Name: repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos
Uploaded: 2018-12-13T13:00:00
Description: Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

המחברים תודה את המכון לחקר לרנר פרוטיאומיה מבנית, גנומית, ואת ההדמיה ליבות לסיוע שלהם ותמיכה. מימון: עבודה זו נתמכה כלכלית על ידי NIH/NCI מענק R00 CA172292 (J.J.Z.) ואת ראשונית (ל J.J.Z.) ואת קלינית Translational המדע שיתופית (CTSC) של התיק Western Reserve אוניברסיטת הליבה ניצול טייס גרנט (ל J.J.Z.). עבודה זו מנוצל מיקרוסקופ קונפוקלי SP8 לייקה אשר נרכש עם מימון מוסדות לאומיים של בריאות סיג גרנט 1S10OD019972-01.

כל הניסויים המערבות בעלי חיים אושרו מראש על-ידי IACUC מרפאת קליבלנד (אכפת לי חיה המוסדית והוועדה שימוש).
1. סינתזה של Functionalized SWCNTs
<ol><li>מערבבים 1 מ ג של SWCNTs, 5 מ"ג של DSPE-PEG2000-אמין ו 5 מ ל מים נטולי נוקלאז סטיריליים בקבוקון נצנוץ זכוכית (20 מ ל). לנער את זה טוב כדי להמיס כל ריאגנטים לחלוטי...

<ol>
	<li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system:+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis.">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li><li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy.">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li><li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+protein+transporters:+generality+and+biological+functionality.">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing.">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA:+an+investigation+of+the+uptake+mechanism+and+pathway.">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li><li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies.">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li><li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bright+side+of+dark+matter:+lncRNAs+in+cancer.">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li><li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma.">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li><li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma.">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175 (2015).</li><li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth.">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li><li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT-1,+a+novel+noncoding+RNA,+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer.">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li><li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas.">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li><li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing.">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163 (2009).</li><li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression.">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809 (2014).</li><li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma.">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+MALAT1/PARP1/LIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma.">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li><li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides.">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li><li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction.">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li><li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells.">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li><li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+modifications+in+multiple+myeloma:+recent+advances+on+the+role+of+DNA+and+histone+methylation.">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li><li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma.">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li><li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity.">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li><li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+approves+fomivirsen,+famciclovir,+and+Thalidomide.+Food+and+Drug+Administration.">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li><li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+new+drugs+for+homozygous+familial+hypercholesterolemia:+managing+benefits+and+risks+in+a+rare+disorder.">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li><li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Eteplirsen+for+Muscular+Dystrophy.">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480 (2017).</li><li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery.">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li><li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics.">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li><li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomedical+applications+of+functionalised+carbon+nanotubes.">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), 571-577 (2005).</li><li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods.">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li><li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes.">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li><li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pH-sensitive+poly(histidine)-PEG/DSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery.">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li><li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages.">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li><li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA.">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li><li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+reduction+of+disulfide+bonds+in+lysosomes:+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+(GILT).">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li><li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Membrane+perturbation+by+carbon+nanotube+insertion:+pathways+to+internalization.">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li><li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers.">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li><li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells.">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li><li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes:+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles.">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li><li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paradoxical+glomerular+filtration+of+carbon+nanotubes.">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li></ol>

הראיות הוכיחו כי lncRNAs לקחת חלק מרכזי בויסות פיזיולוגיים רבים ושגרות pathophysiological ב סרטן, כולל7,מ מ8,9; יש להם פוטנציאל להיות ממוקד לטיפול בסרטן, אשר יכול להתממש מאת antisense oligonucleotides20,21,22. המזון ו?...

SWCNT הוא nanomaterial חדשניים שיכולים לספק סוגים שונים של תרופות, כגון חלבונים, מולקולות קטנות, חומצות גרעין, stably וביעילות עם סבילות אידיאלי, רעילות מינימלית חוץ גופית1 וויוו2. SWCNT functionalized יש נהדר מסיסות הביו ומים, יכול לשמש הסעות עבור מולקולות קטנות יותר, והוא מסוגל לשאת להן לחדור את קרום התא3,4,5.
lncRNAs הם מקבץ של RNA (> 200 nt) זה משוקלטים מן הגנום ל mRNA אבל לא ניתן היה לתרגם את החלבונים. הוכחה גוברת הראו כי lncRNAs להשתתף ברגולציה של ביטוי גנים6 , מעורבים החניכה, התקדמות של רוב סוגי סרטן, כולל מ מ7,8,9. MALAT1 הוא תעתיק noncoding גרעיני מועשר 2 (NEAT2), מאוד שנשמרת lncRNA10. MALAT1 מזוהה בתחילה ריאות שאינם קטנים התא גרורתית סרטן (NSCLC)11, אבל יש כבר overexpressed רבים גידולים5,12,13; הוא נחשב לאחד lncRNAs ביטוי ביותר, הוא מתואם עם פרוגנוזה גרועה מ מ8,14. רמת הביטוי של MALAT1 גבוה משמעותית בחולים קורס קטלני extramedullary מ"מ לעומת אלו שאובחנו רק מ מ15.
במחקר הקודם, יש לנו אישר כי אנטי-MALAT1 oligos robustly לגרום נזק לדנ א אפופטוזיס מ מ16 באמצעות gapmer DNA antisense oligonucleotides מיקוד MALAT1 (אנטי-MALAT1) בתאים מ מ. ה-DNA gapmer המורכב antisense DNA, מקושרים על ידי 2'-הביתה-RNAs, אשר יכול לבקש MALAT1 המחשוף מאת RNase H פעילות פעם מאוגד17. יעילות משלוח ויוו antisense oligos עדיין מגבילה את השימוש הקליני.
כדי לבדוק את המשלוח אפקט של SWCNT אנטי-MALAT1 gapmer oligos, gapmer אנטי-MALAT1 ה-DNA היא מצומדת כדי DSPE-PEG2000-אמין functionalized SWCNT. SWCNT-נגד-MALAT1 מכן מוזרק לווריד מודל העכבר המופץ מ מ; עיכוב בולט הוא ציין לאחר ארבעה טיפולים.

<table border="0" cellpadding="0" cellspacing="0" style="width:1168px;" width="1167">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:324px;">SWCNTs</td>
			<td style="width:199px;">Millipore-Sigma</td>
			<td style="width:209px;">704113</td>
			<td style="width:436px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DSPE-PEG2000-Amine</td>
			<td>Avanti Polar Lipids</td>
			<td>880128</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">bath sonicator</td>
			<td>VWR</td>
			<td>97043-992</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">4 mL centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>Z740208-8EA</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">UV/VIS spectrometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sulfo-LC-SPDP</td>
			<td>ProteoChem</td>
			<td>c1118</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DTT solution</td>
			<td>Millipore-Sigma</td>
			<td>43815</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NAP-5 column</td>
			<td>GE Healthcare</td>
			<td>17-0853-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">in vivo imaging system</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NOD.CB17-Prkdcscid/J mice</td>
			<td>Charles River lab</td>
			<td>250</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Flow cytometer</td>
			<td>Becton Dickinso</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Lipofectamine</td>
			<td>Invitrogen</td>
			<td>11668019</td>
			<td>Lipofectamine2000</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Fetal bovine serum (FBS)</td>
			<td>Invitrogen</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RMPI-1640 medium</td>
			<td>Invitrogen</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- GTTCTGATCCCGCTGCTATT - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- TCCTCAACACTCAGCCTTTATC - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CAAGAGCACAAGAGGAAGAGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CTACATGGCAACTGTGAGGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Quantitative PCR using SYBR Green PCR master mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25780</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RevertAid first-stand cDNA synthesis kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-MALAT1</td>
			<td>synthesized by IDT Company</td>
			<td></td>
			<td>5&#8217;-mC*mG*mA*mA*mA*C*A*T*T 
			*G*G*C*A*C*A*mC*mA*mG*mC*mA-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Viability Assay Kit</td>
			<td>Promega Corporation</td>
			<td>G7570</td>
			<td>CellTiter-GloLuminescent Cell Viability Assay Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SPSS software</td>
			<td>IBM</td>
			<td>version 24.0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Luciferin</td>
			<td>Millipore-Sigma</td>
			<td>L9504</td>
			<td></td>
		</tr>
	</tbody>
</table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

ננו-צינורית פחמן קיר אחד (SWCNT) הוא סוג חדש של ננו-חלקיק, אשר שימש כדי לספק מספר סוגי סמים לתוך תאים, כגון חלבונים, oligonucleotides, תרופות סינתטיות מולקולה קטנה. SWCNT המימדים הניתנות להתאמה אישית, שטחי אזור גדול, באפשרותך לאגוד בגמישות עם סמים דרך שינויים שונים על פני השטח שלו; לכן, זה מערכת אידיאלי להעברת סמים לתוך התאים. זמן noncoding RNAs (lncRNAs) הם מקבץ של יותר מ 200 noncoding RNA nt, אשר לא יכול להיות מתורגם לחלבון אבל יש תפקיד חשוב בתהליכים ביולוגיים, הקשורים pathophysiological. גרורות-הקשורים ריאות אדנוקרצינומה התעתיק 1 (MALAT1) הוא lncRNA שנשמרת מאוד. הוכח כי רמות MALAT1 גבוהות קשורות על פרוגנוזה גרועה סוגי סרטן שונים, לרבות מיאלומה נפוצה (מ מ). נחשפו MALAT1 מווסת את תיקון ה-DNA ומוות תא מ מ; לפיכך, MALAT1 יכול להיחשב מטרה טיפולית עבור מ מ. עם זאת, oligo antisense מסירת יעיל כדי לעכב/נוקאאוט MALAT1 ויוו היא עדיין בעיה. במחקר זה, לנו לשנות את SWCNT עם פג-2000 ו נזווג oligo anti-MALAT1 אליו לבדוק את המשלוח של מתחם זה במבחנה, תזריק את זה דרך הווריד למודל בעכבר של מ מ המופץ, להתבונן על עיכוב משמעותי של התקדמות מ מ, אשר מציינת SWCNT הזה הוא הסעה משלוח אידיאלי עבור gapmer אנטי-MALAT1 ה-DNA.

כדי להדגים את השפעת עיכוב anti-MALAT1 gapmer-DNA מ מ, אנו הפיל את הביטוי של MALAT1, השתמש בה תאים H929 ו- MM.1S. ארבעים ושמונה שעות לאחר מכן, התאים שנאספו לניתוח של יעילות דפיקה למטה, מצב אפופטוזיס בתאים transfected עם אנטי-MALAT1 gapmer או פקד ה-DNA. לרביעיית-PCR התוצאות הראו כי ה-DNA gapmer אנטי-MALAT1 הפיל את הביט?...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

כתב יד זה מתאר את הסינתזה של ננו-צינורית פחמן קיר אחד (SWCNT)-מצומדת MALAT1 antisense gapmer דנ א oligonucleotide (SWCNT-נגד-MALAT1), אשר מדגים מסירת SWCNT אמין, חזק טיפולית והשפעת anti-MALAT1 במבחנה, ויוו. שיטות להשתמש של סינתזה, שינוי, ההטיה, הזרקה של SWCNT-נגד-MALAT1 מתוארים.

דיכוי צמיחת תאים מיאלומה In Vivo על ידי ננו-צינורית פחמן קיר אחד (SWCNT)-נמסר MALAT1 Antisense Oligos

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

השיטה בה אנו משתמשים כאן יכולה לעזור לארוז אוליגונוקלאוטיד עם ננו-צינורית פחמן חד-קירית, שהיא סוג חדש של חלקיקים לאספקת תרופות. היתרון העיקרי של טכניקה זו הוא אספקה יעילה יותר של תרופות oligonucleotide לתאים ב vivo. ההשלכות של טכניקה זו להרחיב לחקור מיאלומה נפוצה, כי זה הציג חלקיקים כדי לשפר את המסירה של תרופות oligonucleotide.באמצעות שיטה זו יכול לספק תובנה לתוך הטיפול מיאלומה נפוצה. זה יכול להיות מיושם גם על מחלות אחרות, נדנוד עם מטען אחר, כגון חלבונים ומולקולות קטנות. ראשית, מערבבים מיליגרם אחד של צינוריות פחמן חד-קיר, חמישה מיליגרם של DSPE-PEG 2000 אמין, וחמישה מיליליטר של מים מעוקרים ללא גרעין בבקבוקון זכוכית 20 מיליליטר.Sonicate הבקבוקון ב sonicator מרבה מים ברמת כוח של 90 וואט במשך שעה אחת בטמפרטורת החדר. לאחר sonication, צנטריפוגה הבקבוקון ב 24, 000 פעמים g במשך שש שעות. ואז לאסוף את הפתרון על טבעי.הוסף מיליליטר אחד של פתרון ננו-צינורית פחמן חד-קיר למכשיר סינון צנטריפוגלי צנטריפוגלי של 100 קילודלטון ואחריו ארבעה מיליליטר של מים מעוקרים ללא גרעין. צנטריפוגה במשך 10 דקות ב 4, 000 פעמים גרם בטמפרטורת החדר כדי להסיר את המין העודף. הוסף 0.5 מיליגרם של Sulfo-LC-SPDP ל 450 microliters של ננו-צינורית פחמן חד-קיר פונקציונלי אמין.לאחר מכן הוסיפו 50 מיקרוליטרים של 10x PBS, והדקירה במשך שעתיים בטמפרטורת החדר. לאחר מכן, מוסיפים את תערובת התגובה למכשיר מסנן צנטריפוגלי כתוצאה מחיתוך משקל מולקולרי של 100 קילודלטון, ואחריו ארבעה מיליליטר של מים נטולי גרעין. צנטריפוגה המדגם במשך 10 דקות ב 4, 000 פעמים גרם בטמפרטורת החדר כדי להסיר את עודף Sulfo-LC-SPDP.לאסוף את Sulfo-LC-SPDP-מטופלים אמין חד קיר פחמן nanotube פתרון נשאר במסנן, ולדלל אותו עם 500 microliters של פתרון אנטי MALAT1-Cy3 שהוכן בעבר. ואז להדגים את המדגם בארבע מעלות צלזיוס לילה. כדי להשיג את התוצאות הטובות ביותר של השוואה, סדר באופן אקראי 14 עכברים לקבוצות ניסוי או בקרה עם שבעה בכל קבוצה, ועם יחס זכר-לנקבה זהה בכל קבוצה.לאחר מכן, נקו את ספסל הניתוח וערקו אותו ב-70% אלכוהול אתיל. השתמש במנורת חימום כדי לחמם את אחד העכברים כדי לעזור לווריד הזנב להופיע. לרסן את העכבר כראוי עם מרסן הזרקת זנב.הזרקת MM.1S-luc/mCherry תאים ב 50 microliters של PBS דרך וריד הזנב. לחץ על אתר ההזרקה עם ספוגית אלכוהול במשך 30 שניות. לאחר מכן סמן את העכבר המוזרק והחזר אותו לכלוב נקי.ביום השביעי, לאחר הזרקת תא MM1S, להזריק 50 microliters של PBS המכיל ננו-צינור פחמן חד קיר אנטי MALAT1 לתוך וריד הזנב של העכבר. לאחר מכן לחץ על אתר ההזרקה עם ספוגית אלכוהול במשך 30 שניות. שימו לב לדימום המקומי על הזנב ולהתנהגות הכללית של העכבר למשך דקה אחת, ואז החזירו אותו לכלוב נקי.שימו לב שוב לכל העכברים המוזרקים לפני החזרת הכלוב למדף כדי לוודא שהזריקות נסבלות היטב. לשקול כל עכבר לפני הניתוח. לאסוף דם היקפי מהלב עבור בדיקת ספירת דם מלאה שבוצעה על ידי מכונת מונה תאי דם.לאחר מכן, לאסוף את הרקמות של מח העצם, הטחול, בלוטות הלימפה, הכליה, ואת הרקמה עם גרורות גלוי. יש לחלץ RNA וחלבון מדגימות מח העצם. לתקן את כל הרקמות הנותרות בפורמלין.לאחר 24 שעות של קיבעון, לטבול את דגימות העצם בתתברית EDTA 0.5-טוחן במשך חמישה ימים עבור decalcification. לאחר מכן לטבול את כל הדגימות ב 75% אתיל אלכוהול לאחסון לטווח ארוך. תוצאות ה-QRT PCR הראו כי דנ"א נגד MALAT1 gapmeR הפיל את הביטוי MALAT1 וגרם לאפופטוזיס באופן משמעותי בתאי H929 ו- MM.1S.פחמן חד-קיר ננו-צינורית נגד MALAT1-Cy3 נמסר לתוך הגרעין של תאי MM, והדחיק באופן משמעותי את רמת MALAT1 אנדוגני הן בתאי H929 ו MM.1S. הכדאיות של תא BMEC-1 אין הבדל משמעותי לאחר טיפול של צינור פחמן חד קיר אנטי MALAT1-Cy3 או שליטה במינונים שונים ונקודות זמן. זה מציין כי הרעילות של פחמן חד קיר ננו-צינורית אנטי MALAT1-Cy3 יש רעילות מוגבלת ומקובלת לתאים נורמליים במינון גבוה.מודל עכבר אנושי המופץ על ידי MM הוקם כדי להעריך את השפעות הטיפול של פחמן חד קיר nanotube אנטי MALAT1 ב vivo. אותות לוציפרון של עכברים בקבוצת הטיפול נגד MALAT1 פחמן חד קיר היו נמוכים להפליא בהשוואה לשליטה לאחר 21 ימים של טיפול. מתוצאות אלה, הגיע למסקנה כי טיפול ננו-צינור פחמן חד-קיר נגד MALAT1 באמצעות הזרקה תוך וררית יכול לספק את האוליגוס נגד MALAT1 לתאי הגידול ביעילות.לא נצפו תופעות לוואי משמעותיות של הטיפול, מה שמצביע על כך שהזרקת ננו-צינורית פחמן חד-קירית נגד MALAT1 היא טיפול בטוח לעכברים. בעת ניסיון הליך זה, חשוב לזכור כי הרכב מולקולת התא ישפיע על המסירה, היעילות, ואת ההשפעה הטיפולית של תרופות oligonucleotide. בעקבות הליך זה, ניתן לבצע שיטות אחרות כמו תיוג חלבונים או מולקולות קטנות על מנת לענות על שאלות נוספות.כמו להשתמש בננו-צינוריות פחמן חד-קיר כדי לספק תרופות אחרות.

Research

JoVE Journal

Cancer Research

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma (DIPG)

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma DIPG

פרוטוקול תרבית תאי ראפיד פוסט מורטם של Glioma Pontine המפוזר העצמותי (DIPG)

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a ...

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

אין ויוו הערכת EPR pH, pO2, מצב חמצון-חיזור, ואת ריכוזים של פוספט גלוטתיון ב Microenvironment הגידול

This protocol demonstrates the capability of low-field electron paramagnetic resonance (EPR)-based techniques in combination with functional paramagnetic ...

Multimodal Bioluminescent and Positronic-emission Tomography/Computational Tomography Imaging of Multiple Myeloma Bone Marrow Xenografts in NOG Mice

הדמיה עם מודאלים מרובים זוהרים, פליטת פוזיטרונים טומוגרפיה/חישובית טומוגרפיה של מיאלומה נפוצה מח עצם Xenografts בעכברים ליקר ביצים

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular ...

Neutrophil Extracellular Traps Generated by Low Density Neutrophils Obtained from Peritoneal Lavage Fluid Mediate Tumor Cell Growth and Attachment

נויטרופילים מלכודות חוץ-תאי שנוצר על ידי נויטרופילים בצפיפות נמוכה המתקבל נוזל שטיפת הצפק התחלקות התא הגידול וקובץ מצורף

Activated neutrophils release neutrophil extracellular traps (NETs), which can capture and destroy microbes. Recent studies suggest that NETs are involved ...

Evaluation of Biomarkers in Glioma by Immunohistochemistry on Paraffin-Embedded 3D Glioma Neurosphere Cultures

הערכה של סמנים Glioma מאת אימונוהיסטוכימיה על תרבויות Neurosphere פרפין-מוטבע Glioma תלת-ממד

Analysis of protein expression in glioma is relevant for several aspects in the study of its pathology. Numerous proteins have been described as ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

ב Vivo עיכוב של מיקרואורנה כדי להקטין את צמיחת הגידול בעכברים

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

מודל עכברי לחקר התפקיד של פיברובלסטים הקשורים לסרטן בצמיחת הגידול

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role ...

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

מודל פרוסת מוח Ex Vivo כדי לחקור ולמקד את צמיחת הגידול הגרורתי של סרטן השד במוח

Brain metastasis is a serious consequence of breast cancer for women as these tumors are difficult to treat and are associated with poor clinical ...

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

הגדרת תפקודי גנים בגידולים סרטניים על ידי אבלציה Ex vivo של אללים פלוקסים בתאי גידול מעטפת עצב היקפית ממאירה

The development of new drugs that precisely target key proteins in human cancers is fundamentally altering cancer therapeutics. However, before these ...

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

ב-Vivo הקרנה אימונוגנית של שלפוחיות חוץ-תאיות שמקורן בגידול על ידי ציטומטריית זרימה של תאי T טחול

Immunogenic cell death of tumors, caused by chemotherapy or irradiation, can trigger tumor-specific T cell responses by releasing danger-associated ...