Name: repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos
Uploaded: 2018-12-13T13:00:00
Description: Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Os autores agradecer o Lerner Research Institute proteômica, genômica e núcleos de imagens para sua assistência e apoio. Financiamento: Este trabalho é apoiado financeiramente pelo NIH/ICN grant R00 CA172292 (J.J.Z.) e fundos de start-up (para J.J.Z.) e clínica e translacional ciência colaborativa (CTSC) do caso Western Reserve University núcleo utilização piloto Grant (para J.J.Z.). Este trabalho utilizou o microscópio confocal Leica SP8 que foi comprado com financiamento da concessão de institutos nacionais de saúde SIG 1S10OD019972-01.

Todos os experimentos envolvendo animais foram pré-aprovados pela Cleveland Clinic IACUC (Comité de uso e cuidado institucional do Animal).
1. síntese de SWCNTs funcionalizados
<ol><li>Mistura de SWCNTs de 1 mg, 5 mg de DSPE-PEG2000-amina e 5 mL de água esterilizada nuclease-livre, em um frasco de cintilação (20 mL). Sacode bem para dissolver todos os reagentes completamente.</li>
	<li>Proceda à sonicação do frasco em um sonicador de banho de água a um nível de potência de 40 W p...

<ol>
	<li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system:+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis.">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li><li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy.">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li><li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+protein+transporters:+generality+and+biological+functionality.">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing.">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA:+an+investigation+of+the+uptake+mechanism+and+pathway.">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li><li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies.">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li><li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bright+side+of+dark+matter:+lncRNAs+in+cancer.">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li><li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma.">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li><li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma.">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175 (2015).</li><li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth.">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li><li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT-1,+a+novel+noncoding+RNA,+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer.">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li><li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas.">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li><li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing.">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163 (2009).</li><li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression.">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809 (2014).</li><li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma.">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+MALAT1/PARP1/LIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma.">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li><li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides.">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li><li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction.">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li><li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells.">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li><li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+modifications+in+multiple+myeloma:+recent+advances+on+the+role+of+DNA+and+histone+methylation.">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li><li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma.">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li><li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity.">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li><li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+approves+fomivirsen,+famciclovir,+and+Thalidomide.+Food+and+Drug+Administration.">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li><li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+new+drugs+for+homozygous+familial+hypercholesterolemia:+managing+benefits+and+risks+in+a+rare+disorder.">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li><li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Eteplirsen+for+Muscular+Dystrophy.">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480 (2017).</li><li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery.">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li><li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics.">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li><li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomedical+applications+of+functionalised+carbon+nanotubes.">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), 571-577 (2005).</li><li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods.">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li><li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes.">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li><li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pH-sensitive+poly(histidine)-PEG/DSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery.">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li><li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages.">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li><li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA.">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li><li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+reduction+of+disulfide+bonds+in+lysosomes:+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+(GILT).">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li><li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Membrane+perturbation+by+carbon+nanotube+insertion:+pathways+to+internalization.">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li><li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers.">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li><li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells.">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li><li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes:+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles.">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li><li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paradoxical+glomerular+filtration+of+carbon+nanotubes.">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li></ol>

A evidência mostrou que lncRNAs participar na regulação de numerosos processos fisiológicos e fisiopatológicos em cânceres, incluindo MM7,8,9; Eles têm o potencial para ser direcionado para o tratamento de câncer, que pode ser realizado por oligonucleotides antisentido20,21,22. O E.U. Food and Drug Administration (FDA) aprovou v...

O SWCNT é um romance nanomaterial que pode fornecer vários tipos de drogas, tais como pequenas moléculas, proteínas e ácidos nucleicos, estàvel e eficientemente com ideal tolerabilidade e toxicidade mínima em vitro1 e2de in vivo. Um SWCNT funcionalizado tem grande solubilidade em água e biocompatibilidade, pode ser usado como um serviço de transporte para moléculas menores e pode transportá-los para penetrar a membrana celular3,4,5.
lncRNAs são um aglomerado de RNA (> 200 nt) que são transcritas do genoma de mRNA, mas não pode ser traduzido em proteínas. Aumentando a evidência mostrou que lncRNAs participar na regulação da expressão de gene6 e estão envolvidas na iniciação e progressão da maioria dos tipos de câncer, incluindo MM7,8,9. MALAT1 é uma transcrição não-codificante nuclear enriquecido 2 (NEAT2) e um altamente conservadas lncRNA10. MALAT1 é inicialmente reconhecido em metastásico pulmão não-pequenas células de câncer (NSCLC)11, mas tem sido overexpressed em inúmeros tumores5,12,13; é um do mais altamente expressa lncRNAs e está correlacionada com um prognóstico pobre em MM8,14. O nível de expressão de MALAT1 é significativamente maior nos pacientes MM extra-medulares curso fatal em relação aos diagnosticados apenas como MM15.
Em um estudo anterior, confirmamos que anti-MALAT1 oligos robustamente originar danos ao DNA e apoptose em MM16 usando oligonucleotides antisentido de DNA de gapmer MALAT1 de segmentação (anti-MALAT1) em células MM. O DNA de gapmer é composto de DNA antisentido e ligado por 2'-OMe-RNAs, que poderiam solicitar MALAT1 de clivagem por RNase H atividade uma vez acoplada17. A eficiência de entrega in vivo de oligos antisentidos ainda limita seu uso clínico.
Para testar a entrega o efeito de SWCNT para anti-MALAT1 gapmer oligos, o anti-MALAT1 gapmer DNA é conjugado a DSPE-PEG2000-amina acrescida SWCNT. O SWCNT-anti-MALAT1 então é injetado por via intravenosa em um modelo de rato disseminadas MM; observa-se uma inibição marcante depois de quatro tratamentos.

<table border="0" cellpadding="0" cellspacing="0" style="width:1168px;" width="1167">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:324px;">SWCNTs</td>
			<td style="width:199px;">Millipore-Sigma</td>
			<td style="width:209px;">704113</td>
			<td style="width:436px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DSPE-PEG2000-Amine</td>
			<td>Avanti Polar Lipids</td>
			<td>880128</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">bath sonicator</td>
			<td>VWR</td>
			<td>97043-992</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">4 mL centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>Z740208-8EA</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">UV/VIS spectrometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sulfo-LC-SPDP</td>
			<td>ProteoChem</td>
			<td>c1118</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DTT solution</td>
			<td>Millipore-Sigma</td>
			<td>43815</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NAP-5 column</td>
			<td>GE Healthcare</td>
			<td>17-0853-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">in vivo imaging system</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NOD.CB17-Prkdcscid/J mice</td>
			<td>Charles River lab</td>
			<td>250</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Flow cytometer</td>
			<td>Becton Dickinso</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Lipofectamine</td>
			<td>Invitrogen</td>
			<td>11668019</td>
			<td>Lipofectamine2000</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Fetal bovine serum (FBS)</td>
			<td>Invitrogen</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RMPI-1640 medium</td>
			<td>Invitrogen</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- GTTCTGATCCCGCTGCTATT - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- TCCTCAACACTCAGCCTTTATC - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CAAGAGCACAAGAGGAAGAGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CTACATGGCAACTGTGAGGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Quantitative PCR using SYBR Green PCR master mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25780</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RevertAid first-stand cDNA synthesis kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-MALAT1</td>
			<td>synthesized by IDT Company</td>
			<td></td>
			<td>5&#8217;-mC*mG*mA*mA*mA*C*A*T*T 
			*G*G*C*A*C*A*mC*mA*mG*mC*mA-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Viability Assay Kit</td>
			<td>Promega Corporation</td>
			<td>G7570</td>
			<td>CellTiter-GloLuminescent Cell Viability Assay Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SPSS software</td>
			<td>IBM</td>
			<td>version 24.0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Luciferin</td>
			<td>Millipore-Sigma</td>
			<td>L9504</td>
			<td></td>
		</tr>
	</tbody>
</table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

O nanotubo de carbono de parede simples (SWCNT) é um novo tipo de nanopartículas, que tem sido usado para entregar vários tipos de drogas em células, como proteínas, oligonucleotides e drogas sintéticas da pequeno-molécula. O SWCNT tem dimensões personalizáveis, uma grande área superficial e com flexibilidade pode vincular com drogas através de diferentes modificações na sua superfície; Portanto, é um sistema ideal para o transporte de drogas em células. Há muito tempo não codificante RNAs (lncRNAs) são um conjunto de RNA não-codificante mais de 200 nt, que não pode ser convertido em proteína, mas desempenham um papel importante nos processos biológicos e fisiopatológicos. Transcrição de adenocarcinoma do pulmão metástase-associado 1 (MALAT1) é uma lncRNA altamente conservada. Foi demonstrado que níveis mais elevados de MALAT1 estão relacionados com o mau prognóstico de vários tipos de câncer, incluindo mieloma múltiplo (MM). Temos revelou que MALAT1 regula a morte de reparação e célula de DNA em MM; assim, o MALAT1 pode ser considerado como um alvo terapêutico para MM. No entanto, a entrega eficiente do oligo antisentido para inibir/nocaute MALAT1 in vivo ainda é um problema. Neste estudo, podemos modificar o SWCNT com PEG-2000 e conjugado um oligo anti-MALAT1 para isso, testar a entrega deste composto em vitro, injetá-lo por via intravenosa em um modelo de mouse MM disseminado e observar uma significativa inibição da progressão de MM, o que indica Esse SWCNT é um vaivém de entrega ideal para gapmer anti-MALAT1 DNA.

Para demonstrar o efeito de inibição de anti-MALAT1 gapmer DNA em MM, que derrubou a expressão de MALAT1 e usado em células H929 e MM.1S. Quarenta e oito horas mais tarde, as células foram coletadas para a análise da eficiência do knock-down e o status de apoptose em células transfectadas com anti-MALAT1 gapmer ou controle de DNA. qRT-PCR os resultados mostraram que anti-MALAT1 gapmer DNA derrubou a expressão de MALAT1 nas células H929 e MM.1S com eficiência(<strong cla...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

Este manuscrito descreve a síntese de um nanotubo de carbono de parede simples (SWCNT)-conjugado MALAT1 gapmer antisentido DNA do oligonucleotide (SWCNT-anti-MALAT1), que demonstra a entrega confiável do SWCNT e o potente efeito terapêutico de anti-MALAT1 in vitro e in vivo. Métodos utilizados para síntese, modificação, conjugação, e injeção de SWCNT-anti-MALAT1 são descritos.

Repressão de crescimento de células do mieloma múltiplo na Vivo por nanotubo de carbono de parede simples (SWCNT)-entregue MALAT1 antisentido Oligos

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

O método que estamos usando aqui pode ajudar a embalar oligonucleotídeo com nanotubo de carbono de parede única, que é um novo tipo de nanopartícula para entrega de drogas. A principal vantagem dessa técnica é a entrega mais eficiente de medicamentos oligonucleotídeos em células in vivo. As implicações desta técnica se estendem à pesquisa de mieloma múltiplo, porque introduziu nanopartículas para melhorar a entrega de medicamentos oligonucleotídeos.Através deste método pode fornecer insights sobre o tratamento para mieloma múltiplo. Também pode ser aplicado a outras doenças e conjugado com outras cargas, como proteínas e pequenas moléculas. Primeiro, misture um miligrama de nanotubos de carbono de parede única, cinco miligramas de DSPE-PEG 2000 amina, e cinco mililitros de água esterilizada sem nuclease em um frasco de cintilação de vidro de 20 mililitros.Sonicar o frasco em um sonicator de banho d'água a um nível de potência de 90 watts por uma hora em temperatura ambiente. Após a sônicação, centrifugar o frasco a 24.000 vezes g durante seis horas. Então colete a solução sobrenante.Adicione um mililitro da solução de nanotubo de carbono de parede única a um dispositivo de filtro centrífugo de corte de peso molecular de 100 quilodalton, seguido por quatro mililitros de água esterilizada sem nuclease. Centrifugar por 10 minutos a 4.000 vezes g à temperatura ambiente para remover o excesso de amina. Adicione 0,5 miligramas de Sulfo-LC-SPDP a 450 microliters do nanotubo de carbono de parede única funcionalizado amina.Em seguida, adicione 50 microliters de 10x PBS, e incubar por duas horas em temperatura ambiente. Em seguida, adicione a mistura de reação a um dispositivo de filtro centrífugo de corte de peso molecular de 100 quilodalton, seguido por quatro mililitros de água sem nuclease. Centrifugar a amostra por 10 minutos a 4.000 vezes g à temperatura ambiente para remover o excesso de Sulfo-LC-SPDP.Colete a solução de nanotubo de carbono de uma parede única tratada pelo Sulfo-LC-SPDP deixada no filtro e dilua-a com 500 microliters de solução anti-MALAT1-Cy3 previamente preparada. Em seguida, incubar a amostra a quatro graus Celsius durante a noite. Para alcançar os melhores resultados de comparação, organize aleatoriamente 14 ratos em grupos de ensaio ou controle com sete em cada grupo, e com a mesma proporção homem-mulher em cada grupo.Em seguida, limpe o banco de operação e esterilize-o com 70% de álcool etílico. Use uma lâmpada de aquecimento para aquecer um dos ratos para ajudar a veia da cauda a aparecer. Contenha o mouse corretamente com um conterrático de injeção de cauda.Injete células MM.1S-luc/mCherry em 50 microliters de PBS através da veia traseira. Pressione o local da injeção com um cotonete de álcool por 30 segundos. Em seguida, marque o rato injetado e devolva-o para uma gaiola limpa.No sétimo dia, após a injeção de células MM1S, injete 50 microliters de PBS contendo nanotubo de carbono de parede única anti-MALAT1 na veia traseira do mouse. Em seguida, pressione o local da injeção com um cotonete de álcool por 30 segundos. Observe o sangramento local na cauda e o comportamento geral do rato por um minuto e, em seguida, devolva-o para uma gaiola limpa.Observe todos os camundongos injetados novamente antes de retornar a gaiola para o rack para garantir que as injeções sejam toleradas bem. Pesar cada rato antes da dissecação. Colete sangue periférico do coração para um ensaio completo de contagem sanguínea realizado por uma máquina de contador de células sanguíneas.Em seguida, recolham os tecidos da medula óssea, baço, linfonodo, rim e tecido com metástase visível. Extrair RNA e proteína das amostras de medula óssea. Conserte todos os tecidos restantes em formalina.Após 24 horas de fixação, mergulhe as amostras ósseas em uma solução EDTA 0,5 molar por cinco dias para descalcificação. Em seguida, mergulhe todas as amostras em 75% de álcool etílico para armazenamento a longo prazo. Os resultados do QRT PCR mostraram que o DNA de gapmer anti-MALAT1 derrubou a expressão MALAT1 e induziu significativamente a apoptose nas células H929 e MM.1S.Nanotubo de carbono de parede única anti-MALAT1-Cy3 foi entregue no núcleo das células MM, e suprimiu significativamente o nível de MALAT1 endógeno em ambas as células H929 e MM.1S. A viabilidade da célula BMEC-1 não tem diferença significativa após o tratamento do nanotubo de carbono de parede única anti-MALAT1-Cy3 ou controle em diferentes dosagens e pontos de tempo. Isso indica que a toxicidade do nanotubo de carbono de parede única anti-MALAT1-Cy3 tem uma toxicidade limitada e aceitável para células normais em alta dosagem.Um modelo de camundongos disseminado por MM humano foi criado para avaliar os efeitos de tratamento do nanotubo de carbono de parede única anti-MALAT1 in vivo. Os sinais de luciferon de camundongos no grupo de tratamento anti-MALAT1 de nanotubo de carbono de parede única foram notavelmente menores em comparação com o controle após 21 dias de tratamento. A partir desses resultados, concluiu-se que o tratamento anti-MALAT1 de nanotubo de carbono de parede única através de injeção intravenosa poderia fornecer os oligos anti-MALAT1 para as células tumorais efetivamente.Não foram observados efeitos colaterais significativos do tratamento, indicando que a injeção anti-MALAT1 de nanotubo de carbono de parede única é um tratamento seguro para camundongos. Ao tentar esse procedimento, é importante lembrar que a composição da molécula celular influenciará a entrega, eficiência e efeito terapêutico dos medicamentos oligonucleotídeos. Após esse procedimento, outros métodos como a conjugação de proteínas ou pequenas moléculas podem ser realizados a fim de responder a perguntas adicionais.Como usar nanotubos de carbono de parede única para entregar outras drogas.

Research

JoVE Journal

Cancer Research

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma (DIPG)

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma DIPG

Um protocolo para a Cultura rápidos post-mortem celular de Difuso Intrínseca Pontine glioma (DIPG)

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a ...

Pesquisa do câncer

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

Na Vivo Avaliação de EPR de pH, pO2, Status Redox e as concentrações de fosfato e glutationa no microambiente do Tumor

This protocol demonstrates the capability of low-field electron paramagnetic resonance (EPR)-based techniques in combination with functional paramagnetic ...

Multimodal Bioluminescent and Positronic-emission Tomography/Computational Tomography Imaging of Multiple Myeloma Bone Marrow Xenografts in NOG Mice

Imagem de tomografia computadorizada multimodal bioluminescentes e emissão positrônica Tomography/computacional de mieloma múltiplo Xenografts de medula óssea em camundongos NOG

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular ...

Neutrophil Extracellular Traps Generated by Low Density Neutrophils Obtained from Peritoneal Lavage Fluid Mediate Tumor Cell Growth and Attachment

Neutrófilos armadilhas extracelulares geradas pela baixa densidade neutrófilos obtidos de fluido de lavagem Peritoneal mediato fixação e crescimento de células de Tumor

Activated neutrophils release neutrophil extracellular traps (NETs), which can capture and destroy microbes. Recent studies suggest that NETs are involved ...

Evaluation of Biomarkers in Glioma by Immunohistochemistry on Paraffin-Embedded 3D Glioma Neurosphere Cultures

Avaliação de biomarcadores em Glioma por imuno-histoquímica na parafina Glioma 3D Neurosphere culturas

Analysis of protein expression in glioma is relevant for several aspects in the study of its pathology. Numerous proteins have been described as ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

In vivo inibição de MicroRNA para diminuir o crescimento tumoral em camundongos

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

Um Modelo de Camundongo para Investigar o Papel de Fibroblastos Associados ao Câncer no Crescimento Tumoral

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role ...

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

Um modelo de fatia cerebral ex vivo para estudar e direcionar o crescimento do tumor metastático do câncer de mama

Brain metastasis is a serious consequence of breast cancer for women as these tumors are difficult to treat and are associated with poor clinical ...

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Definindo funções genéticas em Tumorigênese por Ex vivo Ablaation of Floxed Alleles in Maligna Periférico Nerve Hemato Tumor Cells

The development of new drugs that precisely target key proteins in human cancers is fundamentally altering cancer therapeutics. However, before these ...

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In vivo Triagem de imunogenicidade de vesículas extracelulares derivadas do tumor por citometria de fluxo de células T esplênicas

Immunogenic cell death of tumors, caused by chemotherapy or irradiation, can trigger tumor-specific T cell responses by releasing danger-associated ...