Name: repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos
Uploaded: 2018-12-13T13:00:00
Description: Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Yazarlar Lerner Araştırma Enstitüsü proteomik, genomik ve görüntüleme göbek onların yardım için teşekkür ederiz ve destek. Fonlama: Bu eser mali NIH/ncı hibe R00 CA172292 (J.J.Z.) ve başlangıç fonlar (için J.J.Z.) ve klinik ve çevirim bilim işbirlikçi (CTSC) Case Western Reserve Üniversitesi temel kullanımı Pilot hibe (için J.J.Z.) tarafından desteklenmiştir. Bu eser Ulusal Sağlık Enstitüleri SIG grant 1S10OD019972-01 ile fon ile satın alınmış Leica SP8 confocal mikroskop kullanılmaktadır.

Tüm deney hayvanları içeren (kurumsal hayvan bakım ve kullanım Komitesi) Cleveland Kliniği IACUC tarafından önceden onaylanmış.
1. Functionalized SWCNTs sentezi
<ol><li>Mix 1 mg SWCNTs, DSPE-PEG2000-Amin 5 mg ve 5 mL steril nükleaz ücretsiz su cam mercek flakon (20 mL). Salla de tüm reaktifler tamamen erimesi için.</li>
	<li>Bir su banyosu sonicator 40 W oda sıcaklığında 1 h için bir güç düzeyinde şişede solüsyon içeren temizleyicide (RT, 20 dk x 3, değiştirmek he...

<ol>
	<li>Jiang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNase+non-sensitive+and+endocytosis+independent+siRNA+delivery+system:+delivery+of+siRNA+into+tumor+cells+and+high+efficiency+induction+of+apoptosis.">RNase non-sensitive and endocytosis independent siRNA delivery system: delivery of siRNA into tumor cells and high efficiency induction of apoptosis.</a> Nanoscale. 5 (16), 7256-7264 (2013).</li><li>Murakami, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Water-dispersed+single-wall+carbon+nanohorns+as+drug+carriers+for+local+cancer+chemotherapy.">Water-dispersed single-wall carbon nanohorns as drug carriers for local cancer chemotherapy.</a> Nanomedicine (Lond). 3 (4), 453-463 (2008).</li><li>Kam, N. W., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+protein+transporters:+generality+and+biological+functionality.">Carbon nanotubes as intracellular protein transporters: generality and biological functionality.</a> Journal of the American Chemical Society. 127 (16), 6021-6026 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functionalization+of+carbon+nanotubes+via.+cleavable+disulfide+bonds+for+efficient+intracellular+delivery+of+siRNA+and+potent+gene+silencing.">Functionalization of carbon nanotubes via. cleavable disulfide bonds for efficient intracellular delivery of siRNA and potent gene silencing.</a> Journal of the American Chemical Society. 127 (36), 12492-12493 (2005).</li><li>Kam, N. W., Liu, Z., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+intracellular+transporters+for+proteins+and+DNA:+an+investigation+of+the+uptake+mechanism+and+pathway.">Carbon nanotubes as intracellular transporters for proteins and DNA: an investigation of the uptake mechanism and pathway.</a> Angewandte Chemie International Edition in English. 45 (4), 577-581 (2006).</li><li>Ntziachristos, P., Abdel-Wahab, O., Aifantis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+of+epigenetic+dysregulation+in+hematological+malignancies.">Emerging concepts of epigenetic dysregulation in hematological malignancies.</a> Nature Immunology. 17 (9), 1016-1024 (2016).</li><li>Evans, J. R., Feng, F. Y., Chinnaiyan, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bright+side+of+dark+matter:+lncRNAs+in+cancer.">The bright side of dark matter: lncRNAs in cancer.</a> Journal of Clinical Investigation. 126 (8), 2775-2782 (2016).</li><li>Ronchetti, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lncRNA+transcriptional+fingerprints+characterize+progressive+stages+of+multiple+myeloma.">Distinct lncRNA transcriptional fingerprints characterize progressive stages of multiple myeloma.</a> Oncotarget. 7 (12), 14814-14830 (2016).</li><li>Wong, K. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+silencing+of+a+long+non-coding+RNA+KIAA0495+in+multiple+myeloma.">Epigenetic silencing of a long non-coding RNA KIAA0495 in multiple myeloma.</a> Molecular Cancer. 14, 175 (2015).</li><li>Schmidt, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+long+noncoding+MALAT-1+RNA+indicates+a+poor+prognosis+in+non-small+cell+lung+cancer+and+induces+migration+and+tumor+growth.">The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth.</a> Journal of Thoracic Oncology. 6 (12), 1984-1992 (2011).</li><li>Ji, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT-1,+a+novel+noncoding+RNA,+and+thymosin+beta4+predict+metastasis+and+survival+in+early-stage+non-small+cell+lung+cancer.">MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer.</a> Oncogene. 22 (39), 8031-8041 (2003).</li><li>Luo, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptomic+and+genomic+analysis+of+human+hepatocellular+carcinomas+and+hepatoblastomas.">Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas.</a> Hepatology. 44 (4), 1012-1024 (2006).</li><li>Guffanti, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transcriptional+sketch+of+a+primary+human+breast+cancer+by+454+deep+sequencing.">A transcriptional sketch of a primary human breast cancer by 454 deep sequencing.</a> BMC Genomics. 10, 163 (2009).</li><li>Cho, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MALAT1+long+non-coding+RNA+is+overexpressed+in+multiple+myeloma+and+may+serve+as+a+marker+to+predict+disease+progression.">MALAT1 long non-coding RNA is overexpressed in multiple myeloma and may serve as a marker to predict disease progression.</a> BMC Cancer. 14, 809 (2014).</li><li>Handa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+MALAT1+is+an+inducible+stress+response+gene+associated+with+extramedullary+spread+and+poor+prognosis+of+multiple+myeloma.">Long non-coding RNA MALAT1 is an inducible stress response gene associated with extramedullary spread and poor prognosis of multiple myeloma.</a> British Journal of Haematology. 179 (3), 449-460 (2017).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+MALAT1/PARP1/LIG3+complex+induces+DNA+damage+and+apoptosis+in+multiple+myeloma.">Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma.</a> Leukemia. , (2018).</li><li>Lennox, K. A., Behlke, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+localization+of+long+non-coding+RNAs+affects+silencing+by+RNAi+more+than+by+antisense+oligonucleotides.">Cellular localization of long non-coding RNAs affects silencing by RNAi more than by antisense oligonucleotides.</a> Nucleic Acids Research. 44 (2), 863-877 (2016).</li><li>Kam, N. W., O'Connell, M., Wisdom, J. A., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carbon+nanotubes+as+multifunctional+biological+transporters+and+near-infrared+agents+for+selective+cancer+cell+destruction.">Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (33), 11600-11605 (2005).</li><li>Zeineldin, R., Al-Haik, M., Hudson, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+polyethylene+glycol+integrity+in+specific+receptor+targeting+of+carbon+nanotubes+to+cancer+cells.">Role of polyethylene glycol integrity in specific receptor targeting of carbon nanotubes to cancer cells.</a> Nano Letters. 9 (2), 751-757 (2009).</li><li>Amodio, N., D'Aquila, P., Passarino, G., Tassone, P., Bellizzi, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+modifications+in+multiple+myeloma:+recent+advances+on+the+role+of+DNA+and+histone+methylation.">Epigenetic modifications in multiple myeloma: recent advances on the role of DNA and histone methylation.</a> Expert Opinion on Therapeutic Targets. 21 (1), 91-101 (2017).</li><li>Ahmad, N., Haider, S., Jagannathan, S., Anaissie, E., Driscoll, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+theragnostics+for+the+clinical+management+of+multiple+myeloma.">MicroRNA theragnostics for the clinical management of multiple myeloma.</a> Leukemia. 28 (4), 732-738 (2014).</li><li>Amodio, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+lncRNA+MALAT1+via.+LNA+gapmeR+ASO+inhibits+gene+expression+of+proteasome+subunits+and+triggers+anti-multiple+myeloma+activity.">Drugging the lncRNA MALAT1 via. LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity.</a> Leukemia. , (2018).</li><li>Highleyman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+approves+fomivirsen,+famciclovir,+and+Thalidomide.+Food+and+Drug+Administration.">FDA approves fomivirsen, famciclovir, and Thalidomide. Food and Drug Administration.</a> BETA. 5, (1998).</li><li>Smith, R. J., Hiatt, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+new+drugs+for+homozygous+familial+hypercholesterolemia:+managing+benefits+and+risks+in+a+rare+disorder.">Two new drugs for homozygous familial hypercholesterolemia: managing benefits and risks in a rare disorder.</a> JAMA Internal Medicine. 173 (16), 1491-1492 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Therapeutics. 27 (2), 67-69 (2017).</li><li>Nelson, S. F., Miceli, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Eteplirsen+for+Muscular+Dystrophy.">FDA Approval of Eteplirsen for Muscular Dystrophy.</a> The Journal of the American Medical Association. 317 (14), 1480 (2017).</li><li>Liu, Z., Sun, X., Nakayama-Ratchford, N., Dai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Supramolecular+chemistry+on+water-soluble+carbon+nanotubes+for+drug+loading+and+delivery.">Supramolecular chemistry on water-soluble carbon nanotubes for drug loading and delivery.</a> American Chemical Society Nano. 1 (1), 50-56 (2007).</li><li>Ali-Boucetta, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiwalled+carbon+nanotube-doxorubicin+supramolecular+complexes+for+cancer+therapeutics.">Multiwalled carbon nanotube-doxorubicin supramolecular complexes for cancer therapeutics.</a> Chemical communications (Cambridge). (4), 459-461 (2008).</li><li>Bianco, A., Kostarelos, K., Partidos, C. D., Prato, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biomedical+applications+of+functionalised+carbon+nanotubes.">Biomedical applications of functionalised carbon nanotubes.</a> Chemical communications. (5), 571-577 (2005).</li><li>Hadidi, N., Kobarfard, F., Nafissi-Varcheh, N., Aboofazeli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+single-walled+carbon+nanotube+solubility+by+noncovalent+PEGylation+using+experimental+design+methods.">Optimization of single-walled carbon nanotube solubility by noncovalent PEGylation using experimental design methods.</a> International Journal of Nanomedicine. 6, 737-746 (2011).</li><li>Padilla-Parra, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+imaging+of+endosome+acidification+and+single+retrovirus+fusion+with+distinct+pools+of+early+endosomes.">Quantitative imaging of endosome acidification and single retrovirus fusion with distinct pools of early endosomes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (43), 17627-17632 (2012).</li><li>Wu, H., Zhu, L., Torchilin, V. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pH-sensitive+poly(histidine)-PEG/DSPE-PEG+co-polymer+micelles+for+cytosolic+drug+delivery.">pH-sensitive poly(histidine)-PEG/DSPE-PEG co-polymer micelles for cytosolic drug delivery.</a> Biomaterials. 34 (4), 1213-1222 (2013).</li><li>Oishi, M., Nagatsugi, F., Sasaki, S., Nagasaki, Y., Kataoka, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+polyion+complex+micelles+for+targeted+intracellular+delivery+of+PEGylated+antisense+oligonucleotides+containing+acid-labile+linkages.">Smart polyion complex micelles for targeted intracellular delivery of PEGylated antisense oligonucleotides containing acid-labile linkages.</a> Chembiochem. 6 (4), 718-725 (2005).</li><li>Dong, H., Ding, L., Yan, F., Ji, H., Ju, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+polyethylenimine-grafted+graphene+nanoribbon+for+cellular+delivery+of+locked+nucleic+acid+modified+molecular+beacon+for+recognition+of+microRNA.">The use of polyethylenimine-grafted graphene nanoribbon for cellular delivery of locked nucleic acid modified molecular beacon for recognition of microRNA.</a> Biomaterials. 32 (15), 3875-3882 (2011).</li><li>Arunachalam, B., Phan, U. T., Geuze, H. J., Cresswell, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+reduction+of+disulfide+bonds+in+lysosomes:+characterization+of+a+gamma-interferon-inducible+lysosomal+thiol+reductase+(GILT).">Enzymatic reduction of disulfide bonds in lysosomes: characterization of a gamma-interferon-inducible lysosomal thiol reductase (GILT).</a> Proceedings of the National Academy of Sciences of the United States of America. 97 (2), 745-750 (2000).</li><li>Lelimousin, M., Sansom, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Membrane+perturbation+by+carbon+nanotube+insertion:+pathways+to+internalization.">Membrane perturbation by carbon nanotube insertion: pathways to internalization.</a> Small. 9 (21), 3639-3646 (2013).</li><li>Thomas, M., Enciso, M., Hilder, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+mechanism+and+stability+of+boron+nitride+nanotubes+in+lipid+bilayers.">Insertion mechanism and stability of boron nitride nanotubes in lipid bilayers.</a> J Phys Chem B. 119 (15), 4929-4936 (2015).</li><li>Jin, H., Heller, D. A., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-particle+tracking+of+endocytosis+and+exocytosis+of+single-walled+carbon+nanotubes+in+NIH-3T3+cells.">Single-particle tracking of endocytosis and exocytosis of single-walled carbon nanotubes in NIH-3T3 cells.</a> Nano Letters. 8 (6), 1577-1585 (2008).</li><li>Jin, H., Heller, D. A., Sharma, R., Strano, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Size-dependent+cellular+uptake+and+expulsion+of+single-walled+carbon+nanotubes:+single+particle+tracking+and+a+generic+uptake+model+for+nanoparticles.">Size-dependent cellular uptake and expulsion of single-walled carbon nanotubes: single particle tracking and a generic uptake model for nanoparticles.</a> American Chemical Society Nano. 3 (1), 149-158 (2009).</li><li>Ruggiero, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paradoxical+glomerular+filtration+of+carbon+nanotubes.">Paradoxical glomerular filtration of carbon nanotubes.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (27), 12369-12374 (2010).</li></ol>

Kanıt lncRNAs kanserler, MM7,8,9dahil olmak üzere çok sayıda fizyolojik ve patofizyolojik yordamlarda yönetmelikte yer almak göstermiştir; Onlar antianlamlı oligonucleotides20,21,22tarafından gerçekleştirilebilir kanser tedavisi için hedef olma potansiyeline sahip. ABD Gıda ve İlaç Dairesi (FDA) fomivirsen sitomegalovirü...

SWCNT çeşitli ilaçlar, nükleik asitler, proteinler ve küçük moleküller gibi ideal tolerabilite ve in vitro1 ve içinde vivo2en az toksisite stably ve verimli bir şekilde sunabilir bir roman nanomaterial var. Functionalized SWCNT büyük biyouyumluluk ve su çözünürlük vardır, bir mekik daha küçük moleküller için kullanılabilir ve hücre zarının3,4,5nüfuz onları taşıyabilir.
lncRNAs olan bir küme RNA'ın (> 200 nt) bu mRNA için genom transkripsiyonu ama protein çevrilemez. Kanıt artan lncRNAs gen ifade6 Yönetmelikte katılmak ve inisiyasyon ve en tip-in MM7,8,9dahil olmak üzere kanser progresyon katılmaktadırlar göstermiştir. MALAT1 olan bir nükleer zenginleştirilmiş kodlamayan transkript 2 (NEAT2) ve son derece korunmuş lncRNA10. MALAT1 başlangıçta metastatik olmayan küçük hücreli akciğer kanseri (NSCLC)11' kabul edilmektedir, ancak çok sayıda tümör5,12,13' te overexpressed; en çok ifade lncRNAs biridir ve kötü prognoz MM8,14ile ilişkilidir. MALAT1 ifade düzeyini yalnızca MM15tanısı göre ölümcül ders ekstramedullar MM hastalarda anlamlı olarak daha yüksek.
Bir önceki çalışmada, biz anti-MALAT1 oligos sağlam DNA hasarı ve MM16 apoptosis gapmer DNA antianlamlı oligonucleotides MALAT1 hedefleme kullanarak yol doğruladı (anti-MALAT1) MM hücrelerdeki. Gapmer DNA antianlamlı DNA'sı oluşur ve 2'-OMe-hangi MALAT1 bölünme RNase H bir kez bağlı etkinlik17tarafından sor RNA'ların, bağlanmıştır. Antianlamlı oligos içinde vivo teslim verimliliğini hala klinik kullanımını sınırlar.
Teslim test etmek için SWCNT etkisi için anti-MALAT1 gapmer oligos, DNA DSPE-PEG2000-Amin için Birleşik anti-MALAT1 gapmer SWCNT functionalized. SWCNT-anti-MALAT1 sonra intravenöz bir MM Dissemine fare modeli enjekte edilir; çarpıcı bir inhibisyon dört tedaviler sonra görülmektedir.

<table border="0" cellpadding="0" cellspacing="0" style="width:1168px;" width="1167">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:324px;">SWCNTs</td>
			<td style="width:199px;">Millipore-Sigma</td>
			<td style="width:209px;">704113</td>
			<td style="width:436px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DSPE-PEG2000-Amine</td>
			<td>Avanti Polar Lipids</td>
			<td>880128</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">bath sonicator</td>
			<td>VWR</td>
			<td>97043-992</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">4 mL centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>Z740208-8EA</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">UV/VIS spectrometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>extinction coefficient of 0.0465 L/mg/cm at 808 nm</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sulfo-LC-SPDP</td>
			<td>ProteoChem</td>
			<td>c1118</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">DTT solution</td>
			<td>Millipore-Sigma</td>
			<td>43815</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NAP-5 column</td>
			<td>GE Healthcare</td>
			<td>17-0853-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">in vivo imaging system</td>
			<td>PerkinElmer</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">NOD.CB17-Prkdcscid/J mice</td>
			<td>Charles River lab</td>
			<td>250</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Flow cytometer</td>
			<td>Becton Dickinso</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Lipofectamine</td>
			<td>Invitrogen</td>
			<td>11668019</td>
			<td>Lipofectamine2000</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Fetal bovine serum (FBS)</td>
			<td>Invitrogen</td>
			<td>10437-028</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RMPI-1640 medium</td>
			<td>Invitrogen</td>
			<td>11875-093</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- GTTCTGATCCCGCTGCTATT - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MALAT1-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- TCCTCAACACTCAGCCTTTATC - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QF:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CAAGAGCACAAGAGGAAGAGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GAPDH-QR:</td>
			<td>synthesized by IDT Company</td>
			<td style="width:209px;"></td>
			<td>5&#8217;- CTACATGGCAACTGTGAGGAG - 3&#8217;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Quantitative PCR using SYBR Green PCR master mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>A25780</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RevertAid first-stand cDNA synthesis kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>K1621</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">anti-MALAT1</td>
			<td>synthesized by IDT Company</td>
			<td></td>
			<td>5&#8217;-mC*mG*mA*mA*mA*C*A*T*T 
			*G*G*C*A*C*A*mC*mA*mG*mC*mA-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Viability Assay Kit</td>
			<td>Promega Corporation</td>
			<td>G7570</td>
			<td>CellTiter-GloLuminescent Cell Viability Assay Kit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">accuSkan GO UV/Vis Microplate Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifugal filter</td>
			<td>Millipore-Sigma</td>
			<td>UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SPSS software</td>
			<td>IBM</td>
			<td>version 24.0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">D-Luciferin</td>
			<td>Millipore-Sigma</td>
			<td>L9504</td>
			<td></td>
		</tr>
	</tbody>
</table>

repression of multiple myeloma cell growth in vivo by single-wall carbon nanotube (swcnt)-delivered malat1 antisense oligos

Tek-duvar karbon nanotüp (SWCNT) olan hücrelere, proteinler, oligonucleotides ve sentetik küçük molekül uyuşturucu gibi birden fazla çeşit uyuşturucu dağıtmak için kullanılan nanopartikül, yeni bir türüdür. SWCNT özelleştirilebilir boyutları, yüzeysel geniş bir alanı vardır ve esnek yüzeyinde farklı değişiklikler yoluyla uyuşturucu ile bağlayabilirsiniz; Bu nedenle, uyuşturucu hücreye taşımak için ideal bir sistemdir. Uzun kodlamayan RNA'ların (lncRNAs) bir küme kodlamayan RNA 200 daha uzun olan nt, protein çevrilemeyen ancak biyolojik ve patofizyolojik işlemlerinde önemli bir rol oynamaktadır. Metastaz ilişkili akciğer adenokarsinom transkript 1 (MALAT1) son derece korunmuş bir lncRNA olduğunu. Yüksek MALAT1 düzeyleri multipl miyelom (MM) de dahil olmak üzere çeşitli kanserlerin kötü prognoz ile ilgili gösterilmiştir. Biz-si olmak kâşif MALAT1 DNA tamiri ve hücre ölüm mm düzenler; Böylece, MALAT1 MM için terapötik hedef olarak kabul edilebilir. Ancak, antianlamlı oligo verimli bir şekilde teslim inhibe/nakavt vivo içinde MALAT1 için hala bir sorundur. Bu çalışmada biz PEG-2000 ile SWCNT değiştirmek ve bunu bir anti-MALAT1 oligo eşlenik, bu bileşik tüp bebek teslim test etmek, Dissemine bir MM fare modeli olarak intravenöz enjekte etmek ve MM progresyon gösteren önemli bir inhibisyon gözlemlemek o SWCNT bir ideal teslimat servisi için anti-MALAT1 gapmer DNA'sı var.

Anti-MALAT1 gapmer DNA mm inhibisyon etkisini göstermek için biz MALAT1 ifade çaldı ve H929 ve MM.1S hücrelerinde kullanılan. 48 saat sonra hücre knock-down Verimlilik Analizi için toplanmıştır ve anti-MALAT1 gapmer veya denetim DNA ile hücrelerde apoptoz durumu transfected. qRT-PCR sonuçları (Şekil 2A) Anti-MALAT1 gapmer DNA H929 ve MM.1S hücreleri MALAT1 ifadede verimli bir şekilde yere serdi olduğunu gösterdi. Apoptozis ...

Watch this Scientific Journal Video about Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos at JoVE.com

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube SWCNT-delivered MALAT1 Antisense Oligos

Bu el yazması bir tek-duvar karbon nanotüp (SWCNT) sentezi açıklar-SWCNT güvenilir teslim ve güçlü tedavi edici etkisini gösteren MALAT1 antianlamlı gapmer DNA oligonükleotid (SWCNT-anti-MALAT1), Birleşik Anti-MALAT1 tüp bebek ve içinde vivo. Yöntemleri kullanılan sentez, değiştirme, fiil ve SWCNT-anti-MALAT1 enjeksiyon açıklanmıştır.

Multipl Miyelom hücre büyümesini Vivo tek-duvar karbon nanotüp (SWCNT) tarafından yapılan bir baskı-MALAT1 antianlamlı Oligos teslim

The single-wall carbon nanotube (SWCNT) is a new type of nanoparticle, which has been used to deliver multiple kinds of drugs into cells, such as ...

Burada kullandığımız yöntem, oligonükleotidin tek duvarlı karbon nanotüp ile paketletilmeye yardımcı olabilir, ki bu ilaç teslimatı için yeni bir nanopartikül türüdür. Bu tekniğin en önemli avantajı, oligonükleotid ilaçların in vivo hücrelere daha verimli bir şekilde ulaştırılmasıdır. Bu tekniğin etkileri multipl miyelom araştırmasına kadar uzanır, çünkü oligonükleotid ilaçların teslimini iyileştirmek için nanopartikül madde yi piyasaya sürükler.Bu yöntem sayesinde multipl miyelom tedavisi hakkında bilgi sağlayabilir. Aynı zamanda diğer hastalıklara uygulanabilir ve proteinler ve küçük moleküller gibi diğer kargo ile konjuge. İlk olarak, bir miligram tek duvarlı karbon nanotüpler, beş miligram DSPE-PEG 2000 amin ve 20 mililitrelik cam sintillasyon şişesinde beş mililitre sterilize nükleaz içermeyen suyu karıştırın.Oda sıcaklığında bir saat boyunca 90 watt güç seviyesinde bir su banyosu sonicator şişe sonicate. Sonication sonra, altı saat boyunca 24, 000 kez g şişe santrifüj. Sonra supernatant çözüm toplamak.100 kilodalton moleküler ağırlık kesme santrifüj filtre cihazı ve ardından steril çekirdeksiz su dört mililitre tek duvarkarbon nanotüp çözeltisi bir mililitre ekleyin. Fazla amini çıkarmak için oda sıcaklığında 4,000 kez g'de 10 dakika santrifüj. Amin fonksiyonlu tek duvarlı karbon nanotüp 450 mikrolitre Sulfo-LC-SPDP 0,5 miligram ekleyin.Sonra 10x PBS 50 mikrolitre ekleyin ve oda sıcaklığında iki saat kuluçka. Daha sonra, 100 kilodalton moleküler ağırlık kesme santrifüj filtre cihazı, nükleaz içermeyen su dört mililitre takip reaksiyon karışımı ekleyin. Fazla Sulfo-LC-SPDP'yi çıkarmak için numuneyi oda sıcaklığında 4,000 kez g'de 10 dakika santrifüj edin.Filtrede bırakılan Sulfo-LC-SPDP ile işlenmiş amin tek duvarlı karbon nanotüp çözeltisini toplayın ve daha önce hazırlanmış 500 mikrolitre anti-MALAT1-Cy3 çözeltisi ile seyreltin. Sonra numuneyi bir gecede dört derecede kuluçkaya yatırın. Karşılaştırmanın en iyi sonuçlarını elde etmek için, 14 fareyi her grupta yedi tane olan ve her grupta aynı erkek-kadın oranına sahip deneme veya kontrol gruplarına rastgele yerleştirin.Daha sonra, operasyon tezgahını temizleyin ve %70 etil alkolle sterilize edin. Kuyruk damarının görünmesine yardımcı olmak için farelerden birini ısıtmak için Bir ısıtma lambası kullanın. Fareyi kuyruk enjeksiyonu engelleyiciyle düzgün bir şekilde dizginle.MM.1S-luc/mCherry hücrelerini kuyruk damarına 50 mikrolitre PBS enjekte edin. Enjeksiyon bölgesine 30 saniye boyunca alkol bezi ile basın. Sonra enjekte edilen fareyi işaretleyin ve temiz bir kafese geri döndürün.Yedinci gün, MM1S hücre enjeksiyonundan sonra, farenin kuyruk damarına tek duvarlı karbon nanotüp anti-MALAT1 içeren 50 mikrolitre PBS enjekte edin. Daha sonra 30 saniye boyunca bir alkol bezi ile enjeksiyon sitesine basın. Kuyruktaki lokal kanamayı ve farenin genel davranışını bir dakika boyunca gözlemleyin ve sonra temiz bir kafese geri döndürün.Enjeksiyonların iyi tolere edildiğinden emin olmak için kafesi rafa geri vermeden önce enjekte edilen tüm fareleri tekrar gözlemleyin. Diseksiyondan önce her fareyi tartın. Bir kan hücresi sayAcı makinesi tarafından yapılan tam bir kan sayımı tahlili için kalpten periferik kan toplamak.Sonra, kemik iliği, dalak, lenf düğümü, böbrek ve görünür metastazı olan doku dokuları toplamak. Kemik iliği örneklerinden RNA ve protein ayıklayın. Formalin kalan tüm dokuları düzeltin.24 saatlik fiksasyondan sonra kemik örneklerini kireçlenme için beş gün boyunca 0,5 molar EDTA çözeltisine batırın. Daha sonra tüm numuneleri uzun süreli depolama için %75 etil alkole batırın. QRT PCR sonuçları anti-MALAT1 gapmeR DNA'nın MALAT1 ekspresyonunu düşürüp H929 ve MM.1S hücrelerinde önemli ölçüde apoptoza neden olduğunu göstermiştir.Tek duvarlı karbon nanotüp anti-MALAT1-Cy3 MM hücrelerinin çekirdeğine teslim edildi ve hem H929 hem de MM.1S hücrelerinde endojen MALAT1 seviyesini önemli ölçüde bastırdı. BMEC-1 hücresinin canlılığı, tek duvarlı karbon nanotüp anti-MALAT1-Cy3 tedavisinden veya farklı dozlarda ve zaman noktalarında kontrol edildikten sonra anlamlı bir fark yaratmaz. Bu tek duvarlı karbon nanotüp anti-MALAT1-Cy3 toksisitesi yüksek dozda normal hücrelere sınırlı ve kabul edilebilir toksisite olduğunu gösterir.Bir insan MM-yaygın fare modeli in vivo tek duvarlı karbon nanotüp anti-MALAT1 tedavi etkilerini değerlendirmek için kurulmuştur. Tek duvarlı karbon nanotüp anti-MALAT1 tedavi grubundaki farelerin luciferon sinyalleri, 21 günlük tedaviden sonra kontrole göre oldukça düşüktü. Bu sonuçlardan, intravenöz enjeksiyon yoluyla tek duvarlı karbon nanotüp anti-MALAT1 tedavisinin tümör hücrelerine anti-MALAT1 oligolarını etkili bir şekilde verebileceği sonucuna varılmıştır.Tek duvarlı karbon nanotüp anti-MALAT1 enjeksiyonunun fareler için güvenli bir tedavi olduğunu belirten tedavinin önemli bir yan etkisi gözlenmemiştir. Bu prosedürü denerken, hücre molekülü bileşiminin oligonükleotid ilaçların doğumunu, verimliliğini ve terapötik etkisini etkileyeceğini unutmamak önemlidir. Bu prosedürü takiben, proteinlerin veya küçük moleküllerin konjugasyonu gibi diğer yöntemler ek soruları cevaplamak için yapılabilir.Diğer ilaçlar sunmak için tek duvarlı karbon nanotüpler kullanarak gibi.

Research

JoVE Journal

Cancer Research

Repression of Multiple Myeloma Cell Growth In Vivo by Single-wall Carbon Nanotube (SWCNT)-delivered MALAT1 Antisense Oligos

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma (DIPG)

A Protocol for Rapid Post-mortem Cell Culture of Diffuse Intrinsic Pontine Glioma DIPG

Diffüz İçsel Pontine Glioma Hızlı post-mortem Hücre Kültürü için Protokol (DIPG)

Diffuse Intrinsic Pontine Glioma (DIPG) is a childhood brainstem tumor that carries a universally fatal prognosis. Because surgical resection is not a ...

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

In Vivo EPR Assessment of pH, pO2, Redox Status, and Concentrations of Phosphate and Glutathione in the Tumor Microenvironment

Vivo EPR pH, pO2, Redox durumu ve fosfat konsantrasyonları ve glutatyon tümör Microenvironment olarak değerlendirilmesi

This protocol demonstrates the capability of low-field electron paramagnetic resonance (EPR)-based techniques in combination with functional paramagnetic ...

Multimodal Bioluminescent and Positronic-emission Tomography/Computational Tomography Imaging of Multiple Myeloma Bone Marrow Xenografts in NOG Mice

Multipl Miyelom kemik iliği Xenografts NOG farelerde Multimodal kollarındaki ve pozitronik emisyon tomografi/Hesaplamalı tomografi görüntüleme

Multiple myeloma (MM) tumors engraft in the bone marrow (BM) and their survival and progression are dependent upon complex molecular and cellular ...

Neutrophil Extracellular Traps Generated by Low Density Neutrophils Obtained from Peritoneal Lavage Fluid Mediate Tumor Cell Growth and Attachment

Düşük yoğunluklu nötrofil tarafından oluşturulan nötrofil hücre dışı tuzakları Peritoneal lavaj sıvı aracılık tümör hücre büyümesini ve eki elde

Activated neutrophils release neutrophil extracellular traps (NETs), which can capture and destroy microbes. Recent studies suggest that NETs are involved ...

Evaluation of Biomarkers in Glioma by Immunohistochemistry on Paraffin-Embedded 3D Glioma Neurosphere Cultures

Biyolojik gliyom immünhistokimya parafin gömülü 3D tümörü Neurosphere kültürü üzerinde tarafından değerlendirilmesi

Analysis of protein expression in glioma is relevant for several aspects in the study of its pathology. Numerous proteins have been described as ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

Farelerde Tümör Büyümesini Azaltmak için MikroRNA'nın Vivo İnhibisyonu

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

A Mouse Model to Investigate the Role of Cancer-Associated Fibroblasts in Tumor Growth

Kanserle İlişkili Fibroblastların Tümör Büyümesindeki Rolünü Araştırmak İçin Bir Fare Modeli

Cancer-associated fibroblasts (CAFs) can play an important role in tumor growth by creating a tumor-promoting microenvironment. Models to study the role ...

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

An Ex Vivo Brain Slice Model to Study and Target Breast Cancer Brain Metastatic Tumor Growth

Meme Kanseri Beyin Metastatik Tümör Büyümesini İncelemek ve Hedeflemek için Ex Vivo Beyin Dilimi Modeli

Brain metastasis is a serious consequence of breast cancer for women as these tumors are difficult to treat and are associated with poor clinical ...

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Defining Gene Functions in Tumorigenesis by Ex vivo Ablation of Floxed Alleles in Malignant Peripheral Nerve Sheath Tumor Cells

Malign Periferik Sinir Kılıfı Tümör Hücrelerinde Floks Alellerinin Ex vivo Ablasyonu ile Tümörigenezde Gen Fonksiyonlarının Tanımlanması

The development of new drugs that precisely target key proteins in human cancers is fundamentally altering cancer therapeutics. However, before these ...

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

In Vivo Immunogenicity Screening of Tumor-Derived Extracellular Vesicles by Flow Cytometry of Splenic T Cells

İn Vivo Dalak T Hücrelerinin Akım Sitometrisi ile Tümör Kaynaklı Hücre Dışı Veziküllerin İmmünojenite Taraması

Immunogenic cell death of tumors, caused by chemotherapy or irradiation, can trigger tumor-specific T cell responses by releasing danger-associated ...