neurosphäre Kulturen

Analysis of protein expression in glioma is relevant for several aspects in the study of its pathology. Numerous proteins have been described as ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

In Vivo Hemmung von MicroRNA zur Verringerung des Tumorwachstums bei Mäusen

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

Ein Mausmodell zur Untersuchung der Rolle krebsassoziierter Fibroblasten beim Tumorwachstum

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role ...

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

Ein Ex-vivo-Gehirnschnittmodell zur Untersuchung und Bekämpfung des metastasierenden Tumorwachstums von Brustkrebs im Gehirn

Brain metastasis is a serious consequence of breast cancer for women as these tumors are difficult to treat and are associated with poor clinical ...

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Definition von Genfunktionen in der Tumorgenese durch Ex-vivo-Ablation von Flox-Allelen in bösartigen peripheren Nervenscheidentumorzellen

The development of new drugs that precisely target key proteins in human cancers is fundamentally altering cancer therapeutics. However, before these ...

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

Im lebenden Organismus Immunogenitätsscreening von tumorabgeleiteten extrazellulären Vesikeln durch Durchflusszytometrie von Milz-T-Zellen

Immunogenic cell death of tumors, caused by chemotherapy or irradiation, can trigger tumor-specific T cell responses by releasing danger-associated ...