Name: overexpressing long noncoding rnas using gene-activating crispr
Uploaded: 2019-03-01T15:00:00
Description: Watch this Scientific Journal Video about Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR at JoVE.com

C.P. RO1 DK60729 और P30 DK 41301-26 द्वारा समर्थित है । D.P. एक crohn & कोलाइटिस फाउंडेशन (ccfa) कैरियर विकास पुरस्कार, चिकित्सा द्वारा समर्थित है: पाचन रोग अनुसंधान केंद्र (ddrc) DK41301, और ucla नैदानिक और translational विज्ञान संस्थान (ctsi) UL1TR0001881 । ucla वायरोलॉजी कोर एड्स अनुसंधान के केंद्र (cfar) अनुदान 5p30 AI028697 द्वारा वित्त पोषित किया गया । ucla एकीकृत आणविक प्रौद्योगिकियों कोर इलाज/P30 अनुदान DK041301 द्वारा समर्थित किया गया था । इस कार्य का भी उकलआ एड्स संस्थान ने समर्थन किया था.

नोट: यह नोट करना महत्वपूर्ण है कि यह प्रोटोकॉल प्रतिकृति की कमी वाले लेंटिवायरस का उपयोग करता है । केवल उपयुक्त प्रयोगशाला सुरक्षा प्रशिक्षण के बाद वायरल हैंडलिंग प्रदर्शन । सभी मदों और सतहों क...

<ol>
	<li>Miao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trends+of+long+noncoding+RNA+research+from+2007+to+2016:+a+bibliometric+analysis.">Trends of long noncoding RNA research from 2007 to 2016: a bibliometric analysis.</a> Oncotarget. 8 (47), 83114-83127 (2017).</li><li>Derrien, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GENCODE+v7+catalog+of+human+long+noncoding+RNAs:+analysis+of+their+gene+structure,+evolution,+and+expression.">The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression.</a> Genome Research. 22 (9), 1775-1789 (2012).</li><li>Johnsson, P., Lipovich, L., Grander, D., Morris, K. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+conservation+of+long+non-coding+RNAs;+sequence,+structure,+function.">Evolutionary conservation of long non-coding RNAs; sequence, structure, function.</a> Biochimica et Biophysica Acta. 1840 (3), 1063-1071 (2014).</li><li>Perez-Pinera, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-guided+gene+activation+by+CRISPR-Cas9-based+transcription+factors.">RNA-guided gene activation by CRISPR-Cas9-based transcription factors.</a> Nature Methods. 10 (10), 973-976 (2013).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Maeder, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+RNA-guided+activation+of+endogenous+human+genes.">CRISPR RNA-guided activation of endogenous human genes.</a> Nature Methods. 10 (10), 977-979 (2013).</li><li>Konermann, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+transcriptional+activation+by+an+engineered+CRISPR-Cas9+complex.">Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.</a> Nature. 517 (7536), 583-588 (2015).</li><li>Schmittgen, T. D., Livak, K. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyzing+real-time+PCR+data+by+the+comparative+C(T)+method.">Analyzing real-time PCR data by the comparative C(T) method.</a> Nature Protocols. 3 (6), 1101-1108 (2008).</li><li>Gomez, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+NeST+long+ncRNA+controls+microbial+susceptibility+and+epigenetic+activation+of+the+interferon-gamma+locus.">The NeST long ncRNA controls microbial susceptibility and epigenetic activation of the interferon-gamma locus.</a> Cell. 152 (4), 743-754 (2013).</li><li>Padua, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+long+noncoding+RNA+signature+for+ulcerative+colitis+identifies+IFNG-AS1+as+an+enhancer+of+inflammation.">A long noncoding RNA signature for ulcerative colitis identifies IFNG-AS1 as an enhancer of inflammation.</a> American Journal of Physiology-Gastrointestinal and Liver Physiology. 311 (3), G446-G457 (2016).</li><li>Collier, S. P., Henderson, M. A., Tossberg, J. T., Aune, T. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+the+Th1+genomic+locus+from+Ifng+through+Tmevpg1+by+T-bet.">Regulation of the Th1 genomic locus from Ifng through Tmevpg1 by T-bet.</a> Journal of Immunology. 193 (8), 3959-3965 (2014).</li><li>Kotake, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+ANRIL+is+required+for+the+PRC2+recruitment+to+and+silencing+of+p15(INK4B)+tumor+suppressor+gene.">Long non-coding RNA ANRIL is required for the PRC2 recruitment to and silencing of p15(INK4B) tumor suppressor gene.</a> Oncogene. 30 (16), 1956-1962 (2011).</li><li>Gilbert, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-Scale+CRISPR-Mediated+Control+of+Gene+Repression+and+Activation.">Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation.</a> Cell. 159 (3), 647-661 (2014).</li><li>Cheng, A. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+activation+of+endogenous+genes+by+CRISPR-on,+an+RNA-guided+transcriptional+activator+system.">Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system.</a> Cell Research. 23 (10), 1163-1171 (2013).</li><li>Matouskova, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reference+genes+for+real-time+PCR+quantification+of+messenger+RNAs+and+microRNAs+in+mouse+model+of+obesity.">Reference genes for real-time PCR quantification of messenger RNAs and microRNAs in mouse model of obesity.</a> PLoS One. 9 (1), e86033 (2014).</li></ol>

इस पांडुलिपि को सक्रिय करने crispr का उपयोग करने के लिए एक प्रोटोकॉल प्रस्तुत करता है विट्रो में lncrnas overexpress । यह एक विशेष रूप से महत्वपूर्ण तकनीक है जब लंबे समय तक noncoding rnas का अध्ययन के रूप में transcriptomic उत्पाद कार्या?...

जबकि सबसे जैव चिकित्सा अनुसंधान प्रोटीन-कोडिंग टेप पर ध्यान केंद्रित किया है, लिखित जीन के बहुमत वास्तव में noncoding rnas के होते है (ensembl रिलीज ९३) । वर्तमान अनुसंधान इस क्षेत्र का पता लगाने के लिए शुरुआत है, रोग प्रक्रियाओं में lncrnas पर प्रकाशनों की संख्या के साथ २००७ और २०१७ के बीच तेजी से बढ़ रही1. इन प्रकाशनों का प्रदर्शन है कि कई lncrnas रोग के साथ जुड़े रहे हैं । तथापि, इन lncrnas के आणविक तंत्र के रूप में mrnas की तुलना में उनके विविध कार्यों के कारण अध्ययन करने के लिए मुश्किल हैं. रोग में lncrnas की भूमिका को समझने की समस्या को जटिल, lncrnas अक्सर2rnas कोडिंग की तुलना में निचले स्तर पर व्यक्त कर रहे हैं. इसके अतिरिक्त, lncrnas खराब संरक्षित कर रहे हैं, जो मानव सेल लाइन आधारित तकनीक3में कार्यात्मक अध्ययन को सीमित करता है । इन उपन्यास जीन के तंत्र का अध्ययन करने के लिए एक विधि यह है कि इन्हें सुसंस्कृत कोशिकाओं में अंतर्जात रूप से अतिअभिव्यक्त किया जाता है । ओवरएक्सप्रेशन अध्ययन विशिष्ट जीन के कार्य के रूप में महत्वपूर्ण जानकारी प्रदान करते हैं और शोधकर्ताओं को कुंजी आणविक रास्ते को काटना करने के लिए सक्षम कर सकते हैं ।
एक नई विधि lncrna जीन के प्रतिलेखन को सक्रिय करने के लिए crispr टेक्नोलॉजीज द्वारा शुरू में विकसित gersbach4प्रयोगशाला पर आधारित है । यह प्रोटोकॉल lncrna जीवविज्ञान में उपयोग के लिए और अंय मॉडल प्रणालियों में इन जीन की अभिव्यक्ति के लिए अनुकूलित किया गया है । crispr overexpressing तकनीक में, एक प्रोटीन बुलाया crispr-जुड़े प्रोटीन 9 (Cas9) एक antisense grna के माध्यम से एक डीएनए अनुक्रम की ओर निर्देशित किया जा सकता है कि Cas9 द्वारा मांयता प्राप्त है । आम तौर पर, Cas9 डीएनए दरार पैदा करेगा; हालांकि, Cas9 में परिवर्तन, पहले overexpression तकनीक के लिए विकसित, इस चरण5को निष्क्रिय करें । जब एक transcriptional उत्प्रेरक एक "मृत" Cas9 (dCas9) के लिए जुड़े हुए और सेल लाइनों में transduced है, अंतर्जात lncrnas के overexpression4,6हासिल किया जा सकता है । grna करने के लिए अतिरिक्त संशोधनों के अलावा, अतिरिक्त transcriptional कारकों grna को सक्षम करने के लिए, dCas9 gene सक्रियकरण प्रणाली 10 गुना7की प्रभावकारिता में वृद्धि हुई । महत्वपूर्ण बात, यह है कि transcriptional सक्रियण transcriptional शुरू साइट जीन के लिए करीब निकटता (< 200 बीपी) की आवश्यकता है, जीन से समृद्ध क्षेत्रों में एक विशिष्ट अपरेगुलेशन7को सक्षम करने का प्रदर्शन किया गया था । crispr पीटकर प्रौद्योगिकियों के विपरीत, dCas9 और grna कैसेट के लिए जीनोम में एकीकृत करने की आवश्यकता के लिए कोशिकाओं के लिए कई पीढ़ियों से अधिक एक overexpression बनाए रखने के लिए अनुमति देते हैं । इस लक्ष्य को प्राप्त करने के लिए एक विधि को dCas9-और grna-युक्त कैसेट को एकीकृत करने के लिए दाल के वायरस का उपयोग करने के लिए है । एकीकरण के बाद, lncrna जीन अभिव्यक्ति निर्धारित किया जा सकता है ।
इस लेख में, एक जुरकात टी-सेल मॉडल में lncrna ओवरएक्सप्रेशन के लिए एक प्रोटोकॉल का प्रदर्शन किया जाएगा । एक कदम दर कदम प्रक्रिया को दिखाया गया है और यह भी आसंन कोशिकाओं के लिए अनुकूलित किया जा सकता है ।

<table border="0" cellpadding="0" cellspacing="0" style="width:837px;" width="837">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:245px;">Ampicillin</td>
			<td style="width:195px;">Fisher Scientific</td>
			<td style="width:195px;">BP1760-5</td>
			<td style="width:203px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">CaCl2</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">C1016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">cDNA synthesis kit (iScript)</td>
			<td style="width:195px;">BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 forward primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>5&#39;-TCGCCACAGCATAAAGAAGA&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 reverse primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>5&#39;-CTTTTCATGGTACGCCACCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dCas9 vector</td>
			<td>Addgene</td>
			<td style="width:195px;">50918</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DMEM</td>
			<td>Corning</td>
			<td style="width:195px;">10013CM</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">Ethanol</td>
			<td style="width:195px;">Acros Organics</td>
			<td style="width:195px;">61509-0010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FBS</td>
			<td>Sigma Aldrich</td>
			<td>F2442</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">gRNA plasmid</td>
			<td>VectorBuilder</td>
			<td style="width:195px;">VB180119-1195qxv</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HEK293T cells</td>
			<td>ATCC</td>
			<td style="width:195px;">&#160;CRL-1573</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">HEPES</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">H3375</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPRT1 forward primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>GACCAGTCAACAGGGGACAT&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPRT1 reverse primer</td>
			<td>Integrated DNA Technologies</td>
			<td style="width:195px;">n/a</td>
			<td>GCTTGCGACCTTGACCATCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hygromycin B</td>
			<td>Corning</td>
			<td style="width:195px;">MT3024CR</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">Isopropanol</td>
			<td style="width:195px;">Fisher Scientific</td>
			<td style="width:195px;">BP2618-500</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Jurkat cells</td>
			<td>ATCC</td>
			<td style="width:195px;">&#160;TIB-152</td>
			<td style="width:203px;">clone E6-1</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-glutamine</td>
			<td>Corning</td>
			<td style="width:195px;">25005Cl</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB agar</td>
			<td>Fisher Scientific</td>
			<td>BP1425-500</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB broth</td>
			<td>Fisher Scientific</td>
			<td>BP1426-2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Maxi-prep kit (Plasmid Purification Kit)</td>
			<td>Qiagen</td>
			<td style="width:195px;">12362</td>
			<td></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;">Na2HPO4</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">NIST2186II</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Optimem I reduced serum media&#160;</td>
			<td>Gibco</td>
			<td style="width:195px;">31985070</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p24 elisa</td>
			<td>Perkin Elmer</td>
			<td style="width:195px;">NEK050B</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:245px;">PBS</td>
			<td style="width:195px;">Corning</td>
			<td style="width:195px;">21-040-CMR</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Penicillin and Streptomycin</td>
			<td>Corning</td>
			<td>30-002-Cl</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pMDG2.G</td>
			<td>Addgene &#160;</td>
			<td style="width:195px;">#12259</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pMDLg/pRRE</td>
			<td>Addgene&#160;</td>
			<td style="width:195px;">#60488</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Poly-L-Lysine</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">P-4832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polybrene</td>
			<td>EMD Millipore</td>
			<td style="width:195px;">TR-1003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pRSV-REV</td>
			<td>Addgene</td>
			<td style="width:195px;">#12253</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Puromycin dihydrochloride</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">P8833</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNA purification kit (Aurum RNA mini)</td>
			<td style="width:195px;">BioRad</td>
			<td>7326820</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sodium Butyrate</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">B5887</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SYBR green (iTaq universal)</td>
			<td style="width:195px;">BioRad</td>
			<td>1725122</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td style="width:195px;">X100</td>
			<td></td>
		</tr>
	</tbody>
</table>

overexpressing long noncoding rnas using gene-activating crispr

लांग noncoding आरएनए (lncrna) बायोलॉजी २००७ के बाद से तेजी से बढ़ रही इस क्षेत्र से प्रकाशनों की संख्या के साथ, अनुसंधान के एक नए और रोमांचक क्षेत्र है । इन अध्ययनों से पुष्टि की है कि lncrnas लगभग सभी रोगों में बदल रहे हैं. हालांकि, रोग के संदर्भ में lncrnas के लिए कार्यात्मक भूमिकाओं का अध्ययन प्रोटीन उत्पादों की कमी के कारण मुश्किल रहता है, ऊतक-विशिष्ट अभिव्यक्ति, कम अभिव्यक्ति का स्तर, ब्याह रूपों में जटिलताओं, और प्रजातियों के बीच संरक्षण की कमी. प्रजातियों-विशिष्ट अभिव्यक्ति को देखते हुए, lncrna अध्ययन अक्सर मानव अनुसंधान संदर्भों के लिए प्रतिबंधित कर रहे है जब रोग प्रक्रियाओं का अध्ययन । आणविक स्तर पर lncrnas समारोह के बाद से, lncrnas जीव विज्ञान को काटना करने के लिए एक ही रास्ता है या तो lncrnas को हटाने या lncrnas ओवरएक्सप्रेस और सेलुलर प्रभाव को मापने. इस आलेख में, एक लिखित और कल्पना प्रोटोकॉल को विट्रो में ओवरएक्सप्रेस lncrnas प्रस्तुत किया है । एक प्रतिनिधि प्रयोग के रूप में, भड़काऊ आंत्र रोग के साथ जुड़े एक lncrna, इंटरफेरन गामा एंटीसेंस 1 (ifng-AS1), एक jurkat टी-सेल मॉडल में overexpressed किया जा करने के लिए दिखाया गया है. यह पूरा करने के लिए, सक्रिय संकुल नियमित रूप से interspaced लघु palindromic दोहराता (crispr) तकनीक अंतर्जात जीनोमिक loci पर overexpression सक्षम करने के लिए प्रयोग किया जाता है । सक्रिय crispr तकनीक एक जीन की प्रतिलेखन शुरू साइट के लिए प्रतिलेखन कारकों का एक सेट लक्ष्य, एकाधिक lncrna ब्याह रूपों की एक मजबूत overexpression सक्षम करने से । इस प्रक्रिया के नीचे तीन चरणों में टूट जाएगा, अर्थात् (मैं) गाइड आरएनए (grna) डिजाइन और वेक्टर निर्माण, (द्वितीय) वायरस पीढ़ी और transduction, और (iii) overexpression के लिए कॉलोनी स्क्रीनिंग । इस प्रतिनिधि प्रयोग के लिए, एक से अधिक 20-ifng-AS1 में गुना वृद्धि jurkat टी कोशिकाओं में मनाया गया ।

lncrna ifng को ओवरएक्सप्रेस करने के लिए एक दोहरी सदिश प्रणाली-AS1 इस पांडुलिपि में उदाहरण प्रयोग एक jurkat टी सेल मॉडल lncrna ifng-AS19व्यक्त प्रणाली की overexpression है । ifng-AS1 भड़काऊ आंत्र रोग के साथ जुड़?...

Watch this Scientific Journal Video about Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR at JoVE.com

Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR

पारंपरिक cdna आधारित overexpression तकनीकों लंबे noncoding की overexpression के लिए एक सीमित प्रयोज्यता है rnas संभावित कार्यक्षमता के साथ अपने कई ब्याह रूपों के कारण. यह समीक्षा एक लंबे noncoding आरएनए के कई ब्याह वेरिएंट overexpress करने के लिए crispr प्रौद्योगिकी का उपयोग कर एक प्रोटोकॉल की रिपोर्ट ।

लंबे noncoding rnas का उपयोग करके overexpressing जीन सक्रिय crispr

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since ...

Research

JoVE Journal

Genetics

Sequence-specific and Selective Recognition of Double-stranded RNAs over Single-stranded RNAs by Chemically Modified Peptide Nucleic Acids

अनुक्रम-विशिष्ट और चयनात्मक पहचान डबल-असहाय RNAs पर एकल-असहाय RNAs द्वारा रासायनिक संशोधित पेप्टाइड न्यूक्लिक एसिड

RNAs are emerging as important biomarkers and therapeutic targets. Thus, there is great potential in developing chemical probes and therapeutic ligands ...

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

CRISPR/Cas9-मध्यस्थता एक समरूपता-मध्यस्थ अंत में शामिल होने की रणनीति का उपयोग कर Vivo में लक्षित एकीकरण

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

Metabolic Labeling and Profiling of Transfer RNAs Using Macroarrays

चयापचय लेबलिंग और स्थानांतरण RNAs Macroarrays का उपयोग कर की रूपरेखा

Transfer RNAs (tRNA) are abundant short non-coding RNA species that are typically 76 to 90 nucleotides in length. tRNAs are directly responsible for ...

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

C. एलिगेंस में जीनोमिक पॉइंट म्यूटेंट पैदा करने के लिए एक रैपिड और सतही पाइपलाइन का उपयोग CRISPR/Cas9 Ribonucleoproteins

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been ...

Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

बढ़ाने का विच्छेदन कार्य मल्टीप्लेक्स CRISPR-आधारित बढ़ाने का प्रयोग सेल लाइंस में व्यवधान

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these ...

CRISPR Guide RNA Cloning for Mammalian Systems

स्तनधारी सिस्टम्स के लिए CRISPR गाइड आरएनए क्लोनिंग

The outlined protocol describes streamlined methods for the efficient and cost-effective generation of Cas9-associated guide RNAs. Two alternative ...

Endogenous Protein Tagging in Human Induced Pluripotent Stem Cells Using CRISPR/Cas9

अंतर्जात प्रोटीन टैगिंग में मानव प्रेरित Pluripotent स्टेम कोशिकाओं का उपयोग CRISPR/Cas9

A protocol is presented for generating human induced pluripotent stem cells (hiPSCs) that express endogenous proteins fused to in-frame&#160;N- or ...

Genome Editing in Mammalian Cell Lines using CRISPR-Cas

CRISPR-Cas का उपयोग करके Mammalian कक्ष लाइनों में जीनोम संपादन

The clustered regularly interspaced short palindromic repeats (CRISPR) system functions naturally in bacterial adaptive immunity, but has been ...

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

एक जीन नॉकआउट का परिचय सीधे Trypanosoma cruzi के Amastigote चरण में CRISPR/Cas9 प्रणाली का उपयोग

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas&#8217; disease mainly in Latin America. In order to identify a novel drug target ...