Name: repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos
Uploaded: 2018-12-13T13:00:00
Description: Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

저자 러너 연구소 proteomic, 게놈, 및 그들의 지원에 대 한 이미징 코어를 감사 하 고 지원 합니다. 자금:이 작품 NIH/NCI 부여 R00 CA172292 (J.J.Z.) (J.J.Z.)을 창업 자금 및 임상 및 변환 과학 공동 (CTSC) 케이스 서쪽 예비 대학 코어 사용률 파일럿 부여 (J.J.Z.)의 의해 재정적으로 지원 되었다. 이 작품 활용 건강 SIG의 국가 학회 교부 금 1S10OD019972-01 자금 구입 했던 Leica SP8 confocal 현미경.

모든 실험 동물 관련 된 사전 (기관 동물 관리 및 사용 위원회) 클리블랜드 클리닉 IACUC에 의해 승인 되었다.
1입니다. 기능성된 SWCNTs의 합성
<ol><li>SWCNTs, DSPE-PEG2000-아민의 5 mg 및 유리 섬광 유리병 (20 mL) 소독된 nuclease 무료 물 5 mL의 혼합 1 밀리 그램. 흔들어 모든 시 약을 완전히 분해 하는 게.</li>
	<li>실 온에서 1 h 40 W의 전력 레벨에서 물 목욕 sonicator에 유리병을 sonicate (RT, 20 ?...

<ol>
	<li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system:+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis.">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li><li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy.">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li><li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+protein+transporters:+generality+and+biological+functionality.">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing.">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA:+an+investigation+of+the+uptake+mechanism+and+pathway.">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li><li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies.">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li><li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bright+side+of+dark+matter:+lncRNAs+in+cancer.">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li><li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma.">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li><li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma.">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175 (2015).</li><li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth.">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li><li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT-1,+a+novel+noncoding+RNA,+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer.">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li><li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas.">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li><li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing.">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163 (2009).</li><li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression.">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809 (2014).</li><li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma.">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+MALAT1/PARP1/LIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma.">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li><li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides.">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li><li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction.">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li><li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells.">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li><li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+modifications+in+multiple+myeloma:+recent+advances+on+the+role+of+DNA+and+histone+methylation.">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li><li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma.">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li><li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity.">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li><li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+approves+fomivirsen,+famciclovir,+and+Thalidomide.+Food+and+Drug+Administration.">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li><li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+new+drugs+for+homozygous+familial+hypercholesterolemia:+managing+benefits+and+risks+in+a+rare+disorder.">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li><li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Eteplirsen+for+Muscular+Dystrophy.">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480 (2017).</li><li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery.">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li><li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics.">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li><li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomedical+applications+of+functionalised+carbon+nanotubes.">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), 571-577 (2005).</li><li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods.">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li><li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes.">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li><li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pH-sensitive+poly(histidine)-PEG/DSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery.">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li><li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages.">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li><li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA.">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li><li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+reduction+of+disulfide+bonds+in+lysosomes:+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+(GILT).">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li><li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Membrane+perturbation+by+carbon+nanotube+insertion:+pathways+to+internalization.">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li><li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers.">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li><li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells.">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li><li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes:+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles.">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li><li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paradoxical+glomerular+filtration+of+carbon+nanotubes.">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li></ol>

LncRNAs m M7,,89;를 포함 하 여 암에 수많은 생리 및 병 태 생리 절차의 규칙에 참여를 보이고 있다는 증거 그들은 센스 oligonucleotides20,,2122에 의해 실현 될 수 있는 암 치료에 대 한 타겟이 될 가능성이 있다. 미국 식품 및 의약품 안전 청 (FDA)는 세포 망막<sup class...

SWCNT 소설을 접한 제공할 수 있는 다양 한 유형의 약물, 단백질, 작은 분자, 핵 산 등 안정적이 고 효율적으로 이상적인 tolerability와 시험관1 에 vivo에서2최소 독성입니다. 기능성된 SWCNT 좋은 생체 적합성 및 물 가용성, 작은 분자에 대 한 셔틀으로 사용 될 수 있으며 세포 막3,,45에 침투 하는 그들을 가져올 수 있다.
lncRNAs는 RNA의 클러스터 (> 200 nt) 게놈에서 mRNA를 복사할 수는 있지만 단백질에 번역 될 수 없습니다. LncRNAs 유전자 식6 의 규칙에 참여 하 고 개시와 대부분의 유형의 암, m M7,8,9등의 진행에 관련 된 증거를 증가 보이고 있다. MALAT1 핵 농축 noncoding 사본을 2 (NEAT2)은 매우 보존된 lncRNA10. MALAT1 전이성 비 작은 세포 폐 암 (NSCLC)11, 처음 인식 하지만 수많은 종양5,,1213;에 overexpressed 되었습니다. 그것은 가장 높은 표현된 lncRNAs 중 하나 이며 m M8,14에서 가난한 예 후와 상관 된다. MALAT1 식 수준 치명적인 코스 extramedullary m M 환자 m M15로 진단만 그에 비해 크게 높은 수준 이다.
이전 연구에서 우리는 안티-MALAT1 oligos 튼튼하게 이어질 DNA 손상 및 m M16 에서 apoptosis gapmer DNA 센스 oligonucleotides MALAT1 타겟팅을 사용 하 여 확인 했습니다 (안티-MALAT1) MM 셀에서. Gapmer DNA 센스 DNA의 구성 이며 2'-오메-RNAs, RNase H 한 번 바운드 활동17여 MALAT1 분열을 프롬프트 수 있는 연결. 센스 oligos의 생체 조건 납품 효율성은 아직도 그것의 임상 사용을 제한합니다.
배달 테스트 안티 MALAT1 gapmer oligos, DNA DSPE-PEG2000-아민에 활용 된 안티 MALAT1 gapmer에 대 한 SWCNT의 효과 기능성 SWCNT. SWCNT 안티 MALAT1 다음 주입 정 맥 MM 전파 마우스 모델; 눈에 띄는 억제 4 치료 후 관찰 됩니다.

<table border="0" cellpadding="0" cellspacing="0" style="width:1168px;" width="1167">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:324px;">SWCNTs</td>
			<td style="width:199px;">Millipore-Sigma</td>
			<td style="width:209px;">704113</td>
			<td style="width:436px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DSPE-PEG2000-Amine</td>
			<td>Avanti Polar Lipids</td>
			<td>880128</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">bath sonicator</td>
			<td>VWR</td>
			<td>97043-992</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">4 mL centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>Z740208-8EA</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">UV/VIS spectrometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sulfo-LC-SPDP</td>
			<td>ProteoChem</td>
			<td>c1118</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DTT solution</td>
			<td>Millipore-Sigma</td>
			<td>43815</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NAP-5 column</td>
			<td>GE Healthcare</td>
			<td>17-0853-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">in vivo imaging system</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NOD.CB17-Prkdcscid/J mice</td>
			<td>Charles River lab</td>
			<td>250</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Flow cytometer</td>
			<td>Becton Dickinso</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Lipofectamine</td>
			<td>Invitrogen</td>
			<td>11668019</td>
			<td>Lipofectamine2000</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Fetal bovine serum (FBS)</td>
			<td>Invitrogen</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RMPI-1640 medium</td>
			<td>Invitrogen</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- GTTCTGATCCCGCTGCTATT - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- TCCTCAACACTCAGCCTTTATC - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CAAGAGCACAAGAGGAAGAGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CTACATGGCAACTGTGAGGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Quantitative PCR using SYBR Green PCR master mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25780</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RevertAid first-stand cDNA synthesis kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-MALAT1</td>
			<td>synthesized by IDT Company</td>
			<td></td>
			<td>5&#8217;-mC*mG*mA*mA*mA*C*A*T*T 
			*G*G*C*A*C*A*mC*mA*mG*mC*mA-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Viability Assay Kit</td>
			<td>Promega Corporation</td>
			<td>G7570</td>
			<td>CellTiter-GloLuminescent Cell Viability Assay Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SPSS software</td>
			<td>IBM</td>
			<td>version 24.0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Luciferin</td>
			<td>Millipore-Sigma</td>
			<td>L9504</td>
			<td></td>
		</tr>
	</tbody>
</table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

단일 벽 탄소 나노튜브 (SWCNT)는 새로운 유형의 나노, 세포, 단백질, oligonucleotides, 합성 작은 분자 약물 등으로 약의 여러 종류를 제공 하는 데 사용 되었습니다. SWCNT 사용자 정의 크기, 큰 표면 영역 있고 유연 하 게 표면;에 다른 수정 마약으로 바인딩할 수 있습니다. 따라서, 셀으로 마약을 수송 하는 이상적인 시스템 이다. 긴 noncoding RNAs (lncRNAs)는 200 이상 noncoding RNA의 클러스터 nt는 단백질에 번역 될 수 없습니다 하지만 생물 학적 및 병 태 생리 과정에 중요 한 역할. 전이 관련 된 폐 선 암 사본 1 (MALAT1)은 매우 보존된 lncRNA 이다. 그것은 상부 MALAT1 여러 발성 (MM)를 포함 한 다양 한 암에서의 빈약한 예 지에 관련 된 시연 했다. 우리 MALAT1 mm; DNA 수리 및 세포 죽음 통제 밝혀졌다 따라서, MALAT1 m M에 대 한 치료 대상으로 간주 될 수 있습니다. 그러나, 센스 oligo의 억제/최저 MALAT1 vivo에서 효율적인 배달 여전히 문제입니다. 이 연구에서 우리 못 2000 SWCNT 수정 그것에 안티 MALAT1 올리고 켤레, 테스트 생체 외에서 화합물의 배달, 전파 m M 마우스 모델, 정 맥 주입 하 고 나타내는 m M 진행의 중요 한 금지를 관찰 그 SWCNT 안티 MALAT1 gapmer DNA에 대 한 이상적인 배달 셔틀 이다.

안티 MALAT1 gapmer m M에서 DNA의 억제 효과 보여, 우리 MALAT1의 식을 무 너 뜨 하 고 H929 및 MM.1S 세포에 그것을 사용. 48 시간 후, 셀 눕 힘 효율성의 분석을 위해 수집 하 고 안티 MALAT1 gapmer 또는 컨트롤 DNA transfected 세포에 있는 apoptosis 상태. qRT-PCR 결과 안티 MALAT1 gapmer DNA 뜨 MALAT1 식 H929 및 MM.1S 세포에 효율적으로 나타났다 (그림 2A). Apoptosis의 상...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

이 원고는 단일 벽 탄소 나노튜브 (SWCNT)의 합성에 설명 합니다-는 SWCNT의 안정적인 납품과의 강력한 치료 효과 보여 주는 MALAT1 센스 gapmer DNA oligonucleotide (SWCNT-안티-MALAT1) 활용 안티-MALAT1 생체 외에서 그리고 vivo. 합성, 수정, 활용, 사용 하는 방법 그리고 주입 SWCNT-안티-MALAT1의 설명.

단일 벽 탄소 나노튜브 (SWCNT)에 의해 생체 내에서 여러 Myeloma 세포 성장 억압-MALAT1 센스 Oligos 전달

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

여기서 우리가 사용하는 방법은 약물 전달을 위한 나노입자의 새로운 유형인 단일 벽 탄소 나노튜브로 올리고뉴클레오티드를 포장하는 데 도움이 될 수 있습니다. 이 기술의 주요 장점은 생체 내 세포로 올리고뉴클레오티드 약물을 보다 효율적으로 전달하는 것입니다. 이 기술의 의미는 올리고뉴클레오티드 약물의 전달을 개선하기 위해 나노 입자를 도입했기 때문에 다발성 골수종을 연구하기 위해 확장됩니다.이 방법을 통해 다발성 골수종 에 대한 치료에 대한 통찰력을 제공 할 수 있습니다. 그것은 또한 그밖 질병에 적용될 수 있고 단백질 및 소분자와 같은 그밖 화물과 결합될 수 있습니다. 먼저 단일 벽 탄소 나노튜브 1밀리그램, DSPE-PEG 2000 아민 5밀리그램, 멸균 된 뉴클레아제 없는 물 5 밀리리터를 20 밀리리터 유리 신자극 유리에 섞는다.실온에서 1시간 동안 90와트의 전력 레벨에서 수조 초음파 처리기에서 바이알을 초음파 처리합니다. 초음파 처리 후, 6 시간 동안 24, 000 배 g에서 유리병을 원심분리합니다. 그런 다음 상체 솔루션을 수집합니다.100킬로달톤 분자량 차단 원심 필터 장치에 단일 벽 탄소 나노튜브 용액의 1밀리리터를 넣고 멸균 된 뉴클레아제없는 물의 4 밀리리터를 넣습니다. 원심분리기는 실온에서 4, 000배에서 10분 동안 10분 동안 원심분리기를 사용하여 과도한 아민을 제거합니다. 아민 기능화 단일 벽 탄소 나노튜브의 450 마이크로 리터에 설포 -LC-SPDP의 0.5 밀리그램을 추가합니다.그런 다음 10x PBS의 50 마이크로리터를 추가하고 실온에서 2 시간 동안 배양하십시오. 다음으로, 반응 혼합물을 100킬로달톤 분자량 컷오프 원심 필터 장치에 추가하고, 그 다음에 는 4밀리리터의 뉴클레아제 없는 물을 첨가한다. 원심분리기는 실온에서 4, 000배에서 10분 동안 샘플을 원심분리하여 과도한 Sulfo-LC-SPDP를 제거합니다.Sulfo-LC-SPDP 처리 된 아민 단일 벽 탄소 나노 튜브 용액을 필터에 남기고 이전에 준비된 반대로 준비 된 안티 MALAT1-Cy3 용액 500 마이크로 리터로 희석하십시오. 그런 다음 하룻밤 사이에 섭씨 4도에서 샘플을 배양합니다. 비교의 최상의 결과를 달성하기 위해, 무작위로 각 그룹에서 7시험 또는 대조군으로 14 마리의 마우스를 배치하고, 각 그룹에서 동일한 남성 대 여성 비율로.다음으로, 수술 벤치를 청소하고 70 %의 에틸 알코올로 살균하십시오. 가열 램프를 사용하여 마우스 중 하나를 따뜻하게하여 꼬리 정맥이 나타날 수 있도록 돕습니다. 꼬리 주입 억제제로 마우스를 제대로 억제합니다.MM.1S-luc/mCherry 세포를 꼬리 정맥을 통해 PBS의 50 마이크로리터에 주입하십시오. 30초 동안 알코올 면봉으로 주사 부위를 누릅니다. 그런 다음 주입 된 마우스를 표시하고 깨끗한 케이지로 돌아갑니다.7일째, MM1S 세포 주입 후, 마우스의 꼬리 정맥에 단막 탄소 나노튜브 안티 말라트1을 포함하는 PBS의 50 마이크로리터를 주입한다. 그런 다음 30 초 동안 알코올 면봉으로 주사 부위를 누릅니다. 꼬리에 있는 현지 출혈과 마우스의 일반적인 동작을 1분 동안 관찰한 다음 깨끗한 케이지로 돌려놓습니다.주사가 잘 용납되는지 확인하기 위해 케이지를 랙으로 되돌리기 전에 주입 된 모든 마우스를 다시 관찰하십시오. 해부 전에 각 마우스의 무게. 혈액 세포 카운터 머신에 의해 수행 된 완전한 혈액 수 분석에 대한 심혼에서 말초 혈액을 수집합니다.다음으로, 골수, 비장, 림프절, 신장 및 눈에 보이는 전이조직을 가진 조직의 조직을 수집합니다. 골수 샘플에서 RNA와 단백질을 추출합니다. 나머지 모든 조직을 포르말린으로 수정합니다.24시간 고정 후, 0.5-어금니 EDTA 용액에 뼈 샘플을 5일 동안 담급분해합니다. 그런 다음 모든 샘플을 75%에틸 알코올에 담그고 장기 보관하십시오. QRT PCR 결과는 항 말라트1 gapmeR DNA가 말AT1 발현을 쓰러뜨리고 H929 및 MM.1S 세포에서 크게 세포멸을 유도한다는 것을 보여주었습니다.단일 벽 탄소 나노튜브 항 MALAT1-Cy3는 MM 세포의 핵으로 전달되었고, H929 및 MM.1S 세포 모두에서 내인성 MALAT1 수준을 현저히 억제하였다. BMEC-1 세포의 생존력은 단일 벽 탄소 나노튜브 항 MALAT1-Cy3의 치료 후 유의한 차이가 없거나 다른 투여량및 시점에서 제어할 수 없다. 이는 단일 벽 탄소 나노튜브 항 MALAT1-Cy3의 독성이 높은 투여량에서 정상 세포에 제한적이고 허용 가능한 독성을 갖는다는 것을 나타낸다.생체 내에서 단일 벽 탄소 나노튜브 안티 말AT1의 치료 효과를 평가하기 위해 인간 MM-보급 마우스 모델이 설립되었다. 단일 벽 탄소 나노튜브 항 말AT1 치료 군에서 마우스의 루시퍼론 신호는 21일 치료 후 대조군에 비해 현저하게 낮았다. 이러한 결과로부터, 정맥 주사를 통한 단일 벽 탄소 나노튜브 항말라1 치료가 항 말타1 올리고를 종양 세포에 효과적으로 전달할 수 있다는 결론을 내렸다.치료의 유의한 부작용이 관찰되지 않았으며, 단일 벽 탄소 나노튜브 항 말AT1 주사가 마우스에게 안전한 치료법임을 나타냅니다. 이 절차를 시도하는 동안, 세포 분자 조성이 올리고뉴클레오티드 약물의 전달, 효율성 및 치료 효과에 영향을 미칠 것이라는 점을 기억하는 것이 중요합니다. 이 절차에 따라, 단백질 또는 작은 분자의 연상 같은 다른 방법은 추가 질문에 대답하기 위해 수행 될 수있다.다른 약물을 전달하기 위해 단일 벽 탄소 나노 튜브를 사용하는 것과 같습니다.

Research

JoVE Journal

Cancer Research

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma (DIPG)

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma DIPG

확산 내장 뇌교 신경 교종의 신속한 사후 세포 배양을위한 프로토콜 (DIPG)

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a ...

연구

암 연구학

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

Vivo에서 PH, pO2, 산화 환 원 상태, 고 농도의 인산 염 및 종양 Microenvironment에 티의 EPR 평가

This protocol demonstrates the capability of low-field electron paramagnetic resonance (EPR)-based techniques in combination with functional paramagnetic ...

Multimodal Bioluminescent and Positronic-emission Tomography/Computational Tomography Imaging of Multiple Myeloma Bone Marrow Xenografts in NOG Mice

다 발성 골 수 Xenografts 노 그 쥐에서의 복합 발광 및 양자 방출 단층 촬영/컴퓨터 단층 촬영 영상

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular ...

Neutrophil Extracellular Traps Generated by Low Density Neutrophils Obtained from Peritoneal Lavage Fluid Mediate Tumor Cell Growth and Attachment

호 중구 Extracellular 함정 밀도가 낮은 호 중구에 의해 생성 된 종양 세포 성장 및 첨부 파일 중재 하십시오 복 막 게 액체에서 얻은

Activated neutrophils release neutrophil extracellular traps (NETs), which can capture and destroy microbes. Recent studies suggest that NETs are involved ...

Evaluation of Biomarkers in Glioma by Immunohistochemistry on Paraffin-Embedded 3D Glioma Neurosphere Cultures

Immunohistochemistry 파라핀 임베디드 3D Glioma Neurosphere 문화에 의해 Glioma 바이오 마커의 평가

Analysis of protein expression in glioma is relevant for several aspects in the study of its pathology. Numerous proteins have been described as ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

쥐에서 종양 성장을 감소 하는 MicroRNA의 생체 내 억제

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

종양 성장에서 암 관련 섬유아세포의 역할을 조사하기 위한 마우스 모델

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role ...

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

유방암 뇌 전이성 종양 성장을 연구하고 표적으로 삼는 Ex Vivo 뇌 슬라이스 모델

Brain metastasis is a serious consequence of breast cancer for women as these tumors are difficult to treat and are associated with poor clinical ...

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

악성 말초 신경 시스 종양 세포에서 Floxed 대립 유전자의 Ex vivo 절제에 의한 종양 발생에서 유전자 기능 정의

The development of new drugs that precisely target key proteins in human cancers is fundamentally altering cancer therapeutics. However, before these ...

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

생체 내 비장 T 세포의 유세포 분석기에 의한 종양 유래 세포밖 소포의 면역원성 스크리닝

Immunogenic cell death of tumors, caused by chemotherapy or irradiation, can trigger tumor-specific T cell responses by releasing danger-associated ...