Name: a converging strategy for the generation of a virtually sequenced cdna library from unreferenced pacific oysters
Uploaded: 2019-06-13T13:30:00
Description: Watch this Scientific Journal Video about A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters at JoVE.com

이 작품은 중국 자연과학 재단(교부금 번호 31471703, A020130537 및 31671854, J.V. 및 L.L.에 31670435) 및 100 외국 인재 계획(JSB2014012)에 의해 부분적으로 지원되었습니다.

참고: 도식 개요는 그림 1에나와 있습니다.
1. 샘플 수집
<ol><li>굴 표본을 구하십시오. 수확 후 철기, 수송 및 실험실 사용 전에 얼음에 굴을 보관하고 구입 후 4-7 일 이내에 처리하십시오. 참고: 이 프로토콜의 경우, 굴은 난징의 중카이 도매 시장(닝데, 푸젠, 중국, 랴오닝강, 장쑤성), 칭다오의 하이지 수산물 회사(중국 산둥성 칭다오에서 유래), 주청?...

<ol>
	<li>Blaxter, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+promise+of+a+DNA+taxonomy.">The promise of a DNA taxonomy.</a> Philosophical transactions of the Royal Society of London. Series B, Biological. 359 (1444), 669-679 (2004).</li><li>Wen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+identification+of+dried+shellfish+(oyster,+clam+and+mussel)+products+sold+on+the+Chinese+market.">Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market.</a> Food Control. 90, 199-204 (2018).</li><li>Zhang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+cob+and+cox1+genes+and+editing+of+the+corresponding+mRNAs+in+Dinophysis+acuminata+from+Narragansett+Bay,+with+special+reference+to+the+phylogenetic+position+of+the+genus+Dinophysis.">Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis.</a> Applied and Environmental Microbiology. 74 (5), 1546-1554 (2007).</li><li>Sell, J., Spirkovski, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mitochondrial+DNA+differentiation+between+two+forms+of+trout+Salmo+letnica,+endemic+to+the+Balkan+Lake+Ohrid,+reflects+their+reproductive+isolation.">Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation.</a> Molecular Ecology. 13, 3633-3644 (2004).</li><li>Karadjian, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+rearranged+mitochondrial+genome+in+Nycteria+parasites+(Haemosporidia)+from+bats.">Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (35), 9834-9839 (2018).</li><li>Morga, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+genes+from+flat+oyster+Ostrea+edulis+as+suitable+housekeeping+genes+for+quantitative+real+time+PCR.">Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR.</a> Fish and Shellfish Immunology. 29 (6), 937-945 (2010).</li><li>Delsuc, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+systematics+of+armadillos+(Xenarthra,+Dasypodidae):+contribution+of+maximum+likelihood+and+Bayesian+analyses+of+mitochondrial+and+nuclear+genes.">Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes.</a> Molecular Phylogenetics and Evolution. 28 (2), 261-265 (2005).</li><li>Wei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+and+Biochemical+Characterization+of+UDP-Glucose+Dehydrogenase+from+Akkermansia+muciniphila.">Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila.</a> Protein &amp; Peptide Letters. 24 (8), 735-741 (2017).</li><li>Gu, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+and+Biochemical+Characterization+of+the+UDP-Xylose+Biosynthesis+Pathway+in+Sphaerobacter+thermophilus.">Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus.</a> Protein &amp; Peptide Letters. 23 (12), 1103-1110 (2016).</li><li>Duan, X. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+characterization+of+the+UDP-xylose+biosynthesis+pathway+in+Rhodothermus+marinus.">Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus.</a> Applied Microbiology and Biotechnology. 99 (22), 9463-9472 (2015).</li><li>Vogelstein, B., Gillespie, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+and+analytical+purification+of+DNA+from+agarose.">Preparative and analytical purification of DNA from agarose.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (2), 615-619 (1979).</li><li>Song, H. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UDP-glucose+4-epimerase+and+&#946;-1,4-galactosyltransferase+from+the+oyster+Magallana+gigas+as+valuable+biocatalysts+for+the+production+of+galactosylated+products.">UDP-glucose 4-epimerase and &#946;-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products.</a> International Journal of Molecular Sciences. 19 (6), 1600 (2018).</li><li>Gainey, P. A., Phelps, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridine+diphosphate+glucuronic+acid+production+and+utilization+in+various+tissues+actively+synthesizing+glycosaminoglycans.">Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans.</a> Biochemical Journal. 128 (2), 215-227 (1972).</li></ol>

제시된 프로토콜은 COX1과 ND 유전자를 공개적으로 이용 가능한 굴 DNA 게놈 데이터베이스와 비교하여 지역 해산물 시장에서 유사한 표현형을 가진 참조되지 않은 굴 표본의 유전 적 식별을 허용합니다. 이 방법의 중요성은 가상 cDNA 라이브러리의 평가를 위해 단일 PCR 반응만 필요하기 때문에 단순성입니다. 보존된 2개의 미토콘드리아 COX1 및 ND 유전자는 각 굴에서 RNA 추출물의 역전사에 의해 생성된...

긴 납품 시간, 기업가 추론 또는 국가별 관세 규정으로 인해 살아있는 참조 생물학적 물질의 취득이 어려울 수 있습니다. 대안으로서, 요구되는 생물학적 물질은 또한 전형적으로 동일한 시편으로부터 수집될 수 있다. 그러나, 이 견본은 유전자형의 수준에 현저하게 변화할 수 있고, 그러므로 동일 종의 디지털로 저장된 기준 게놈과의 비교는 수시로 새로 공급된 물자의 비호환성 때문에 어렵거나 심지어 쓸모없는 렌더링됩니다 기존 DNA 증폭 방법. 개별 시료의 고도로 보존된 유전자를 시퀀싱하는 것은 cDNA라이브러리 2의 품질 평가를 위한 기준 유전자로 자주 사용되는 보존된 미토콘드리아 유전자와 같은 종 1을 식별하기 위한 널리 사용되고 강력한 도구입니다2 ,3,4,5,6. 본명 제시된 방법에 대한 근본적인 근거는 기준 게놈의 상응하는 서열에 비해 개별 익명 굴 샘플에서 미토콘드리아 유전자 서열의 높은 보존이 다른 유전자도 나타낼 수 있음을 나타낸다는 것이다. 낮은 수준의 차이는 핵 DNA 7에 비해 일반적으로 빠른 미토콘드리아DNA 진화 속도를 감안할 때, 단순히 공개적으로 사용하여 광범위한 과학적 및 산업적으로 관련된 유전자의 증폭 및 격리를 허용합니다. 사용 가능한 시퀀싱 데이터를 참조로 사용할 수 있습니다.
본 명세서의 전체적인 목적은 굴 유전자의 복제를 위한 템플릿 DNA로서 사용될 수 있는 사실상 서열된 굴 cDNA 라이브러리를 생성하기 위한 최적화된 워크플로우를 제시하는 것이다. 가상 시퀀싱에서, 드 노보 게놈 시퀀싱은 우회; 대신, 알려진 디지털 방식으로 저장된 참조 시퀀스는 결국 라이브러리를 구성할 cdNA 생산을 위한 프라이머를 활용하거나 설계하는 데 직접 사용됩니다(또는 기존 라이브러리에 추가됨). 목표는 생성된 cDNA 서열과 기준 서열 사이의 유사성이 낮은 발산에서 높은 발산까지 순위가 매겨질 수 있음을 의미하는 수렴 cDNA 라이브러리를 생성하는 것입니다. 시토크롬 C 옥시다아제 소단위 1(COX1) 및 NADH 탈수소효소(ND)를 기준 유전자로 사용하는 주요 장점은 이러한 미토콘드리아 유전자의 높은 보존으로 인해 지리적으로 매우 탈수한 굴 표본도 프로파일화될 수 있다는 것입니다. 이러한 잘 확립 된 마커로 접근법을 입증 한 후, 우리는 설탕 뉴클레오티드 생합성에 관여하고 산업 관련성 8,9, 2 효소 후보에게 적용을 입증합니다. 10. 태평양 굴의 생명 공학 적 잠재력은 아직 밝혀지지 않았습니다. 따라서, 우리는 사실상 서열화된 cDNA 라이브러리를 준비하기 위한 이 수렴 방법이 또한 이 관련 생물학 물자에서 cDNA를 생성하고 싶은 비전문가 연구원을 위해 적법할 것이라는 점을 믿습니다.

<table border="0" cellpadding="0" cellspacing="0" style="width:827px;" width="826">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:261px;">Chemicals:</td>
			<td style="width:199px;"></td>
			<td style="width:131px;"></td>
			<td style="width:236px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1% Triton X-100</td>
			<td>Solarbio</td>
			<td>9002-93-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:261px;">2,5-Dihydroxybenzoic acid</td>
			<td>Alfa Aesar</td>
			<td>490-79-9</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Acetonitrile</td>
			<td>Merck</td>
			<td>75-05-8</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Agarose for molecular biology</td>
			<td>Biowest Chemicals</td>
			<td>111860</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ampicilin</td>
			<td>Solarbio</td>
			<td>69-52-3</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chloroform</td>
			<td>Lingfeng, Shanghai</td>
			<td>67-66-3</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DEPC water</td>
			<td>Thermo Scientific</td>
			<td>R0601</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ethanol</td>
			<td>Jinhuada, Guangzhou</td>
			<td>64-17-5</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Guanidinium thiocyanate-phenol reagent</td>
			<td>Invitrogen</td>
			<td>15596018</td>
			<td>TRIzol reagent</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Imidazole</td>
			<td>Energy Chemical</td>
			<td>288-32-4</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isopropyl alcohol</td>
			<td>Nanjing Chemical Reagent</td>
			<td>67-63-0</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isopropyl &#946;-D-thiogalactopyranoside</td>
			<td>Solarbio</td>
			<td>367-93-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Kanamycin</td>
			<td>Solarbio</td>
			<td>25389-94-0</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB Agar</td>
			<td>Thermo Fisher</td>
			<td>22700025</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LB Broth</td>
			<td>Thermo Fisher</td>
			<td>10855021</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Methanol</td>
			<td>Jinhuada, Guangzhou</td>
			<td>67-56-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;">MgCl2 hexahydrate</td>
			<td>Xilong Huagong</td>
			<td>7791-18-6</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NaCl</td>
			<td>Xilong Huagong</td>
			<td>7647-14-5</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">NAD+</td>
			<td>Duly Biotech</td>
			<td>53-84-9</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phenyl-methylsulfonyl fluoride</td>
			<td>Macklin</td>
			<td>329-98-6</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tris</td>
			<td>Solarbio</td>
			<td>77-86-1</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">UDP-glucose</td>
			<td>Wuhu Nuowei Chemicals</td>
			<td>28053-08-9</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UDP-glucuronic acid</td>
			<td>SIGMA</td>
			<td>63700-19-6</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tools/Instruments:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MALDI-TOF mass spectrometer</td>
			<td>Bruker</td>
			<td>Autoflex</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Metal block heater</td>
			<td>Long Yang Scientific Instruments</td>
			<td>Thermoshaker HB20</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR thermocycler</td>
			<td>Hema</td>
			<td>9600</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Enzyme and Kits:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">10&#215;Ligation buffer</td>
			<td>Thermo Scientific</td>
			<td>B69</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">5&#215;PrimeSTAR buffer</td>
			<td>Takara</td>
			<td>9158A</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Alkaline phosphatase</td>
			<td>ThermoFisher FastAP</td>
			<td>EF0654</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">COX forward primer</td>
			<td>Genscript</td>
			<td>ATGTCAACAAATCATTTAGACATTG</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">COX reverse primer</td>
			<td>Genscript</td>
			<td>ACTTGACCAAAAACATAAGACATG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cutsmart Buffer</td>
			<td>NEB</td>
			<td>B7204S</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">dNTP mix</td>
			<td>Invitrogen</td>
			<td>18427088</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUGD forward primer</td>
			<td>Genscript</td>
			<td>ACATATGACCCTGTCCAAGATCTGTTGT</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUGD reverse primer</td>
			<td>Genscript</td>
			<td>ACTCGAGACTCTGTGAGGCGGTGGAG</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUXS forward primer</td>
			<td>Genscript</td>
			<td>CCATATGGCAGAATCCTCACAATCAC</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">MgUXS reverse primer</td>
			<td>Genscript</td>
			<td>ACTCGAGCACATTTTTGAATTTGCAGACGT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ND forward primer</td>
			<td>Genscript</td>
			<td>ATGAGATGGCAATTATTTTTTAAT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ND reverse primer</td>
			<td>Genscript</td>
			<td>ATGTATTTTGGAAAAATCTCCAC</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PCR Cleanup Kit</td>
			<td>AxyGen</td>
			<td>AP-PCR-250</td>
			<td>*Alternative distributors possible</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pET-30a(+) vector</td>
			<td>Merck Millipore</td>
			<td>69909</td>
			<td></td>
		</tr>
	</tbody>
</table>

a converging strategy for the generation of a virtually sequenced cdna library from unreferenced pacific oysters

새로운 세포주 또는 게놈 시퀀싱 프로젝트의 개발과 같은 주요 실험에서 이전에 사용되었던 기준 종의 생물학적 물질에 대한 접근은 종종 추가 연구 또는 제3자에 대한 제공이 어렵습니다. 샘플의 소모적 특성. 현재 아시아, 오스트레일리아 및 북미의 태평양 연안에 널리 분포되어 있지만, 개별 태평양 굴 표본은 유전적으로 매우 다양하므로 유전자 라이브러리의 시작 물질로 직접 적합하지 않습니다. 이 기사에서는 지역 해산물 시장에서 얻은 참조되지 않은 태평양 굴 표본을 사용하여 cDNA 라이브러리를 생성하는 방법을 보여줍니다. 이들 라이브러리는 공론화된 굴 게놈과 비교하였고, 가장 가까운 관련 라이브러리는 미토콘드리아 기준 유전자 시토크롬 C 옥시다아제 소단위 I(COX1) 및 NADH 탈수소효소(ND)를 사용하여 선택하였다. 생성된 cDNA 라이브러리의 적합성은 UDP-글루쿠로닉 산 탈수소효소(UGD) 및 UDP-자일로스의 생합성을 담당하는 UDP-자일로오스 신타제(UXS)를 코딩하는 두 유전자의 복제 및 발현에 의해 입증된다. UDP-포도당.

도 1은 태평양 굴 개인으로부터 유래된 수렴 cDNA 라이브러리의 기재된 제조 방법의 개략적 개요를 나타낸다. 도 2는 기준 물질의 COX1 및 ND 유전자 서열로부터 높은 발산을 가진 먼 관련 굴 시편의 COX1 및 ND 유전자의 서열을 나타낸다. 도 3은 기준 물질의 COX1 및 ND 유전자 서열로부터 낮은 발산을 가진 밀접하게 관련된 굴 시편의 COX1 ...

Watch this Scientific Journal Video about A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters at JoVE.com

A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters

우리는 참조되지 않은 태평양 굴 견본에서 RNA 견본을 사용하는 방법에 대한 전략을 기술하고, 사실상 연속된 cDNA 라이브러리를 생성하기 위하여 공개적으로 유효한 게놈 데이터와 비교하여 유전 물질을 평가합니다.

참조되지 않은 태평양 굴에서 사실상 순차적 cDNA 라이브러리 생성을 위한 수렴 전략

The access to biological material of reference species, which were used previously in key experiments such as in the development of novel cell lines or ...

우리가이 방법으로 해결 하려는 주요 질문은 어떻게 우리가 생물 공학적으로 관련 된 유전자의 복제에 대 한 지역 식품 시장에서 구입 한 재료에서 RNA 샘플을 사용할 수 있습니다? 여기에서는 태평양 굴을 이 접근 방식과 추가 적용 가능성을 입증하기 위한 사례 연구로 사용합니다. 이 기술의 주요 장점은 굴 샘플의 기존의 게놈 또는 cDNA 염기서열분석이 우회될 수 있다는 것입니다.대신, 시토크롬 c 산화효소 서브유닛 I 및 NADH 탈수소효소의 서열은 태평양 굴에서 공개적으로 이용 가능한 기준 서열과 비교하여 가장 밀접한 관련이 있는 시편을 선택했다. 이 시편으로부터 제조된 cDNA는 공공 서열 정보를 사용하여 선택될 수 있는 생명공학적으로 관련된 유전자의 복제에 직접 사용될 수 있다. 이 절차를 시연하는 것은 난징농업대학의 글리코믹스 및 글리칸 생명공학 연구센터졸업생 2명이 이용메이 류와 유콴 리(Yuquan Li)입니다.굴 조직 샘플을 준비하려면 멸균 된 메스를 사용하여 각 굴 표본의 대략적인 기하학적 중심에서 약 100 밀리그램의 균일 한 연조직을 잘라냅니다. 샘플을 액체 질소 50밀리리터로 채워진 박격포로 옮는다. 플래시 냉동 굴 조직을 미세 한 분말로 갈아 넣습니다.각 시편의 냉동 조직의 75밀리그램을 멸균 1.5밀리리터 원심분리기 튜브에 넣고, 구니디늄 티오야네이트 페놀 추출 시약 1밀리리터와 섞는다. 이 절차의 가장 중요한 단계는 RNA 추출 단계입니다. RNA 분해를 최소화하기 위해서는 굴 조직과 RNA 추출 을 수확하는 사이의 시간을 줄이는 것이 필수적입니다.원심 분리는 14, 000 배 g 및 섭씨 4도에서 15 분 동안 샘플을 원심 분리합니다. 새로운 1.5 밀리리터 원심분리기 튜브로 상체를 옮기고, 클로로폼 200마이크로리터를 추가하고, 혼합물이 유백색으로 변할 때까지 10~15초 동안 소용돌이 믹서에 철저히 섞습니다. 다음으로, 원심분리기는 이전과 마찬가지로 15분 동안.200 마이크로리터 파이펫을 사용하면 상수 층을 방해하지 않고 새로운 1.5 밀리리터 원심분리기 튜브로 조심스럽게 전달합니다. 원심분리기 튜브에 이소프로필 알코올 500마이크로리터를 넣고 부드럽게 반전하여 샘플을 섞습니다. 그런 다음 샘플을 얼음 위에 20 분 동안 둡니다.원심분리기는 14, 000배, 섭씨 4도에서 8분간, 상수분리기를 제거합니다. 펠릿을 75%에탄올1밀리리터로 재차, 원심분리기는 14, 000배, 섭씨 4도에서 5분간 재차한다. 모든 상체를 제거하고 에탄올로 세척을 반복합니다.실온에서 6분간 펠릿을 건조시다. 그런 다음, 말린 RNA 펠릿을 DEPC 처리 된 물의 25 마이크로 리터에 녹여 서 튜브를 얼음에 유지합니다. 24시간 이내에 RNA 샘플을 사용하십시오.cDNA 라이브러리를 생성하기 위해 먼저 원고에 따라 솔루션을 추가하여 300 마이크로리터 PCR 튜브에서 각 RNA 샘플에 대한 반응 혼합물을 준비한다. 추출된 RNA 샘플의 마이크로리터 1개를 튜브에 추가합니다. PCR 열순환기에서 섭씨 42도에서 60분 동안 혼합물을 배양한 다음 온도를 섭씨 95도로 5분간 증가시면 됩니다.생성된 cDNA 라이브러리를 섭씨 영하 20도에서 최대 12개월 동안 보관하십시오. 먼저, 생성된 cDNA 라이브러리의 마이크로리터 1개를 원고에 따라 제조된 PCR 혼합물을 포함하는 튜브에 추가한다. PCR 튜브를 PCR 써모사이클러에 넣고, 원고에 따른 어닐링 단계, 신장 단계 및 변성 단계로 구성된 초기 내포화 단계 및 35PCR 반응 사이클로 PCR 증폭을 수행한다.사이클 후 5분 동안 하나의 마무리 신장 단계를 수행합니다. PCR 제품의 5개의 마이크로리터를 사용하여 아가로즈 젤 전기포광에 의한 품질을 확인합니다. 증폭된 COX1 또는 ND 유전자를 각각 759 또는 748염기 쌍에서 단일 대역으로 관찰한다.PCR 제품의 나머지 부분을 정화하려면 각 샘플에 고농도의 차오트로픽 염을 함유한 DNA 결합 버퍼 100마이크로리터를 추가합니다. 내용내용을 짧게 혼합하는 소용돌이. 정화 열을 2밀리리터 원심분리기 튜브에 넣습니다.반응 혼합물을 기둥에 파이펫합니다. 내장 기둥이 있는 튜브를 실온에서 1분 동안 14, 000배 g의 원심분리기에 놓습니다. 2밀리리터 원심분리기 튜브에서 여과물을 폐기한 후, 14, 000배 g에서 원심분리로 700 및 400 마이크로리터의 세척용 액수 W2로 두 번 세척합니다.다음으로, 금속 블록 히터에서 1 밀리리터의 탈이온된 물을 섭씨 65도로 가열합니다. 컬럼을 새로운 1.5밀리리터 원심분리기 튜브로 옮기고, 예열된 분수의 파이펫 25 마이크로리터를 백색 기둥 멤브레인의 중심으로 옮킨다. 멤브레인이 실온에서 1 분 동안 담가 두십시오.그런 다음, 실온에서 1 분 동안 14, 000 배 g에서 컬럼으로 튜브를 원심 분리합니다. 열을 버리고 정제 된 PCR 제품을 섭씨 영하 20도에서 최대 12 개월 동안 보관하십시오. 선택적으로 COX1 또는 ND 역프라이머는 양방향 시퀀싱에도 사용할 수 있습니다.Sanger 시퀀싱의 경우 관련 COX1 또는 ND 포워드 프라이머를 사용하십시오. 시퀀싱 결과를 검색한 후, NCBI 뉴클레오티드 BLAST 온라인 도구를 사용하여 태평양 굴 기준 균주의 게놈 서열과 서열을 비교한다. MgUGD 및 MgUXS 유전자의 각각 전방 및 역 프라이머를 사용하여 이전에 수행했던 PCR에 의해 증폭되고 정화합니다.소화 완충제로 정제된 PCR 제품을 배양한 후, 1.5밀리리터 원심분리기 튜브에서 500나노그램의 pET-30a를 용해하여 예치된 pET-30a 벡터를 준비하고, 최대 16마이크로리터를 얹기 위해 탈이온수를 첨가한다. 그런 다음, 10배 농축 소화 버퍼 2개와 20단위 제한 엔토뉴리스 Nde1 및 Xho1 각각 1개의 마이크로리터를 튜브에 첨가한다. 3시간 동안 37°C에서 혼합물을 배양합니다.그 후, 1 단위 알칼리 인산염의 마이크로 리터 를 추가하고 추가 시간 동안 섭씨 37도에서 배양. 그런 다음, 알칼리성 인스파타제를 비활성화하기 위해 10분 동안 예열된 금속 블록 히터에 튜브를 10분간 놓습니다. MgUGD 및 MgUXS 유전자를 가진 E.coli BL21 세포를 재배한 후, 2리터 흔들리는 플라스크에서 400 밀리리터 LB 배지로 배양을 옮기고, 섭씨 37도의 온도에서 200 rpm의 셰이커에 놓습니다.3시간 후, 600나노미터의 파장에서 광미터의 광학 밀도를 확인하고 약 0.5의 흡수에 도달하도록 한다. 그런 다음 셰이커 온도를 섭씨 20도로 줄입니다. 1-어금니 IPTG의 400 마이크로리터를 첨가하여 재조합 단백질의 발현을 3시간 동안 유도합니다.세포를 수확 한 후 섭씨 4도에서 20 분 동안 초음파 처리로 세포를 방해하십시오. 원심분리기는 14, 000배, 섭씨 4도에서 20분 동안, 활동 테스트를 위한 새로운 튜브에서 상퍼를 수집한다. 활동 분석 후, MgUXS 및 MgUGD 혼합물에 메탄올 20 마이크로리터와 40 마이크로리터의 클로로폼을 첨가하여 반응을 담금질한다.샘플 혼합물, 원심분리기는 14, 000배 g에서 6분간 4도의 섭씨로 소용돌이합니다. MALDI-TOF 질량 분석법에 대한 새로운 튜브에서 각 튜브의 상부 수성 층을 수집합니다. 본 실험에서, 매우 발산된 시편의 COX1 및 ND 유전자 서열의 서열 정렬은 참조 태평양 굴 균주와 비교하였다.적색 화살표는 얻어진 cDNA 샘플의 기준 서열과 서열 사이의 뉴클레오티드 차이를 나타낸다. 밀접하게 관련된 굴 시편의 COX1 및 ND 유전자의 서열은 참조 태평양 굴 균주로부터 낮은 발산을 보여줍니다. MALDI-TOF 질량 분석법은 cDNA 라이브러리를 성공적으로 적용하여 산업적으로 관련된 유전자 MgUGD 및 MgUXS를 복제합니다.젤 이미지는 또한 연속적으로 표현되고 정제된 MgUGD 및 MgUXS의 효소 작용에 의해 생성된 UDP-글루쿠로닉산 및 UDP-xylose를 식별합니다. 이 방법은 참조 서열과 얻은 마커 서열 사이의 완벽한 일치를 필요로하지 않으며 참조되지 않은 굴과 함께 작동하도록 연구원에게 자신감을 주어야한다. 원칙적으로, 이 방법은 밀접하게 관련된 참조 종에서 서열이 공개적으로 이용 가능한 참조되지 않은 생물학적 샘플에 적용될 수 있다.이 방법은 비 전문가 연구원이 잠재적인 생물학적 중요성의 유전 물질에 쉽게 접근할 수 있게 하고 더 많은 과학자들이 쉽게 접근가능하지만 불완전하게 확인된 생물학적 샘플로 작업할 수 있는 길을 열어줍니다.

Research

JoVE Journal

Bioengineering

Synthetic Spider Silk Production on a Laboratory Scale

실험실 규모의 합성 거미의 실크 생산

As society progresses and resources become scarcer, it is becoming increasingly important to cultivate new technologies that engineer next generation ...

연구

생체공학

Designing a Bio-responsive Robot from DNA Origami

DNA 종이 접기에서 바이오 반응 로봇을 설계

Nucleic acids are astonishingly versatile. In addition to their natural role as storage medium for biological information1, they can be utilized in ...

An Improved Method for the Preparation of Type I Collagen From Skin

피부에서 타입 I 콜라겐의 제조를위한 개선 된 방법

Soluble type 1 collagen (COL1) is used extensively as an adhesive substrate for cell cultures and as a cellular scaffold for regenerative applications. ...

Lipid Bilayer Vesicle Generation Using Microfluidic Jetting

미세 유체 제트를 사용하여 지질 이중층 소포 세대

Bottom-up synthetic biology presents a novel approach for investigating and reconstituting biochemical systems and, potentially, minimal organisms. This ...

Generation of a Three-dimensional Full Thickness Skin Equivalent and Automated Wounding

3 차원 전체 두께 피부의 세대 동등한 및 자동화 부상

In vitro models are a cost effective and ethical alternative to study cutaneous wound healing processes. Moreover, by using human cells, these models ...

Qualitative Characterization of the Aqueous Fraction from Hydrothermal Liquefaction of Algae Using 2D Gas Chromatography with Time-of-flight Mass Spectrometry

비행 시간 형 질량 분석과 2D 가스 크로마토 그래피를 사용하여 조류의 열수 액화에서 수성 분수의 질적 특성

Two-dimensional gas chromatography coupled with time-of-flight mass spectrometry is a powerful tool for identifying and quantifying chemical components in ...

A Microcontroller Operated Device for the Generation of Liquid Extracts from Conventional Cigarette Smoke and Electronic Cigarette Aerosol

전통적인 담배 연기와 전자 담배 연 무질에서 액체 추출의 세대에 대 한 장치를 운영 하는 마이크로컨트롤러

Electronic cigarettes are the most popular tobacco product among middle and high schoolers and are the most popular alternative tobacco product among ...

Scalable Generation of Mature Cerebellar Organoids from Human Pluripotent Stem Cells and Characterization by Immunostaining

인간 다능성 줄기 세포에서 성숙한 소뇌 오르가노이드의 확장 가능한 생성 및 면역 염색에 의한 특성화

The cerebellum plays a critical role in the maintenance of balance and motor coordination, and a functional defect in different cerebellar neurons can ...

Production of Membrane-Filtered Phase-Shift Decafluorobutane Nanodroplets from Preformed Microbubbles

미리 형성된 마이크로버블에서 멤브레인 여과 위상 시프트 데카플루오로부탄 나노방울의 생산

There are many methods that can be used for the production of vaporizable phase-shift droplets for imaging and therapy. Each method utilizes different ...

Generation of a Simplified Three-Dimensional Skin-on-a-chip Model in a Micromachined Microfluidic Platform

마이크로머신 마이크로유체 플랫폼의 간소화된 3차원 스킨 온-어칩 모델 생성

This work presents a new, cost-effective, and reliable microfluidic platform with the potential to generate complex multilayered tissues. As a proof of ...