Name: repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos
Uploaded: 2018-12-13T13:00:00
Description: Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

लेखकों Lerner अनुसंधान संस्थान proteomic, जीनोमिक, और उनकी सहायता और समर्थन के लिए इमेजिंग कोर धंयवाद । फंडिंग: यह काम वित्तीय रूप से NIH/NCI ग्रांट R00 CA172292 (टू J.J.Z.) और स्टार्ट-अप फंड (J.J.Z. को) और केस वेस्टर्न रिजर्व यूनिवर्सिटी कोर उपयोग पायलट ग्रांट (CTSC) के नैदानिक और शोधों विज्ञान सहयोगी (J.J.Z.) द्वारा समर्थित था । यह काम Leica SP8 फोकल माइक्रोस्कोप कि स्वास्थ्य हस्ताक्षर अनुदान 1S10OD019972-01 के राष्ट्रीय संस्थानों से धन के साथ खरीदा गया था का उपयोग किया ।

सभी प्रयोगों पशु शामिल पूर्व क्लीवलैंड क्लिनिक IACUC (संस्थागत पशु देखभाल और उपयोग समिति) द्वारा अनुमोदित किया गया ।
1. कार्यात्मक SWCNTs का संश्लेषण
<ol><li>मिश्रण 1 मिलीग्राम SWCNTs, 5 DSPE के मिलीग्राम-PEG2000-अमी...

<ol>
	<li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system:+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis.">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li><li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy.">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li><li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+protein+transporters:+generality+and+biological+functionality.">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing.">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA:+an+investigation+of+the+uptake+mechanism+and+pathway.">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li><li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies.">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li><li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bright+side+of+dark+matter:+lncRNAs+in+cancer.">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li><li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma.">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li><li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma.">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175 (2015).</li><li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth.">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li><li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT-1,+a+novel+noncoding+RNA,+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer.">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li><li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas.">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li><li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing.">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163 (2009).</li><li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression.">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809 (2014).</li><li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma.">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+MALAT1/PARP1/LIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma.">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li><li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides.">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li><li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction.">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li><li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells.">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li><li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+modifications+in+multiple+myeloma:+recent+advances+on+the+role+of+DNA+and+histone+methylation.">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li><li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma.">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li><li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity.">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li><li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+approves+fomivirsen,+famciclovir,+and+Thalidomide.+Food+and+Drug+Administration.">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li><li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+new+drugs+for+homozygous+familial+hypercholesterolemia:+managing+benefits+and+risks+in+a+rare+disorder.">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li><li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Eteplirsen+for+Muscular+Dystrophy.">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480 (2017).</li><li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery.">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li><li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics.">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li><li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomedical+applications+of+functionalised+carbon+nanotubes.">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), 571-577 (2005).</li><li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods.">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li><li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes.">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li><li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pH-sensitive+poly(histidine)-PEG/DSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery.">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li><li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages.">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li><li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA.">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li><li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+reduction+of+disulfide+bonds+in+lysosomes:+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+(GILT).">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li><li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Membrane+perturbation+by+carbon+nanotube+insertion:+pathways+to+internalization.">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li><li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers.">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li><li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells.">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li><li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes:+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles.">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li><li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paradoxical+glomerular+filtration+of+carbon+nanotubes.">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li></ol>

सबूत से पता चला है कि lncRNAs कैंसर में कई शारीरिक और pathophysiological प्रक्रियाओं के विनियमन में भाग लेने, मिमी सहित7,8,9; वे कैंसर के इलाज के लिए लक्षित होने की क्षमता है, जो antisense oligonucleotides<...

SWCNT एक उपंयास nanomaterial है कि दवाओं के विभिंन प्रकार के, जैसे प्रोटीन, छोटे अणुओं, और न्यूक्लिक एसिड के रूप में वितरित कर सकते हैं, छुरा और कुशलतापूर्वक आदर्श सहनशीलता और ंयूनतम विषाक्तता के साथ इन विट्रो में1 और vivo2में । एक कार्यात्मक SWCNT महान है असंगति और पानी घुलनशीलता, छोटे अणुओं के लिए एक शटल के रूप में इस्तेमाल किया जा सकता है, और उंहें ले जा सकते है करने के लिए सेल झिल्ली3,4,5घुसना ।
lncRNAs आरएनए के एक क्लस्टर (> 200 nt) कि जीनोम से mRNA के लिए लिखित रहे हैं, लेकिन प्रोटीन के लिए अनुवाद नहीं किया जा सकता है । सबूत बढ़ाने से पता चला है कि lncRNAs जीन अभिव्यक्ति6 के विनियमन में भाग लेते है और दीक्षा और कैंसर के अधिकांश प्रकार की प्रगति में शामिल हैं, मिमी7,8,9सहित । MALAT1 एक परमाणु-गैर कोडिंग प्रतिलिपि 2 (NEAT2) समृद्ध और एक उच्च संरक्षित lncRNA10है । MALAT1 शुरू में मेटास्टेटिक गैर छोटे सेल फेफड़ों के कैंसर (NSCLC)11में मांयता प्राप्त है, लेकिन कई ट्यूमर में व्यक्त किया गया है5,12,13; यह सबसे उच्च व्यक्त lncRNAs में से एक है और मिमी8,14में एक गरीब रोग का निदान के साथ संबंधित है । MALAT1 की अभिव्यक्ति स्तर पर गंभीर पाठ्यक्रम extramedullary mm रोगियों केवल मिमी15के रूप में निदान की तुलना में काफी अधिक है ।
पिछले एक अध्ययन में, हमने पुष्टि की है कि एंटी-MALAT1 ओलिगोस्पर्मिया मजबूती से डीएनए क्षति के लिए सीसा और mm16 में apoptosis gapmer डीएनए antisense oligonucleotides लक्ष्यीकरण MALAT1 (विरोधी MALAT1) का उपयोग करके मिमी कोशिकाओं में । gapmer डीएनए antisense डीएनए से बना है और 2 ' से जुड़े-OMe-RNAs, जो MALAT1 ज गतिविधि द्वारा त्वरित RNase दरार सकता है एक बार17बाध्य । में vivo वितरण दक्षता antisense ओलिगोस्पर्मिया अभी भी अपने नैदानिक उपयोग सीमा ।
एंटी-MALAT1 gapmer ओलिगोस्पर्मिया के लिए SWCNT के डिलिवरी प्रभाव का परीक्षण करने के लिए एंटी MALAT1 gapmer डीएनए को संयुग्मित-DSPE-अमीनी कार्यात्मकता PEG2000 है. SWCNT-विरोधी MALAT1 तो नसों में एक मिमी फैलाया माउस मॉडल में इंजेक्ट किया जाता है; एक हड़ताली निषेध चार उपचार के बाद मनाया जाता है ।

<table border="0" cellpadding="0" cellspacing="0" style="width:1168px;" width="1167">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:324px;">SWCNTs</td>
			<td style="width:199px;">Millipore-Sigma</td>
			<td style="width:209px;">704113</td>
			<td style="width:436px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DSPE-PEG2000-Amine</td>
			<td>Avanti Polar Lipids</td>
			<td>880128</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">bath sonicator</td>
			<td>VWR</td>
			<td>97043-992</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">4 mL centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>Z740208-8EA</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">UV/VIS spectrometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sulfo-LC-SPDP</td>
			<td>ProteoChem</td>
			<td>c1118</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DTT solution</td>
			<td>Millipore-Sigma</td>
			<td>43815</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NAP-5 column</td>
			<td>GE Healthcare</td>
			<td>17-0853-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">in vivo imaging system</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NOD.CB17-Prkdcscid/J mice</td>
			<td>Charles River lab</td>
			<td>250</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Flow cytometer</td>
			<td>Becton Dickinso</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Lipofectamine</td>
			<td>Invitrogen</td>
			<td>11668019</td>
			<td>Lipofectamine2000</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Fetal bovine serum (FBS)</td>
			<td>Invitrogen</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RMPI-1640 medium</td>
			<td>Invitrogen</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- GTTCTGATCCCGCTGCTATT - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- TCCTCAACACTCAGCCTTTATC - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CAAGAGCACAAGAGGAAGAGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CTACATGGCAACTGTGAGGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Quantitative PCR using SYBR Green PCR master mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25780</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RevertAid first-stand cDNA synthesis kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-MALAT1</td>
			<td>synthesized by IDT Company</td>
			<td></td>
			<td>5&#8217;-mC*mG*mA*mA*mA*C*A*T*T 
			*G*G*C*A*C*A*mC*mA*mG*mC*mA-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Viability Assay Kit</td>
			<td>Promega Corporation</td>
			<td>G7570</td>
			<td>CellTiter-GloLuminescent Cell Viability Assay Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SPSS software</td>
			<td>IBM</td>
			<td>version 24.0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Luciferin</td>
			<td>Millipore-Sigma</td>
			<td>L9504</td>
			<td></td>
		</tr>
	</tbody>
</table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

सिंगल वॉल कार्बन नैनोट्यूब (SWCNT) एक नए प्रकार की nanoparticle है, जिसे कोशिकाओं में कई तरह की दवाओं को डिलीवर करने के लिए इस्तेमाल किया गया है, जैसे प्रोटीन, oligonucleotides, और सिंथेटिक छोटे-अणु ड्रग्स । SWCNT अनुकूलन आयामों, एक बड़े सतही क्षेत्र है, और flexibly अपनी सतह पर विभिंन संशोधनों के माध्यम से दवाओं के साथ बांध कर सकते हैं; इसलिए, यह कोशिकाओं में दवाओं के परिवहन के लिए एक आदर्श प्रणाली है । लंबे समय से कोडिंग RNAs (lncRNAs) के एक क्लस्टर कर रहे है decoding आरएनए से अधिक २०० nt, जो प्रोटीन के लिए अनुवाद नहीं किया जा सकता है लेकिन जैविक और pathophysiological प्रक्रियाओं में एक महत्वपूर्ण भूमिका निभाते हैं । मेटास्टेसिस-एसोसिएटेड फेफड़ों ग्रंथिकर्कटता प्रतिलिपि 1 (MALAT1) एक उच्च संरक्षित lncRNA है । यह प्रदर्शन किया गया था कि उच्च MALAT1 स्तर विभिन्न कैंसर के गरीब रोग का निदान करने के लिए संबंधित हैं, सहित कई मायलोमा (मिमी). हमें पता चला है कि MALAT1 डीएनए की मरंमत और मिमी में कोशिका मृत्यु को नियंत्रित करता है; इस प्रकार, MALAT1 मिमी के लिए एक चिकित्सीय लक्ष्य के रूप में माना जा सकता है । हालांकि, antisense oligo के कुशल प्रसव को रोकना/पछाड़ना MALAT1 vivo में अभी भी एक समस्या है । इस अध्ययन में, हम खूंटी-२००० के साथ SWCNT को संशोधित करने और इसे करने के लिए एक विरोधी MALAT1 oligo संयुग्मी, इन विट्रो में इस परिसर के वितरण का परीक्षण, यह नसों में एक प्रसार मिमी माउस मॉडल में सुई, और मिमी प्रगति का एक महत्वपूर्ण अवरोध का पालन, जो इंगित करता है कि SWCNT विरोधी MALAT1 gapmer डीएनए के लिए एक आदर्श प्रसव शटल है ।

मिमी में विरोधी MALAT1 gapmer डीएनए के निषेध प्रभाव प्रदर्शित करने के लिए, हम नीचे MALAT1 की अभिव्यक्ति खटखटाया और यह H929 और MM. 1s कोशिकाओं में इस्तेमाल किया । ४८ घंटे बाद, कोशिकाएं नॉक-डाउन दक्षता के विश्ले...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

इस पांडुलिपि एक एकल दीवार कार्बन नैनोट्यूब (SWCNT) के संश्लेषण का वर्णन-संयुग्मित MALAT1 antisense gapmer डीएनए oligonucleotide (SWCNT-anti-MALAT1), जो SWCNT के विश्वसनीय वितरण और शक्तिशाली उपचारात्मक प्रभाव को दर्शाता है एंटी MALAT1 इन विट्रो में और vivo में. संश्लेषण, संशोधन, विकार, और SWCNT-विरोधी MALAT1 के इंजेक्शन के लिए इस्तेमाल किया तरीकों का वर्णन कर रहे हैं ।

सिंगल वॉल कार्बन नैनोट्यूब (SWCNT) द्वारा Vivo में मल्टीपल मायलोमा सेल ग्रोथ का दमन-डिलीवर MALAT1 Antisense ओलिगोस्पर्मिया

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

हम यहां जिस विधि का उपयोग कर रहे हैं, वह एकल दीवार कार्बन नैनोट्यूब के साथ ओलिगोन्यूक्लियोटाइड को पैकेज करने में मदद कर सकता है, जो दवा वितरण के लिए एक नए प्रकार का नैनोपार्टिकल है। इस तकनीक का मुख्य लाभ वीवो में कोशिकाओं में ओलिगोन्यूक्लियोटाइड दवाओं की अधिक कुशल डिलीवरी है। इस तकनीक के निहितार्थ कई मायलोमा अनुसंधान करने के लिए विस्तारित है, क्योंकि यह ओलिगोन्यूक्लियोटाइड दवाओं के वितरण में सुधार करने के लिए नैनोपार्टिकल शुरू की है ।इस विधि के माध्यम से कई मायलोमा के उपचार में अंतर्दृष्टि प्रदान कर सकते हैं। यह अन्य बीमारियों पर भी लागू किया जा सकता है और प्रोटीन और छोटे अणुओं जैसे अन्य कार्गो के साथ संयुग्मित किया जा सकता है। सबसे पहले, एक मिलीग्राम एकल दीवार कार्बन नैनोट्यूब, DSPE-PEG २००० अमीन के पांच मिलीग्राम, और एक 20 मिलीलीटर ग्लास प्रस्फुटन शीशी में बंधी नाभिक मुक्त पानी के पांच मिलीलीटर मिश्रण ।कमरे के तापमान पर एक घंटे के लिए 90 वाट के बिजली के स्तर पर एक वाटरबाथ सोनिकेटर में शीशी को सोनिकेट करें। सोनीशन के बाद, छह घंटे के लिए 24, 000 बार जी पर शीशी अपकेंद्रित्र। इसके बाद सुपरनैंट सॉल्यूशन इकट्ठा करें।एक १००-किलोडलटन आणविक वजन कटऑफ अपकेंद्रित्र फिल्टर डिवाइस के लिए एकल दीवार कार्बन नैनोट्यूब समाधान के एक मिलीलीटर जोड़ें और इसके बाद स्टरलाइज्ड न्यूक्लियेज-फ्री पानी के चार मिलीलीटर । अतिरिक्त अमीन को हटाने के लिए कमरे के तापमान पर 4, 000 बार जी पर 10 मिनट के लिए सेंट्रलाइज। अमीन-कार्यात्मक एकल-दीवार कार्बन नैनोट्यूब के 450 माइक्रोलीटर में सल्फो-एलसी-एसपीडीपी के 0.5 मिलीग्राम जोड़ें।फिर 10x पीबीएस के 50 माइक्रोलीटर जोड़ें, और कमरे के तापमान पर दो घंटे के लिए इनक्यूबेट करें। इसके बाद, 100-किलोडडलटन आणविक वजन कटऑफ अपकेंद्रित्र फिल्टर डिवाइस में प्रतिक्रिया मिश्रण जोड़ें, इसके बाद चार मिलीलीटर नाभिक मुक्त पानी। अतिरिक्त सल्फो-एलसी-एसपीडीपी को हटाने के लिए कमरे के तापमान पर 4, 000 बार जी पर 10 मिनट के लिए नमूना अपकेंद्रित्र करें।फिल्टर में छोड़े गए सल्फो-एलसी-एसपीडीपी-इलाज अमीन सिंगल-वॉल कार्बन नैनोट्यूब सॉल्यूशन को इकट्ठा करें, और इसे पहले से तैयार एंटी-MALAT1-Cy3 समाधान के 500 माइक्रोलीटर के साथ पतला करें। फिर रात भर चार डिग्री सेल्सियस पर नमूना इनक्यूबेट। तुलना का सबसे अच्छा परिणाम प्राप्त करने के लिए, बेतरतीब ढंग से प्रत्येक समूह में सात के साथ परीक्षण या नियंत्रण समूहों में 14 चूहों की व्यवस्था, और प्रत्येक समूह में एक ही पुरुष से महिला अनुपात के साथ ।इसके बाद, ऑपरेशन बेंच को साफ करें और इसे 70% एथिल अल्कोहल के साथ स्टरलाइज करें। पूंछ नस प्रदर्शित करने में मदद करने के लिए चूहों में से एक को गर्म करने के लिए एक हीटिंग लैंप का उपयोग करें। माउस को पूंछ इंजेक्शन निरोधक के साथ ठीक से नियंत्रित करें।पूंछ नस के माध्यम से पीबीएस के 50 माइक्रोलीटर में MM.1S-luc/mCherry कोशिकाओं इंजेक्ट करें। इंजेक्शन साइट को 30 सेकंड के लिए एक शराब झाड़ू के साथ दबाएं। फिर इंजेक्शन माउस को चिह्नित करें और इसे एक साफ पिंजरे में वापस करें।सात दिन, MM1S सेल इंजेक्शन के बाद, माउस की पूंछ नस में एकल दीवार कार्बन नैनोट्यूब विरोधी MALAT1 युक्त PBS के ५० माइक्रोलीटर सुई । फिर इंजेक्शन साइट को 30 सेकंड के लिए शराब के झाड़ू के साथ दबाएं। पूंछ पर स्थानीय रक्तस्राव और माउस के सामान्य व्यवहार को एक मिनट के लिए देखें, और फिर इसे एक साफ पिंजरे में वापस करें।यह सुनिश्चित करने के लिए कि इंजेक्शन अच्छी तरह से सहन किए जाते हैं, रैक में पिंजरे लौटने से पहले सभी इंजेक्शन चूहों का फिर से निरीक्षण करें। विच्छेदन से पहले प्रत्येक माउस का वजन करें। एक रक्त कोशिका काउंटर मशीन द्वारा किए गए एक पूर्ण रक्त गिनती परख के लिए दिल से परिधीय रक्त ले लीजिए।इसके बाद, अस्थि मज्जा, तिल्ली, लिम्फ नोड, गुर्दे, और दृश्यमान मेटास्टेसिस के साथ ऊतक के ऊतकों को इकट्ठा करें। बोन मैरो नमूनों से आरएनए और प्रोटीन निकालें। फॉर्मेलिन में शेष सभी ऊतकों को ठीक करें।निर्धारण के 24 घंटे के बाद, अस्थि नमूनों को 0.5-मोलर EDTA समाधान में पांच दिनों के लिए विसर्जित करें। फिर लंबे समय तक भंडारण के लिए 75% एथिल अल्कोहल में सभी नमूनों को विसर्जित करें। क्यूआरटी पीसीआर के परिणामों से पता चला है कि एंटी-MALAT1 गैपमेर डीएनए ने MALAT1 अभिव्यक्ति को नीचे गिरा दिया और एच 929 और एमएम.1एस कोशिकाओं में एपोप्टोसिस को काफी प्रेरित किया।एकल दीवार कार्बन नैनोट्यूब विरोधी MALAT1-Cy3 एमएम कोशिकाओं के नाभिक में दिया गया था, और काफी दोनों H929 और MM.1S कोशिकाओं में अंतर्जात MALAT1 स्तर दबा दिया । सिंगल-वॉल कार्बन नैनोट्यूब एंटी-MALAT1-Cy3 या विभिन्न खुराकों और टाइमपॉइंट्स पर नियंत्रण के उपचार के बाद बीएमईसी-1 सेल की व्यवहार्यता में कोई महत्वपूर्ण अंतर नहीं है। यह इंगित करता है कि एकल दीवार कार्बन नैनोट्यूब एंटी-MALAT1-Cy3 की विषाक्तता उच्च खुराक पर सामान्य कोशिकाओं के लिए एक सीमित और स्वीकार्य विषाक्तता है।वीवो में एकल दीवार कार्बन नैनोट्यूब एंटी-MALAT1 के उपचार प्रभावों का मूल्यांकन करने के लिए एक मानव एमएम-प्रसारित माउस मॉडल स्थापित किया गया था। एकल दीवार कार्बन नैनोट्यूब एंटी MALAT1 उपचार समूह में चूहों के लूसिफ़ेरॉन संकेत उपचार के 21 दिनों के बाद नियंत्रण की तुलना में उल्लेखनीय रूप से कम थे । इन परिणामों से, यह निष्कर्ष निकाला गया कि नसों में इंजेक्शन के माध्यम से एकल दीवार कार्बन नैनोट्यूब एंटी-MALAT1 उपचार ट्यूमर कोशिकाओं को प्रभावी ढंग से एंटी-MALAT1 ओलिगोस वितरित कर सकता है।उपचार का कोई महत्वपूर्ण दुष्प्रभाव नहीं देखा गया, यह दर्शाता है कि एकल दीवार कार्बन नैनोट्यूब एंटी-MALAT1 इंजेक्शन चूहों के लिए एक सुरक्षित उपचार है। इस प्रक्रिया का प्रयास करते समय, यह याद रखना महत्वपूर्ण है कि कोशिका अणु संरचना ओलिगोन्यूक्लियोटाइड दवाओं के वितरण, दक्षता और चिकित्सीय प्रभाव को प्रभावित करेगी। इस प्रक्रिया के बाद, अतिरिक्त प्रश्नों का उत्तर देने के लिए प्रोटीन या छोटे अणुओं के संविलियन जैसे अन्य तरीकों का प्रदर्शन किया जा सकता है।जैसे अन्य दवाओं को वितरित करने के लिए एकल दीवार कार्बन नैनोट्यूब का उपयोग करना।

Research

JoVE Journal

Cancer Research

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma (DIPG)

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma DIPG

फैलाना आंतरिक Pontine Glioma की रैपिड पोस्टमार्टम सेल संस्कृति के लिए एक प्रोटोकॉल (DIPG)

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a ...

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

Vivo में पीएच के EPR आकलन, पीओ2, Redox स्थिति, और ट्यूमर में फॉस्फेट और Glutathione की सांद्रता Microenvironment

This protocol demonstrates the capability of low-field electron paramagnetic resonance (EPR)-based techniques in combination with functional paramagnetic ...

Multimodal Bioluminescent and Positronic-emission Tomography/Computational Tomography Imaging of Multiple Myeloma Bone Marrow Xenografts in NOG Mice

Multimodal Bioluminescent और Positronic-उत्सर्जन टोमोग्राफी/Xenografts चूहों में एकाधिक मायलोमा अस्थि मज्जा नोग की गणना टोमोग्राफी इमेजिंग

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular ...

Neutrophil Extracellular Traps Generated by Low Density Neutrophils Obtained from Peritoneal Lavage Fluid Mediate Tumor Cell Growth and Attachment

पेरिटोनियल लेवेज द्रव मध्यस्थता ट्यूमर सेल विकास और लगाव से प्राप्त कम घनत्व न्यूट्रोफिल द्वारा उत्पन्न न्युट्रोफिल Extracellular जाल

Activated neutrophils release neutrophil extracellular traps (NETs), which can capture and destroy microbes. Recent studies suggest that NETs are involved ...

Evaluation of Biomarkers in Glioma by Immunohistochemistry on Paraffin-Embedded 3D Glioma Neurosphere Cultures

तंत्रिकाबंधार्बुद में Immunohistochemistry द्वारा आयल-एंबेडेड 3d तंत्रिकाबंधार्बुद Neurosphere संस्कृतियों का मूल्यांकन

Analysis of protein expression in glioma is relevant for several aspects in the study of its pathology. Numerous proteins have been described as ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

चूहे में ट्यूमर की वृद्धि को कम करने के लिए MicroRNA के Vivo निषेध में

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

ट्यूमर के विकास में कैंसर से जुड़े फाइब्रोब्लास्ट की भूमिका की जांच करने के लिए एक माउस मॉडल

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role ...

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

स्तन कैंसर मस्तिष्क मेटास्टैटिक ट्यूमर विकास का अध्ययन और लक्ष्य करने के लिए एक पूर्व वीवो मस्तिष्क स्लाइस मॉडल

Brain metastasis is a serious consequence of breast cancer for women as these tumors are difficult to treat and are associated with poor clinical ...

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

घातक परिधीय तंत्रिका म्यान ट्यूमर कोशिकाओं में फ्लोक्स्ड एलील के पूर्व विवो पृथक्करण द्वारा ट्यूमरजेनेसिस में जीन कार्यों को परिभाषित करना

The development of new drugs that precisely target key proteins in human cancers is fundamentally altering cancer therapeutics. However, before these ...

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

Vivo में इम्युनोजेनेसिटी स्प्लेनिक टी कोशिकाओं के प्रवाह Cytometry द्वारा ट्यूमर व्युत्पन्न बाह्य कोशिकीय पुटिकाओं की स्क्रीनिंग

Immunogenic cell death of tumors, caused by chemotherapy or irradiation, can trigger tumor-specific T cell responses by releasing danger-associated ...