Name: a converging strategy for the generation of a virtually sequenced cdna library from unreferenced pacific oysters
Uploaded: 2019-06-13T13:30:00
Description: Watch this Scientific Journal Video about A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters at JoVE.com

यह काम चीन के प्राकृतिक विज्ञान फाउंडेशन (अनुदान संख्या 31471703, A0201300537 और 31671854 जे.वी. और एल.एल., अनुदान संख्या 31470435 को जी.वाई.) द्वारा भाग में समर्थित किया गया था, और 100 विदेशी प्रतिभा योजना (जेएसबी2014012 को अनुदान)।

नोट: एक योजनाबद्ध ओवरव्यू चित्र 1में दिखाया गया है।
1. नमूना संग्रह
<ol><li>सीप के नमूने प्राप्त करें। पोस्टHarvest अवधि के दौरान बर्फ पर कस्तूरी रखें, परिवहन और खरीद के बाद 4-7 दिनों के भीतर प?...

<ol>
	<li>Blaxter, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+promise+of+a+DNA+taxonomy.">The promise of a DNA taxonomy.</a> Philosophical transactions of the Royal Society of London. Series B, Biological. 359 (1444), 669-679 (2004).</li><li>Wen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+identification+of+dried+shellfish+(oyster,+clam+and+mussel)+products+sold+on+the+Chinese+market.">Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market.</a> Food Control. 90, 199-204 (2018).</li><li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+cob+and+cox1+genes+and+editing+of+the+corresponding+mRNAs+in+Dinophysis+acuminata+from+Narragansett+Bay,+with+special+reference+to+the+phylogenetic+position+of+the+genus+Dinophysis.">Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis.</a> Applied and Environmental Microbiology. 74 (5), 1546-1554 (2007).</li><li>Sell, J., Spirkovski, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+differentiation+between+two+forms+of+trout+Salmo+letnica,+endemic+to+the+Balkan+Lake+Ohrid,+reflects+their+reproductive+isolation.">Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation.</a> Molecular Ecology. 13, 3633-3644 (2004).</li><li>Karadjian, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+rearranged+mitochondrial+genome+in+Nycteria+parasites+(Haemosporidia)+from+bats.">Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (35), 9834-9839 (2018).</li><li>Morga, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+genes+from+flat+oyster+Ostrea+edulis+as+suitable+housekeeping+genes+for+quantitative+real+time+PCR.">Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR.</a> Fish and Shellfish Immunology. 29 (6), 937-945 (2010).</li><li>Delsuc, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+systematics+of+armadillos+(Xenarthra,+Dasypodidae):+contribution+of+maximum+likelihood+and+Bayesian+analyses+of+mitochondrial+and+nuclear+genes.">Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes.</a> Molecular Phylogenetics and Evolution. 28 (2), 261-265 (2005).</li><li>Wei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+and+Biochemical+Characterization+of+UDP-Glucose+Dehydrogenase+from+Akkermansia+muciniphila.">Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila.</a> Protein &amp; Peptide Letters. 24 (8), 735-741 (2017).</li><li>Gu, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+and+Biochemical+Characterization+of+the+UDP-Xylose+Biosynthesis+Pathway+in+Sphaerobacter+thermophilus.">Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus.</a> Protein &amp; Peptide Letters. 23 (12), 1103-1110 (2016).</li><li>Duan, X. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+characterization+of+the+UDP-xylose+biosynthesis+pathway+in+Rhodothermus+marinus.">Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus.</a> Applied Microbiology and Biotechnology. 99 (22), 9463-9472 (2015).</li><li>Vogelstein, B., Gillespie, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+and+analytical+purification+of+DNA+from+agarose.">Preparative and analytical purification of DNA from agarose.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (2), 615-619 (1979).</li><li>Song, H. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UDP-glucose+4-epimerase+and+&#946;-1,4-galactosyltransferase+from+the+oyster+Magallana+gigas+as+valuable+biocatalysts+for+the+production+of+galactosylated+products.">UDP-glucose 4-epimerase and &#946;-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products.</a> International Journal of Molecular Sciences. 19 (6), 1600 (2018).</li><li>Gainey, P. A., Phelps, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridine+diphosphate+glucuronic+acid+production+and+utilization+in+various+tissues+actively+synthesizing+glycosaminoglycans.">Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans.</a> Biochemical Journal. 128 (2), 215-227 (1972).</li></ol>

प्रस्तुत प्रोटोकॉल एक सार्वजनिक रूप से उपलब्ध सीप डीएनए जीनोम डेटाबेस के साथ COX1 और एनडी जीन की तुलना से क्षेत्रीय समुद्री भोजन बाजार से इसी तरह phenotype के साथ unreferenced सीप नमूनों की आनुवंशिक पहचान की अनुमति दे?...

लंबे समय तक वितरण समय, उद्यमी तर्क, या देश-विशिष्ट सीमा शुल्क नियमों के कारण रहने वाले संदर्भित जैविक सामग्री का अधिग्रहण चुनौतीपूर्ण हो सकता है। एक विकल्प के रूप में, आवश्यक जैविक सामग्री भी phenoically समान नमूनों से एकत्र किया जा सकता है. हालांकि, इन नमूनों जीनोटाइप के स्तर पर काफी भिन्न हो सकते हैं, और इसलिए एक ही प्रजाति के डिजिटल रूप से संग्रहीत संदर्भ जीनोम के साथ तुलना अक्सर मुश्किल या यहां तक कि नए स्रोत सामग्री की असंगति के कारण व्यर्थ प्रदान की जाती हैं मौजूदा डीएनए प्रवर्धन विधियों. व्यक्तिगत नमूनों की अत्यधिक संरक्षित जीन ों को अलग-अलग1 प्रजातियों की पहचान करने के लिए एक व्यापक रूप से इस्तेमाल किया और शक्तिशाली उपकरण है , इस तरह के संरक्षित mitochondrial जीन है कि अक्सर cDNA पुस्तकालयों की गुणवत्ता के आकलन के लिए संदर्भ जीन के रूप में उपयोग किया जाता है के रूप में2 ,3,4,5,6. इसके साथ प्रस्तुत विधि के लिए अंतर्निहित तर्क यह है कि संदर्भ जीनोम के इसी दृश्यों की तुलना में व्यक्तिगत अनाम सीप नमूनों में mitochondrial जीन दृश्यों के उच्च संरक्षण इंगित करता है कि अन्य जीन भी एक दिखा सकते हैं विचलन के निम्न स्तर, परमाणु डीएनए7के सापेक्ष mitochondrial डीएनए विकास की आम तौर पर तेजी से दर को देखते हुए, बस सार्वजनिक रूप से उपयोग करके वैज्ञानिक और औद्योगिक रूप से प्रासंगिक जीन की एक विस्तृत श्रृंखला के प्रवर्धन और अलगाव की अनुमति एक संदर्भ के रूप में उपलब्ध अनुक्रमण डेटा.
यहाँ वर्णित विधि के समग्र लक्ष्य के लिए एक वस्तुतः अनुक्रम सीप CDNA पुस्तकालय जो सीप जीन की क्लोनिंग के लिए टेम्पलेट डीएनए के रूप में इस्तेमाल किया जा सकता पैदा करने के लिए एक अनुकूलित कार्यप्रवाह पेश है. आभासी अनुक्रमण में, डे नोवो जीनोम अनुक्रमण दरकिनार है; इसके बजाय, एक ज्ञात, डिजिटल संग्रहीत संदर्भ अनुक्रम का उपयोग या cDNAs है कि अंततः एक पुस्तकालय शामिल होगा के उत्पादन के लिए प्राइमर डिजाइन करने के लिए सीधे प्रयोग किया जाता है (या एक पूर्व मौजूदा एक करने के लिए जोड़ा जाएगा). उद्देश्य एक अभिसरण CDNA पुस्तकालय का उत्पादन करने के लिए है, जिसका अर्थ है कि उत्पन्न cDNA दृश्यों और संदर्भ अनुक्रम के बीच समानताएं कम से उच्च विचलन के लिए स्थान दिया जा सकता है. साइटोक्रोम सी ऑक्सिडेज सबयूनिट 1 (COX1) और NADH Dehydrogenase (एनडी) संदर्भ जीन के रूप में उपयोग करने का एक प्रमुख लाभ यह है कि इन माइटोकोंड्रियाल जीनों के उच्च संरक्षण के कारण भी अत्यधिक भौगोलिक रूप से विक्षिप्यता सीप नमूनों को प्रोफाइल किया जा सकता है। इन अच्छी तरह से स्थापित मार्करों के साथ दृष्टिकोण साबित करने के बाद, हम तो दो एंजाइम उम्मीदवारों जो चीनी न्यूक्लिओटाइड biosynthesis में शामिल हैं और औद्योगिक प्रासंगिकता का हो सकता है के लिए अपने आवेदन का प्रदर्शन8,9, 10. प्रशांत सीप की जैव-प्रौद्योगिकी क्षमता अभी भी अज्ञात है . इस प्रकार, हम मानते हैं कि एक वस्तुतः अनुक्रम cDNA पुस्तकालय तैयार करने के लिए इस converging विधि भी गैर विशेषज्ञ शोधकर्ताओं जो इस प्रासंगिक जैविक सामग्री से cDNA उत्पन्न करना चाहते हैं के लिए उपयुक्त हो जाएगा.

<table border="0" cellpadding="0" cellspacing="0" style="width:827px;" width="826">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:261px;">Chemicals:</td>
			<td style="width:199px;"></td>
			<td style="width:131px;"></td>
			<td style="width:236px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% Triton X-100</td>
			<td>Solarbio</td>
			<td>9002-93-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:261px;">2,5-Dihydroxybenzoic acid</td>
			<td>Alfa Aesar</td>
			<td>490-79-9</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Acetonitrile</td>
			<td>Merck</td>
			<td>75-05-8</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Agarose for molecular biology</td>
			<td>Biowest Chemicals</td>
			<td>111860</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ampicilin</td>
			<td>Solarbio</td>
			<td>69-52-3</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chloroform</td>
			<td>Lingfeng, Shanghai</td>
			<td>67-66-3</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DEPC water</td>
			<td>Thermo Scientific</td>
			<td>R0601</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ethanol</td>
			<td>Jinhuada, Guangzhou</td>
			<td>64-17-5</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Guanidinium thiocyanate-phenol reagent</td>
			<td>Invitrogen</td>
			<td>15596018</td>
			<td>TRIzol reagent</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Imidazole</td>
			<td>Energy Chemical</td>
			<td>288-32-4</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isopropyl alcohol</td>
			<td>Nanjing Chemical Reagent</td>
			<td>67-63-0</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isopropyl &#946;-D-thiogalactopyranoside</td>
			<td>Solarbio</td>
			<td>367-93-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Kanamycin</td>
			<td>Solarbio</td>
			<td>25389-94-0</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB Agar</td>
			<td>Thermo Fisher</td>
			<td>22700025</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB Broth</td>
			<td>Thermo Fisher</td>
			<td>10855021</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Methanol</td>
			<td>Jinhuada, Guangzhou</td>
			<td>67-56-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;">MgCl2 hexahydrate</td>
			<td>Xilong Huagong</td>
			<td>7791-18-6</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NaCl</td>
			<td>Xilong Huagong</td>
			<td>7647-14-5</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">NAD+</td>
			<td>Duly Biotech</td>
			<td>53-84-9</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phenyl-methylsulfonyl fluoride</td>
			<td>Macklin</td>
			<td>329-98-6</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tris</td>
			<td>Solarbio</td>
			<td>77-86-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UDP-glucose</td>
			<td>Wuhu Nuowei Chemicals</td>
			<td>28053-08-9</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UDP-glucuronic acid</td>
			<td>SIGMA</td>
			<td>63700-19-6</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tools/Instruments:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MALDI-TOF mass spectrometer</td>
			<td>Bruker</td>
			<td>Autoflex</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Metal block heater</td>
			<td>Long Yang Scientific Instruments</td>
			<td>Thermoshaker HB20</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR thermocycler</td>
			<td>Hema</td>
			<td>9600</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Enzyme and Kits:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10&#215;Ligation buffer</td>
			<td>Thermo Scientific</td>
			<td>B69</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5&#215;PrimeSTAR buffer</td>
			<td>Takara</td>
			<td>9158A</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Alkaline phosphatase</td>
			<td>ThermoFisher FastAP</td>
			<td>EF0654</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">COX forward primer</td>
			<td>Genscript</td>
			<td>ATGTCAACAAATCATTTAGACATTG</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">COX reverse primer</td>
			<td>Genscript</td>
			<td>ACTTGACCAAAAACATAAGACATG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cutsmart Buffer</td>
			<td>NEB</td>
			<td>B7204S</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dNTP mix</td>
			<td>Invitrogen</td>
			<td>18427088</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUGD forward primer</td>
			<td>Genscript</td>
			<td>ACATATGACCCTGTCCAAGATCTGTTGT</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUGD reverse primer</td>
			<td>Genscript</td>
			<td>ACTCGAGACTCTGTGAGGCGGTGGAG</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUXS forward primer</td>
			<td>Genscript</td>
			<td>CCATATGGCAGAATCCTCACAATCAC</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUXS reverse primer</td>
			<td>Genscript</td>
			<td>ACTCGAGCACATTTTTGAATTTGCAGACGT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ND forward primer</td>
			<td>Genscript</td>
			<td>ATGAGATGGCAATTATTTTTTAAT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ND reverse primer</td>
			<td>Genscript</td>
			<td>ATGTATTTTGGAAAAATCTCCAC</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PCR Cleanup Kit</td>
			<td>AxyGen</td>
			<td>AP-PCR-250</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pET-30a(+) vector</td>
			<td>Merck Millipore</td>
			<td>69909</td>
			<td></td>
		</tr>
	</tbody>
</table>

a converging strategy for the generation of a virtually sequenced cdna library from unreferenced pacific oysters

संदर्भ प्रजातियों की जैविक सामग्री के लिए उपयोग, जो पहले प्रमुख प्रयोगों में इस्तेमाल किया गया था जैसे कि उपन्यास सेल लाइनों या जीनोम अनुक्रमण परियोजनाओं के विकास में, अक्सर आगे के अध्ययन या तीसरे पक्ष के कारण प्रदान करने के लिए मुश्किल है नमूनों की उपभोक् ता प्रकृति। हालांकि अब व्यापक रूप से एशिया, ऑस्ट्रेलिया और उत्तरी अमेरिका के प्रशांत तटों पर वितरित, व्यक्तिगत प्रशांत सीप नमूने आनुवंशिक रूप से काफी विविध हैं और इसलिए जीन पुस्तकालयों के लिए प्रारंभिक सामग्री के रूप में सीधे उपयुक्त नहीं हैं. इस अनुच्छेद में, हम क्षेत्रीय समुद्री भोजन बाजार से प्राप्त unreferenced प्रशांत सीप नमूनों के उपयोग का प्रदर्शन करने के लिए cDNA पुस्तकालयों उत्पन्न करते हैं. इन पुस्तकालयों तो सार्वजनिक रूप से उपलब्ध सीप जीनोम की तुलना में थे, और निकटतम संबंधित पुस्तकालय mitochondrial संदर्भ जीन Cytochrome C Oxidase subunit मैं (COX1) और NADH Dehydrogenase (एनडी) का उपयोग कर चुना गया था. उत्पन्न cDNA पुस्तकालय की उपयुक्तता भी क्लोनिंग और दो जीन की अभिव्यक्ति द्वारा प्रदर्शित किया जाता है एंजाइमों यूडीपी-ग्लूकुरोनिक एसिड dehydrogenase (UGD) और UDP-xylose synthase (UXS), जो से UDP-xylose के biosynthesis के लिए जिम्मेदार हैं एन्कोडिंग यूडीपी-ग्लूकोज।

चित्र 1 प्रशांत सीप व्यक्तियों से व्युत्पन्न अभिसरण cDNA पुस्तकालय के वर्णित तैयारी विधि का एक योजनाबद्ध अवलोकन दिखाता है। चित्र 2 संदर्भ सामग्री के COX1 और एनडी जीन दृश्यों से उच्च व?...

Watch this Scientific Journal Video about A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters at JoVE.com

A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters

हम कैसे unreferenced प्रशांत सीप नमूनों से आरएनए नमूनों का उपयोग करने के लिए एक रणनीति का वर्णन है, और सार्वजनिक रूप से उपलब्ध जीनोम डेटा के साथ तुलना द्वारा आनुवंशिक सामग्री का मूल्यांकन करने के लिए एक वस्तुतः अनुक्रम CDNA पुस्तकालय उत्पन्न करते हैं.

असंदर्भित प्रशांत ऑयस्टर्स से एक वस्तुतः अनुक्रमित cDNA लाइब्रेरी के उत्पादन के लिए एक Converging रणनीति

The access to biological material of reference species, which were used previously in key experiments such as in the development of novel cell lines or ...

Research

JoVE Journal

Bioengineering

Synthetic Spider Silk Production on a Laboratory Scale

एक प्रयोगशाला पैमाने पर सिंथेटिक स्पाइडर सिल्क उत्पादन

As society progresses and resources become scarcer, it is becoming increasingly important to cultivate new technologies that engineer next generation ...

Designing a Bio-responsive Robot from DNA Origami

डीएनए Origami से एक जैव संवेदनशील रोबोट डिजाइनिंग

Nucleic acids are astonishingly versatile. In addition to their natural role as storage medium for biological information1, they can be utilized in ...

An Improved Method for the Preparation of Type I Collagen From Skin

त्वचा से टाइप I कोलेजन की तैयारी के लिए एक बेहतर तरीका

Soluble type 1 collagen (COL1) is used extensively as an adhesive substrate for cell cultures and as a cellular scaffold for regenerative applications. ...

Lipid Bilayer Vesicle Generation Using Microfluidic Jetting

Microfluidic Jetting का प्रयोग लिपिड bilayer पुटिका पीढ़ी

Bottom-up synthetic biology presents a novel approach for investigating and reconstituting biochemical systems and, potentially, minimal organisms. This ...

Generation of a Three-dimensional Full Thickness Skin Equivalent and Automated Wounding

एक तीन आयामी पूर्ण मोटाई त्वचा की पीढ़ी के बराबर है और स्वचालित लोग घायल हो गए

In vitro models are a cost effective and ethical alternative to study cutaneous wound healing processes. Moreover, by using human cells, these models ...

Qualitative Characterization of the Aqueous Fraction from Hydrothermal Liquefaction of Algae Using 2D Gas Chromatography with Time-of-flight Mass Spectrometry

शैवाल की जलतापीय द्रवीकरण से जलीय अंश के साथ समय की उड़ान मास स्पेक्ट्रोमेट्री 2 डी गैस क्रोमैटोग्राफी का उपयोग के गुणात्मक विशेषता

Two-dimensional gas chromatography coupled with time-of-flight mass spectrometry is a powerful tool for identifying and quantifying chemical components in ...

A Microcontroller Operated Device for the Generation of Liquid Extracts from Conventional Cigarette Smoke and Electronic Cigarette Aerosol

एक Microcontroller पारंपरिक सिगरेट का धुआं और इलेक्ट्रॉनिक सिगरेट एयरोसोल से तरल निष्कर्षों की पीढ़ी के लिए उपकरण संचालित

Electronic cigarettes are the most popular tobacco product among middle and high schoolers and are the most popular alternative tobacco product among ...

Scalable Generation of Mature Cerebellar Organoids from Human Pluripotent Stem Cells and Characterization by Immunostaining

ह्यूमन प्लुरिपोटेंट स्टेम सेल और इम्यूनोस्टेनिंग द्वारा लक्षण वर्णन से परिपक्व सेरिबेलर ऑर्गेनॉइड की स्केलेबल जनरेशन

The cerebellum plays a critical role in the maintenance of balance and motor coordination, and a functional defect in different cerebellar neurons can ...

Production of Membrane-Filtered Phase-Shift Decafluorobutane Nanodroplets from Preformed Microbubbles

झिल्ली-फ़िल्टर्ड फेज-शिफ्ट Decafluorobutane Nanodroplets का उत्पादन Preformed Microbubbles से

There are many methods that can be used for the production of vaporizable phase-shift droplets for imaging and therapy. Each method utilizes different ...

Generation of a Simplified Three-Dimensional Skin-on-a-chip Model in a Micromachined Microfluidic Platform

माइक्रोमशीन्ड माइक्रोफ्लुइडिक प्लेटफॉर्म में एक सरलीकृत त्रि-आयामी त्वचा-ऑन-ए-चिप मॉडल का उत्पादन

This work presents a new, cost-effective, and reliable microfluidic platform with the potential to generate complex multilayered tissues. As a proof of ...