Name: in vivo direct reprogramming of resident glial cells into interneurons by intracerebral injection of viral vectors
Uploaded: 2019-06-17T15:00:00
Duration: 12 min 26 s
Description: Watch this Scientific Journal Video about In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors at JoVE.com

<p class="jove_content">마르첼라 비르텔레는 마리 스크와도우스카-퀴리 혁신 교육 네트워크 및 보조금 협정 제676408호하에 유럽 연합 호라이즌 2020 프로그램(H2020-MSCA-ITN-2015)의 자금을 지원받았습니다. 다니엘라 릴란더 오토슨은 스웨덴 연구위원회 (2017-01234)의 지원을 받았습니다.</p>

<ol>
	<li>Barker, R. A., Parmar, M., Studer, L., Takahashi, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Trials+of+Stem+Cell-Derived+Dopamine+Neurons+for+Parkinson&#39;s+Disease:+Dawn+of+a+New+Era.">Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson&#39;s Disease: Dawn of a New Era.</a> <em style='font-style: italic'>Cell Stem Cell</em>. <b>21</b> (5), 569-573 (2017).</li><li>Southwell, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interneurons+from+embryonic+development+to+cell-based+therapy.">Interneurons from embryonic development to cell-based therapy.</a> <em style='font-style: italic'>Science</em>. <b>344</b> (6180), 1240622 (2014).</li><li>Parmar, M., Torper, O., Drouin-Ouellet, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-based+therapy+for+Parkinson&#39;s+disease:+A+journey+through+decades+toward+the+light+side+of+the+Force.">Cell-based therapy for Parkinson&#39;s disease: A journey through decades toward the light side of the Force.</a> <em style='font-style: italic'>European Journal of Neuroscience</em>. , (2018).</li><li>Torper, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Reprogramming+of+Striatal+NG2+Glia+into+Functional+Neurons+that+Integrate+into+Local+Host+Circuitry.">In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry.</a> <em style='font-style: italic'>Cell Reports</em>. <b>12</b> (3), 474-481 (2015).</li><li>Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+conversion+of+astrocytes+to+neurons+in+the+injured+adult+spinal+cord.">In vivo conversion of astrocytes to neurons in the injured adult spinal cord.</a> <em style='font-style: italic'>Nature Communication</em>. <b>5</b>, 3338 (2014).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ascl1+Converts+Dorsal+Midbrain+Astrocytes+into+Functional+Neurons+In+Vivo.">Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo.</a> <em style='font-style: italic'>Journal of Neuroscience</em>. <b>35</b> (25), 9336-9355 (2015).</li><li>Guo, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+direct+reprogramming+of+reactive+glial+cells+into+functional+neurons+after+brain+injury+and+in+an+Alzheimer&#39;s+disease+model.">In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer&#39;s disease model.</a> <em style='font-style: italic'>Cell Stem Cell</em>. <b>14</b> (2), 188-202 (2014).</li><li>Grande, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+impact+on+direct+neuronal+reprogramming+in+vivo+in+the+adult+brain.">Environmental impact on direct neuronal reprogramming in vivo in the adult brain.</a> <em style='font-style: italic'>Nature Communication</em>. <b>4</b>, 2373 (2013).</li><li>Niu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+reprogramming+of+astrocytes+to+neuroblasts+in+the+adult+brain.">In vivo reprogramming of astrocytes to neuroblasts in the adult brain.</a> <em style='font-style: italic'>Nature Cell Biology</em>. <b>15</b> (10), 1164-1175 (2013).</li><li>Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vector+Reprogramming+of+Adult+Resident+Striatal+Oligodendrocytes+into+Functional+Neurons.">Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons.</a> <em style='font-style: italic'>Molecular Therapy</em>. <b>25</b> (4), 928-934 (2017).</li><li>Pereira, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+Reprogramming+of+Resident+NG2+Glia+into+Neurons+with+Properties+of+Fast-Spiking+Parvalbumin-Containing+Interneurons.">Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons.</a> <em style='font-style: italic'>Stem Cell Reports</em>. <b>9</b> (3), 742-751 (2017).</li><li>Rivetti di Val Cervo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+functional+dopamine+neurons+from+human+astrocytes+in+vitro+and+mouse+astrocytes+in+a+Parkinson&#39;s+disease+model.">Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson&#39;s disease model.</a> <em style='font-style: italic'>Nature Biotechnology</em>. <b>35</b> (5), 444-452 (2017).</li><li>Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Helper-free+Production+of+Laboratory+Grade+AAV+and+Purification+by+Iodixanol+Density+Gradient+Centrifugation.">Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation.</a> <em style='font-style: italic'>Molecular Therapy Methods &#38; Clinial Development</em>. <b>10</b>, 1-7 (2018).</li><li>Torper, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+induced+neurons+via+direct+conversion+in+vivo.">Generation of induced neurons via direct conversion in vivo.</a> <em style='font-style: italic'>Proceedings of the National Academy of Sciences of the United States of America</em>. <b>110</b> (17), 7038-7043 (2013).</li><li>Kawaguchi, Y., Kubota, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correlation+of+physiological+subgroupings+of+nonpyramidal+cells+with+parvalbumin-+and+calbindinD28k-immunoreactive+neurons+in+layer+V+of+rat+frontal+cortex.">Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex.</a> <em style='font-style: italic'>Journal of Neurophysiology</em>. <b>70</b> (1), 387-396 (1993).</li><li>Grealish, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+A9+dopamine+neuron+component+in+grafts+of+ventral+mesencephalon+is+an+important+determinant+for+recovery+of+motor+function+in+a+rat+model+of+Parkinson&#39;s+disease.">The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson&#39;s disease.</a> <em style='font-style: italic'>Brain</em>. <b>133</b> (Pt 2), 482-495 (2010).</li><li>Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+dopaminergic+neurons+of+nigral+and+ventral+tegmental+area+subtypes+in+grafts+of+fetal+ventral+mesencephalon+based+on+cell+morphology,+protein+expression,+and+efferent+projections.">Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections.</a> <em style='font-style: italic'>Journal of Neuroscience</em>. <b>25</b> (27), 6467-6477 (2005).</li></ol>

<p class="jove_content">생체 내 직접 재프로그래밍은 Cre-발현 마우스 균주에서 AAV FLEX 벡터를 사용하여 달성될 수 있다. 재프로그래밍 효능에 관해서는 마우스 균주 간의 차이가 관찰되었다는 점에 유의하는 것이 중요합니다. 줄무늬에서 생체 내 재프로그래밍의 경우, NG2-Cre 마우스 라인은 다른 균주와 비교할 때 더 효율적인 것으로 입증되었습니다. 새로운 동물 균주를 사용하기 전에, 동물의 나이가 종종이 단백질 발현의 특이성에 영향을 미치기 때문에 시간이 지남에 따라 Cre 발현에 관한 마우스 제공 자 지침을 확인하는 것이 중요합니다. 우리의 연구에서, 12주 이상 된 동물은 NG2 glia 이외의 세포에서 Cre 발현에 대한 위험이 있었기 때문에 생체 내 재프로그래밍에 사용되지 않았다. 시냅신-FLEX-GFP 시제만주입된 대조군 동물의 지속적인 존재 및 모니터링이 권장된다. 이것은 더 재프로그래밍 유전자 (ALN)가 사용되지 않는 경우에 나타나서는 안 되는 GFP 양성 세포를 위한 동물의 감시를 허용합니다.</p>
<p class="jove_content">새로 프로그래밍된 뉴런을 식별하기 위해 이 프로토콜에 설명된 뉴런과 같은 뉴런 특이적 식별 방법이 가장 중요합니다. 이는 동성애자 영역에서 재프로그래밍할 때 특히 관련성이 있는 내인성 주변 세포로부터 재프로그래밍된 뉴런을 적절히 식별하고 구별할 수 있게 한다.</p>
<p class="jove_content">그것은 또한 바이러스 성 주입에 대 한 올바른 구조를 대상으로 하는 것이 중요 하다. 따라서, 바이러스 성 주입을 위한 입체 외과는 중요하고 두뇌의 더 작은 구조물을 표적으로 할 때 특히 정확하게 접근할 필요가 있습니다.</p>
<p class="jove_content">우리는 이전에<sup class="xref">동일한</sup> 재프로그래밍 인자를 사용하여 생체 외 재프로그래밍 실험을 기반으로 생체 내 재프로그래밍의 결과를 예측하는 것이 신뢰할 수 없다는 것을 11을 보여주었습니다. 따라서 관심있는 모든 요소는 생체 내에서 테스트해야합니다. 우리의 손에, 많은 다른 요인 조합은 뉴런의 동일한 아류형을 제공 (즉, 생체 내에서 interneurons<sup class="xref">11)</sup> 이러한 유전자는 다른 뉴런의 개발에 연루 된 사실에도 불구하고.</p>
<p class="jove_content">재프로그래밍된 뉴런에 대한 전세포 패치 클램프는 섬세한 기술이며 조직 처리는 좋은 결과를 위해 중요하다. 얼음 차가운 Krebs 용액을 가진 관류는 조직 질을 향상시킵니다. 또한 패치 된 뉴런은 신중하게 치료해야합니다. 재프로그래밍된 뉴런의 성숙 및 표현형 정체성이 전체 세포 패치 클램프를 사용하여 다소 평가될 수 있더라도, 이들 세포는 그들의 내인성 대조물과 완전히 비교할 수 없다. 게놈 시퀀싱(예를 들어, RNA 시퀀싱)과 같은 추가유형의 분석은 다시 프로그래밍된 세포 정체성을 추가로 확인하기 위해 사용되어야 한다.</p>
<p class="jove_content">본 명세서에 기재된 기술은 뇌에서 신경 대체가 필요한 미래 치료법의 개발을 위해 고려될 수 있다. 생체 내 재프로그래밍은 아직 초기 단계에 있으며 인간으로의 번역은 아직 예측되지 않았지만,이 기술은 뇌의 외인성 유전자 기능을 평가하고 생체 내에서 세포 성숙을 연구하는 방법을 제공 할 수 있습니다.</p>

<p class="jove_content">이 방법의 전반적인 목표는 효율적으로 parvalbumin 발현 인터뉴런과 같은 기능및 아류형 특정 뉴런으로 생체 내 뇌 상주 glia를 변환하는 것입니다. 이것은 외인성 세포 공급원에 대한 필요 없이 뇌 질환에 대한 대체 세포 대체 요법의 개발을 향한 한 걸음을 제공합니다. 또한 세포 운명 스위치를 연구하는 도구를 만듭니다.</p>
<p class="jove_content">뇌는 새로운 뉴런을 생성하기위한 제한된 용량을 가지고. 따라서, 신경 질환에서, 뇌 수리를 위한 외인성 세포 소스의 필요성이 있다. 이를 위해, 세포의 상이한 공급원은 1차 조직, 줄기세포 유래 세포 및 재프로그래밍된 세포로부터의 세포를 포함하여 수년에 걸쳐 강렬한 연구를 거쳤으며 1,<sup class="xref"></sup><sup></sup><sup class="xref">2,</sup><sup></sup><sup class="xref">3.</sup> 뉴런으로 상주 하는 뇌 세포의 직접 리프로그래밍은 뇌 내부의 새로운 뉴런을 생성 하기 위한 환자의 자신의 세포를 사용 하 여 뇌 수리에 대 한 매력적인 방법을 제공할 수 있는 최근 접근. 현재까지, 몇몇 보고는 두뇌에 있는 바이러스성 벡터 납품을<sup class="xref"></sup>통해 생체 내 재프로그래밍에서 보여주었습니다 4, 5,<sup></sup><sup class="xref"></sup><sup></sup><sup class="xref">6,</sup><sup></sup><sup class="xref">7</sup><sup class="xref">8,</sup><sup></sup><sup class="xref">9</sup> 와 같은 다른 두뇌 지구에서 피질, 척수, 줄무늬 및 중뇌 5,<sup class="xref">10</sup><sup class="xref"></sup><sup>,</sup><sup></sup><sup class="xref">11뿐만</sup>아니라 손상되지 않은 병변 뇌 5,<sup class="xref"></sup><sup></sup><sup class="xref"></sup><sup>8,</sup><sup class="xref">11,</sup><sup></sup><sup class="xref">12</sup>. 억제 및 흥분성 뉴런 모두<sup class="xref">4,</sup><sup></sup><sup class="xref">8,</sup>그러나 이들 세포의 정확한 표현형 또는 기능은 아직 상세히 분석되지 않았다.</p>
<p class="jove_content">이 프로토콜에서, 우리는 생체 내 재프로그래밍 된 뉴런의 보다 효율적인 재프로그래밍 및 세포 별 식별을 설명합니다. 우리는 기능성 및 면역 조직 화학적 특성에 기초한 신경 성숙 및 표현형 특성의 기능 평가를 위한 프로토콜을 제공합니다.</p>
<p class="jove_content">우리는 생체 내 재프로그래밍 된 뉴런을 확인하기 위해 Cre-유도성 AAV 벡터와 GFP 리포터를 사용했습니다. 이러한 바이러스 벡터의 선택은 레트로바이러스<sup class="xref">7,</sup><sup></sup><sup class="xref">8의</sup>사용에 대한 대안으로서 뇌의 분할 및 비분할 세포 모두를 감염시키고, 표적 세포의 수를 증가시키는 장점이 있다. 뉴런 특이적 시냅신 구동 FLEX 리포터(GFP)를 통해 새로 생성된 뉴런을 구체적으로 검출할 수 있었습니다. 이전 연구는 생체 내 재프로그래밍<sup class="xref">7,</sup>9에 대한 아류형 특이적 프로모터를 사용했으며, 이는 또한 특정 세포 유형에서 유전자 및 리포터의 재프로그래밍을 허용한다.<sup></sup><sup class="xref"></sup> 그러나, 그 방법은 리포터 및 뉴런 마커의 공동 발현의 사후 분석에 의해 재프로그래밍된 뉴런의 추가 식별을 요구한다. 본 명세서에 기재된 것과 같은 뉴런 특이적 리포터의 사용은, 직접적인 식별을 허용한다. 이는 성공적인 변환에 대한 직접적인 증거를 제공하며 패치 클램프 전기 생리학에 필요한 라이브 세포 식별을 허용합니다.</p>

<table>
	<tbody>
		<tr>
			<td><strong>REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pAAV-CA-FLEX</td>
			<td>AddGene</td>
			<td>38042</td>
			<td></td>
		</tr>
		<tr>
			<td>Ascl1</td>
			<td>AddGene</td>
			<td>67291</td>
			<td>NM_008553.4</td>
		</tr>
		<tr>
			<td>Lmx1a</td>
			<td>AddGene</td>
			<td>33013</td>
			<td>NM_0033652.5</td>
		</tr>
		<tr>
			<td>Nurr1</td>
			<td>AddGene</td>
			<td>35000</td>
			<td>NM_013613.2</td>
		</tr>
		<tr>
			<td>GFP-syn</td>
			<td>AddGene</td>
			<td>30456</td>
			<td></td>
		</tr>
		<tr>
			<td>LoxP (FLEX) sequence 1</td>
			<td></td>
			<td></td>
			<td>GATCTccataacttcgtataaagtatcctatac<br/>gaagttatatcaaaataggaagaccaatgcttc<br/>accatcgacccgaattgccaagcatcaccatcg<br/>acccataacttcgtataatgtatgctatacgaa<br/>gttatactagtcccgggaaggcgaagacgcgga<br/>agaggctctaga</td>
		</tr>
		<tr>
			<td>LoxP (FLEX) sequences 2</td>
			<td></td>
			<td></td>
			<td>tactagtataacttcgtataggatactttatac<br/>gaagttatcattgggattcttcctattttgatc<br/>caagcatcaccatcgaccctctagtccacatct<br/>caccatcgacccataacttcgtatagcatacat<br/>tatacgaagttatgtccctcgaagaggttcgaa<br/>ttcgtttaaacGGTACCCTCGAC</td>
		</tr>
		<tr>
			<td>pDP5</td>
			<td>Plasmid Factory</td>
			<td>PF435</td>
			<td></td>
		</tr>
		<tr>
			<td>pDP6</td>
			<td>Plasmid Factory</td>
			<td>PF436</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate-Buffered Saline (PBS)</td>
			<td>Thermo Fisher Scientific</td>
			<td>10010023</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS (Fetal bovine serum)</td>
			<td>Thermo Fisher Scientific</td>
			<td>10500064</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin streptomycin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM (Dulbecco&#39;s Modified Eagle Medium)+ Glutamax</td>
			<td>Thermo Fisher Scientific</td>
			<td>61965026</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS (Dulbecco&#39;s Phosphate Buffer Saline)</td>
			<td>Thermo Fisher Scientific</td>
			<td>14190094</td>
			<td></td>
		</tr>
		<tr>
			<td>HEK293 cells</td>
			<td>Thermo Fisher Scientific</td>
			<td>85120602-1VL</td>
			<td></td>
		</tr>
		<tr>
			<td>Flasks</td>
			<td>BD Falcon</td>
			<td>10078780</td>
			<td>175 cm2</td>
		</tr>
		<tr>
			<td>Tris H-CL</td>
			<td>Sigma Aldrich</td>
			<td>10812846001</td>
			<td>
			<div>
			<div>For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>EDTA: Invitrogen</td>
			<td>EDTA: AM9260G</td>
			<td>
			<div>
			<div>For TE buffer use 1 mM EDTA</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Ultrapure water</td>
			<td></td>
			<td></td>
			<td>
			<div>
			<div>see Ultrapure water system</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>SigmaAldrich</td>
			<td>C5080</td>
			<td>2.5 M</td>
		</tr>
		<tr>
			<td>Dulbecco&#180;s phosphate-buffered saline (DPBS)</td>
			<td>Thermo Fisher Scientific</td>
			<td>14190136</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma-Aldrich</td>
			<td>S3014</td>
			<td>
			<div>
			<div>FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Sigma-Aldrich</td>
			<td>M8266-100G</td>
			<td>
			<div>
			<div>For lysis Buffer: 1 mM</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Ultracentrifuge sealing tubes</td>
			<td>Beckman Coulter</td>
			<td>Quick-Seal&#174;&#160;Polypropylene Tube</td>
			<td></td>
		</tr>
		<tr>
			<td>OptiPrep&#8482;&#160;Density Gradient Medium</td>
			<td>Sigma Aldrich</td>
			<td>D1556-250ML</td>
			<td></td>
		</tr>
		<tr>
			<td>10-mL syringe-18G needle</td>
			<td>BD</td>
			<td>305064</td>
			<td></td>
		</tr>
		<tr>
			<td>Laboratory glass bottles</td>
			<td>VWR</td>
			<td>?</td>
			<td></td>
		</tr>
		<tr>
			<td>Anion exchange filter</td>
			<td>PALL laboratory</td>
			<td>MSTG25Q6</td>
			<td>
			<div>
			<div>Acrodisc unit with Mustang Q membrane</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Centrifugal filter unit</td>
			<td>Merck</td>
			<td>Z740210-24EA</td>
			<td>
			<div>
			<div>Amicon Ultra-4 device</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Endotoxin-Free Plasmid DNA Isolation Kits</td>
			<td>Thermo Fisher Scientific</td>
			<td>A33073</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2PO4</td>
			<td>Sigma-Aldrich</td>
			<td>S7907</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Sigma-Aldrich</td>
			<td>H7523</td>
			<td>15 mL</td>
		</tr>
		<tr>
			<td>Falcon tube</td>
			<td>Thermo Fisher Scientific</td>
			<td>Corning 352196</td>
			<td></td>
		</tr>
		<tr>
			<td>Falcon tube</td>
			<td>Thermo Fisher Scientific</td>
			<td>Corning 352070</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass Vials</td>
			<td>Novatech</td>
			<td>30209-1232</td>
			<td>
			<div>
			<div>CGGCCTCAGFGAGCGA</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Forward Primer for Inverted Terminal Repeat (ITR) sequence</td>
			<td></td>
			<td></td>
			<td>
			<div>
			<div>GGAACCCCTAGTGATGGAGTT</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Reverse Primer for Inverted Terminal Repeat (ITR) sequence</td>
			<td></td>
			<td></td>
			<td>
			<div>
			<div>CACTCCCTCTCTGCGCGCTCG</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>5&#180;FAM / 3&#180;BHQ1 probe</td>
			<td>Jena Bioscience</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>0.22 mm filter</td>
			<td>Merck</td>
			<td>SLGV004SL</td>
			<td>Millex-GV filter</td>
		</tr>
		<tr>
			<td><strong>EQUIPMENT AAV5 VIRAL VECTOR PREPARATION</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Freezer -20 &#176;C</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Freezer -80 &#176;C</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Fridge +4 &#176;C</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>AAV viral room</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ultrapure Water system</td>
			<td>Merck</td>
			<td>Milli-Q&#174; IQ 7000</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex mixer</td>
			<td>VWR</td>
			<td>444-0004</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultracentrifuge</td>
			<td>Beckman Coulter</td>
			<td>Beckman Optima LE-80K Ultracentrifuge</td>
			<td></td>
		</tr>
		<tr>
			<td>Autoclave</td>
			<td>Tuttnauer</td>
			<td>2540 EL</td>
			<td></td>
		</tr>
		<tr>
			<td>Polymerase Chain Reaction (PCR)</td>
			<td>BioRad</td>
			<td>C1000 Touch Thermal Cycler</td>
			<td></td>
		</tr>
		<tr>
			<td>Quantitative PCR (qPCR)</td>
			<td>Roche</td>
			<td>LightCycler&#174; 480 System</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Thermo Fisher Scientific</td>
			<td>Sorvall ST16</td>
			<td></td>
		</tr>
		<tr>
			<td>Water Bath</td>
			<td>Thermo Fisher Scientific</td>
			<td>TSGP02</td>
			<td></td>
		</tr>
		<tr>
			<td><strong>ANIMAL MODEL</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>NG2-Cre mice</td>
			<td>Jackson</td>
			<td>NG2-CrexB6129, Stock #008533</td>
			<td></td>
		</tr>
		<tr>
			<td><strong>REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Water</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Saline</td>
			<td>Apoteket AB</td>
			<td></td>
			<td>70%</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Solveco</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Isolfurane</td>
			<td>Apoteket AB</td>
			<td></td>
			<td>
			<div>
			<div>Dilute to 1% solution with warm water.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Virkon</td>
			<td>Viroderm</td>
			<td>7511&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Pentobarbital</td>
			<td>Apoteket AB</td>
			<td>P0500000</td>
			<td>
			<div>
			<div>i.p. for terminal procedure at the dose of 60 mg/ml.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>Merck</td>
			<td>S0389-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blu</td>
			<td>Thermo Fisher Scientific</td>
			<td>15250061</td>
			<td></td>
		</tr>
		<tr>
			<td>Retrobeads</td>
			<td>Lumafluor</td>
			<td>R170</td>
			<td></td>
		</tr>
		<tr>
			<td>Buprenorphine</td>
			<td>Apoteket AB</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td><strong>EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN</strong></td>
			<td></td>
			<td></td>
			<td>
			<div>
			<div>From RSG Solingen.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Scissors</td>
			<td>VWR</td>
			<td>233-1552</td>
			<td>From Biochem.</td>
		</tr>
		<tr>
			<td>Tweezers</td>
			<td>VWR</td>
			<td>232-0007</td>
			<td></td>
		</tr>
		<tr>
			<td>Forcep</td>
			<td>VWR</td>
			<td>232-0120</td>
			<td></td>
		</tr>
		<tr>
			<td>Scalpel holder</td>
			<td>VWR</td>
			<td>RSGA106.621</td>
			<td>Number 20.</td>
		</tr>
		<tr>
			<td>Scalpel</td>
			<td>VWR</td>
			<td>RSGA106.200</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereotaxic frame</td>
			<td>Stoelting Europe</td>
			<td>51500D</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse ear bars</td>
			<td>Stoelting Europe</td>
			<td>51648</td>
			<td>5 ul</td>
		</tr>
		<tr>
			<td>Syringe with Removable needle</td>
			<td>Hamilton Company</td>
			<td>65</td>
			<td>
			<div>
			<div>0,75 inner diameter and 1.5 outer diameter.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Glass capilaries</td>
			<td>Stoelting</td>
			<td>50811</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass capillary puller</td>
			<td>Sutter company</td>
			<td>P-1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Dental drill</td>
			<td>Agnthos AB</td>
			<td>1464</td>
			<td></td>
		</tr>
		<tr>
			<td>Shaver</td>
			<td>Agnthos AB</td>
			<td>GT420</td>
			<td></td>
		</tr>
		<tr>
			<td>Isoflurane Chamber and pump</td>
			<td>Agnthos AB</td>
			<td>8323101</td>
			<td>2 mL</td>
		</tr>
		<tr>
			<td>Syringes</td>
			<td>Merck</td>
			<td>Z118400-30EA</td>
			<td>25G</td>
		</tr>
		<tr>
			<td>Needles</td>
			<td>Merck</td>
			<td>Z192414&#160;Aldrich</td>
			<td></td>
		</tr>
		<tr>
			<td>Mouse and neonatal rat adaptor for stereotaxic fram</td>
			<td>Stoelting</td>
			<td>51625</td>
			<td></td>
		</tr>
		<tr>
			<td>Heating pad</td>
			<td>Braintree scientific, inc</td>
			<td>53800M</td>
			<td>
			<div>
			<div>From Covidien 2187.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Cotton gauze</td>
			<td>Fisher Scientific</td>
			<td>22-037-902</td>
			<td></td>
		</tr>
		<tr>
			<td>Rubber tube</td>
			<td>Elfa Distrelec</td>
			<td>HFT-A-9.5/4.8 PO-X BK 150</td>
			<td></td>
		</tr>
		<tr>
			<td>Cotton swabs</td>
			<td>Fisher Scientific</td>
			<td>18-366-473</td>
			<td></td>
		</tr>
		<tr>
			<td><strong>REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Sigma-Aldrich</td>
			<td>P9333</td>
			<td></td>
		</tr>
		<tr>
			<td>NaH<sub>2</sub>PO<sub>4</sub>-H<sub>2</sub>O</td>
			<td>Sigma-Aldrich</td>
			<td>S9638</td>
			<td></td>
		</tr>
		<tr>
			<td>MgCl<sub>2</sub>-6 H<sub>2</sub>O</td>
			<td>Sigma-Aldrich</td>
			<td>M2670</td>
			<td></td>
		</tr>
		<tr>
			<td>CaCl<sub>2</sub>-6 H<sub>2</sub>O</td>
			<td>Sigma-Aldrich</td>
			<td>C8106</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4-7 H<sub>2</sub>O</td>
			<td>Sigma-Aldrich</td>
			<td>230391</td>
			<td></td>
		</tr>
		<tr>
			<td>NaHCO<sub>3</sub></td>
			<td>Sigma-Aldrich</td>
			<td>S5761</td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Sigma-Aldrich</td>
			<td>G7021</td>
			<td>
			<div>
			<div>see Ultrapure Water system</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Ultrapure Water</td>
			<td></td>
			<td></td>
			<td>Prepare 1 or 2M.</td>
		</tr>
		<tr>
			<td>KOH</td>
			<td>Sigma-Aldrich</td>
			<td>P5958-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>K-D-gluconate</td>
			<td>Sigma-Aldrich</td>
			<td>G4500&#160;Sigma</td>
			<td></td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Sigma-Aldrich</td>
			<td>P9541</td>
			<td></td>
		</tr>
		<tr>
			<td>KOH-EGTA (Etilene glycol-bis-N-tetracetic acid)</td>
			<td>Sigma-Aldrich</td>
			<td>E3889&#160;Sigma</td>
			<td></td>
		</tr>
		<tr>
			<td>KOH- Hepes acid (N-2-hydroxyethylpiperazine-N&#8217;-2-ethanesulfonic acid)</td>
			<td>Sigma-Aldrich</td>
			<td>H7523</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr>
			<td>Mg2ATP</td>
			<td>Sigma-Aldrich</td>
			<td>A9187</td>
			<td></td>
		</tr>
		<tr>
			<td>Na3GTP</td>
			<td>Sigma-Aldrich</td>
			<td>G8877</td>
			<td></td>
		</tr>
		<tr>
			<td>Biocytin</td>
			<td>Sigma-Aldrich</td>
			<td>B4261</td>
			<td></td>
		</tr>
		<tr>
			<td>Picrotoxin</td>
			<td>Merck</td>
			<td>P1675&#160;Sigma</td>
			<td></td>
		</tr>
		<tr>
			<td>CNQX</td>
			<td>Merck</td>
			<td>C239&#160;Sigma</td>
			<td></td>
		</tr>
		<tr>
			<td>Ice</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td><strong>EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Borosilicate glass pipette</td>
			<td>Sutter Company</td>
			<td>B150-86-10</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass capillary puller</td>
			<td>Sutter company</td>
			<td>P-1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Vibratome</td>
			<td>Leica</td>
			<td>Leica VT1000 S</td>
			<td></td>
		</tr>
		<tr>
			<td>WaterBath</td>
			<td>Thermo Fisher Scientific</td>
			<td>TSGP02</td>
			<td></td>
		</tr>
		<tr>
			<td>Clampfit software</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Multiclamp software</td>
			<td>Molecular Devices</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td><strong>REAGENTS FOR IMMUNOHISTOCHEMISTRY</strong></td>
			<td></td>
			<td></td>
			<td>
			<div>
			<div>Use at a concentration of 4%.&#160;CAUTION:&#160;PFA is a potent fixative. Avoid ingestion and contact with skin.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Paraformaldehyde (PFA)</td>
			<td>Merck Millipore</td>
			<td>1040051000</td>
			<td>
			<div>
			<div>Use at a concentration of 0.1%.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Fisher Scientific</td>
			<td>10254640</td>
			<td>
			<div>
			<div>Donkey.Use at a concentration of 1 : 400.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>Serum</td>
			<td>Merck Millipore</td>
			<td>S30-100ML</td>
			<td>
			<div>
			<div>Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20&#176;C,&#160;light sensitive. Use at a concentration of 1 : 500.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>4&#8242;,6-Diamidino-2&#8242;-phenylindole dihydrochloride (DAPI)</td>
			<td>Sigma Aldrich</td>
			<td>D9542</td>
			<td>
			<div>
			<div>1: 600 in KPBS-T.</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>streptavidin- Cy3</td>
			<td>Thermo Fisher Scientific</td>
			<td>434315</td>
			<td>1:5000, rabbit.</td>
		</tr>
		<tr>
			<td>Anti-GAD65/67</td>
			<td>Abcam</td>
			<td></td>
			<td>1:2000, mouse.</td>
		</tr>
		<tr>
			<td>Anti-PV</td>
			<td>Sigma</td>
			<td>P3088</td>
			<td>1:200, goat.</td>
		</tr>
		<tr>
			<td>Anti-Chat</td>
			<td>Merk</td>
			<td>AB143</td>
			<td>1:5000, rabbit.</td>
		</tr>
		<tr>
			<td>Anti-NPY</td>
			<td>Immunostar</td>
			<td>22940</td>
			<td></td>
		</tr>
		<tr>
			<td>K<sub>2</sub>HPO<sub>4</sub></td>
			<td>Sigma-Aldrich</td>
			<td>P3786</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr>
			<td>KH<sub>2</sub>PO<sub>4</sub></td>
			<td>Sigma-Aldrich</td>
			<td>NIST200B</td>
			<td>1:1000, chicken.</td>
		</tr>
		<tr>
			<td>Anti-GFP</td>
			<td>Abcam</td>
			<td>ab13970</td>
			<td></td>
		</tr>
		<tr>
			<td>Mounting solution</td>
			<td>Merck</td>
			<td>10981</td>
			<td>
			<div>
			<div>Polyvinyl alcohol mounting medium with DABCO&#174;, antifading</div>
			</div>
			</td>
		</tr>
		<tr>
			<td>OCT</td>
			<td>Agar Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Sigma-Aldrich</td>
			<td>G9012-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Distilled water</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-freeze solution</td>
			<td>Tissue Pro Technology</td>
			<td>AFS05-1000N, 1000 mL/ea.</td>
			<td></td>
		</tr>
		<tr>
			<td><strong>EQUIPMENT FOR IMMUNOHISTOCHEMISTRY</strong></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Inverted fluorescence microscope</td>
			<td>Leica</td>
			<td>DMI6000 B</td>
			<td></td>
		</tr>
		<tr>
			<td>Confocal microscope</td>
			<td>Leica</td>
			<td>TCS SP8 laser scanning confocal microscope.</td>
			<td></td>
		</tr>
		<tr>
			<td>Prism</td>
			<td>GraphPad</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microtome</td>
			<td>Leica</td>
			<td>SM2010R</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo direct reprogramming of resident glial cells into interneurons by intracerebral injection of viral vectors

<p class="jove_content">생체 내에서 뇌의 상주 신경교를 기능및 아류형 특이적 뉴런으로 변환하는 것은 대체 세포 대체 요법의 개발을 향한 한 걸음을 내딛는 동시에 구내에서 세포 운명을 연구하는 도구를 만듭니다. 현재까지 생체 내 재프로그래밍을 통해 뉴런을 얻을 수 있었지만, 이러한 뉴런의 정확한 표현형이나 성숙 하는 방법은 자세히 분석되지 않았습니다. 이 프로토콜에서, 우리는 AAV 기반 바이러스 벡터 시스템을 사용하여 생체 내 재프로그래밍 된 뉴런의 보다 효율적인 변환 및 세포 별 식별을 설명합니다. 우리는 또한 재프로그래밍된 세포의 신경 성숙에 대한 기능적 평가를 위한 프로토콜을 제공한다. 플립-절제(FLEX) 벡터를 주입함으로써, 세포 리프로그래밍의 표적역할을 하는 뇌의 특정 세포 유형에 리프로그래밍 및 시냅신 구동 리포터 유전자를 함유한다. 이 기술은 새로 프로그래밍 된 뉴런의 쉬운 식별을 할 수 있습니다. 결과는 수득된 재프로그래밍된 뉴런이 시간이 지남에 따라 기능적으로 성숙하고, 시냅스 접촉을 받고, 다른 유형의 인터뉴런의 전기 생리학적 특성을 보여준다는 것을 보여준다. 전사 인자 Ascl1, Lmx1a 및 Nurr1을 사용하여, 재프로그래밍된 세포의 대다수는 빠른 스파이크, 파르브알부민 함유 인터뉴런의 특성을 갖는다.</p>

<p class="jove_content" fo:keep-together.within-page="1">AAV 벡터의 주사는 NG2-Cre 마우스 줄무늬(도<strong class="xfig">1A)에서</strong>뉴런으로 상주하는 NG2 글리아 세포를 성공적으로 재프로그래밍하는 데 사용된다. 구체적으로 NG2 glia를 표적으로 하기 위해, 리프로그래밍/리포터 유전자를 가진 FLEX 벡터는 안티센스 방향으로 삽입되고 두 쌍의 안티병렬,<strong class="xfig"></strong>이종 성 loxP 부위에 의해 측면에 삽입된다(그림 1B). 3개의 재프로그래밍 유전자(Ascl1, Lmx1a 및 Nurr1)는 각각 의 개별 벡터에 대한 유비쿼터스 cba 프로모터의 제어 하에 배치된다. GFP 발현이 Cre 발현 세포로부터 유래된 재프로그래밍된 뉴런으로 제한되도록 하기 위해, GFP는 뉴런 특이적 시냅신 프로모터의 제어하에 배치된다(또한 FLEX 벡터에서).</p>
<p class="jove_content" fo:keep-together.within-page="1">리프로그래밍 및 리포터 구문의 조합의 사용은 마우스 줄무늬에서 GFP 양성 뉴런의 생성을 허용한다(도<strong class="xfig">1C,</strong><strong>C').</strong> 재프로그래밍 유전자의 존재 없이 리포터 구조의 사용은 GFP 양성 뉴런을 생성하지 않는다(도<strong class="xfig">1D).</strong></p>
<p class="jove_content" fo:keep-together.within-page="1">바이오시틴이 채워진 재프로그래밍된 뉴런은 사후 면역 염색 후 볼 수<strong class="xfig"></strong>있다(도 2A). 변환이 성공하면 광범위한 신경 형태가 있어야합니다. 재프로그래밍된 뉴런의 전기생리학적 기록은 자발적인 활성 측정을 가진 후발성 기능적 연결의 존재를 보여준다(도<strong class="xfig">2B,</strong><strong></strong>C). 이 ionotropic GABAergic 또는 글루타마테르지 차단제와 함께 차단 될 수 있습니다 (Picrotoxin 또는 CNQX), 다시 프로그래밍 된 뉴런에 흥분 성 및 억제 시 냅 스 입력을 제안. 자발적인 활동의 발생은 시간 후<strong class="xfig"></strong>바이러스 주사 (그림 2D)와 함께 증가하여 점진적 인 성숙을 나타냅니다.</p>
<p class="jove_content" fo:keep-together.within-page="1">전류 유도된 활동 전위는 기능적인 뉴런에서 존재합니다. 변환 후 시간이 지남에 따라 작업<strong class="xfig"></strong>전위가 증가합니다(그림 2E). 이것은 또한 신경 기능의 성숙을 나타냅니다. 미성숙한 뉴런에서, 전류는 없음 또는 극소수의<strong class="xfig"></strong>작용 전위를 유도한다(도 2F).</p>
<p class="jove_content" fo:keep-together.within-page="1">뉴런의 발사 패턴은 세포의 형태와 채널 발현(15)과 같은<sup class="xref"></sup>인자에 의존하기 때문에 세포 유형별이다. 생체 내 재프로그래밍된 뉴런에서 기록된 패턴은 내인성 뉴런 아류형과 비교하여, 예를 들어 빠른 스파이크 인터뉴런(Cell Type B, <strong class="xfig">도 3B)</strong>또는 다른 세포 유형(그림<strong class="xfig">3A,</strong><strong>C, D) </strong>). 관찰된 전기생리학적 차이는 GFP와의 특정 아류형 마커 및 공동 발현의 존재에 의해 확인될 수 있다(도 3E-H).<strong class="xfig"></strong><strong></strong> 전부, 이 데이터는 줄무늬에 존재하는 재프로그래밍된 뉴런이 Parvalbumin-, ChAt- 및 NPY-발현과 같은 다른 유형의 인터뉴런의 특성을 가지고 있음을 나타내며, 줄무늬 배지 가시 뉴런 정체성(DARPP32+) <strong class="xfig">그림 3E</strong> <strong>-H)를</strong>참조하십시오.</p>
<p class="jove_content" fo:keep-together.within-page="1"><img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59465/59465fig1.jpg"><br><strong>그림 1: 상주 NG2 글리아의 생체 내 재프로그래밍을 뉴런으로.</strong> (A) AAV 바이러스-줄무늬 NG2 글리아의 생체 내 재프로그래밍에서 매개된 회로도 표현.<strong></strong> (b) 생체 내 재프로그래밍에 사용되는 AAV5 FLEX 구조체의 개략적 표현은 표적 세포에서 의 유전자 발현에 의해 유전자 발현이 조절된다.<strong></strong> <strong>(C</strong> 및 <strong>C')</strong>생체 내에서 신경세포를 다시 프로그래밍하여, 신-GFP + ALN 주사를 줄무늬로 주입하였다. (D) 바이러스 성 칵테일에 재프로그래밍 요인이 첨가되지 않은 경우 재프로그래밍 된 뉴런의 부재, 오직 리포터 구성만이 생체 내에서 주입된다.<strong></strong> 축척 막대 = 100mm(C), 25mm(C'), 25mm(D). <a href="https://www.jove.com/files/ftp_upload/59465/59465fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a></p>
<p class="jove_content" fo:keep-together.within-page="1"><img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59465/59465fig2.jpg"><br><strong>그림 2: 생체 내 재프로그래밍된 뉴런은 기능적이며 시간이 지남에 따라 성숙을 보여준다.</strong> (A) 바이오시틴이 채워진 재프로그래밍 된 뉴런은 수지상 척추를 포함하는 성숙한 신경 형태를 나타낸다.<strong></strong> 트레이스는 (B) 억제 (GABAergic) 활성은 PICrotoxin으로 차단되는 활성, GABA<sub>A</sub> 수용체 길항제 및 (C) CNQX, AMPA 수용체 길항제로 차단되는 흥분성 활성.<strong></strong><strong></strong> (D) 후시냅스 활동이 있는 뉴런의 수는 시간이 지남에 따라 증가합니다.<strong></strong> (E) 패치 된 뉴런은 이미 5 주 후 주입 후 (w.p.i.)에서 반복적 인 발사를 보여주고 8 및 12 w.p.i. (F) 미성숙 뉴런의 현재 유도 된 행동 전위 및 후발성 활성을 보여 줄 수 있으며, 시냅스 (saptic)는 거의 시냅스를 보이지 않습니다.<strong></strong><strong></strong> 이벤트 및 B 및 D. 규모 막대 = 25mm에 비해 몇 가지 작업 잠재력이 <a href="https://www.jove.com/files/ftp_upload/59465/59465fig2large.jpg" target="_blank">그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a></p>
<p class="jove_content" fo:keep-together.within-page="1"><img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59465/59465fig3v2.jpg"><br><strong>그림 3: 생체 내 재프로그래밍된 뉴런은 줄무성 인터뉴런의 면역조직화학적 및 전기생리학적 특성을 보여준다.</strong> <strong>(A-D)</strong> 생체 내 재프로그래밍 된 뉴런의 발사 패턴은 뚜렷한 유형일 수 있습니다: (A) 유형 A는 내인성 배지 가시 뉴런 (DARPP32+)과 유사합니다;<strong></strong> (B) 빠른 스파이크와 유사 (PV +) 인터 뉴런;<strong></strong> (C) 눈에 띄는 처짐 (NPY+)와 낮은 임계 값 스파이크 뉴런과 유사;<strong></strong> (D) 큰 과분극 (채팅 +)로 발사 뉴런.<strong></strong> <strong>(E-H)</strong> GFP 및 인터뉴런 마커 PV(E), ChAT(F), NPY(G), 및<strong></strong>프로젝션 뉴런 마커 DARPP32(H)의 공동 국소화를 나타내는 공초점 이미지.<strong></strong><strong></strong><strong></strong> 모든 축척 막대 = 50mm. <a href="https://www.jove.com/files/ftp_upload/59465/59465fig3v2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a></p>

Watch this Scientific Journal Video about In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors at JoVE.com

In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors

바이러스 벡터의 intracerebral 주입에 의해 인터뉴런으로 상주 신경교 세포의 생체 내 직접 재프로그래밍

<p class="jove_content">이 프로토콜은 생체 내에서 직접 다시 프로그래밍 된 인터뉴런을 생성하는 것을 목표로, 뇌의 AAV 기반 바이러스 시스템과 생체 내에서 세포 식별 및 추가 분석을 허용하는 FLEX 시냅신 구동 GFP 리포터를 사용하여.</p>

Converting resident glia in the brain into functional and subtype-specific neurons in vivo provides a step forward towards the development of alternative ...

<p>이 프로토콜은 상주 신경교에서 두뇌에 직접 새로운 뉴런을 생성할 수 있고 이 재프로그래밍된 세포가 하위 형 특정 뉴런으로 성숙한다는 것을 보여줍니다. 주요 장점은 NG2-glia와 분석을 위해 다시 프로그래밍된 뉴런에 라벨을 붙이는 GFP 리포터의 특정 타겟팅을 가능하게 하는 cre-의존하는 AAV 바이러스입니다. 두뇌에 있는 새로운 뉴런을 생성하는 것은 두뇌에 있는 세포 보충 치료를 위한 미래 발달로 이끌어 낼 수 있습니다.</p><p>우리의 프로토콜에서 우리는 정신 장애에 대한 의미가 parv알부민 양성 인터뉴런을 생성합니다. 생체 내에서 리프로그래밍은 어떤 신경 표현형 및 당신이 표적으로 하고 싶은 신경 조건에 따라서 그밖 두뇌 영역 및 회로에 적용될 수 있습니다. 절차를 시연하는 것은 제니 요한슨입니다 : 기술자, 마리아 페레이라 : 전 박사 과정 학생, 마르첼라 Birtele : 우리의 실험실에서 박사 과정 학생.</p><p>AAV5 바이러스 벡터를 생성하기 위해 5개의 T175 플라스크에서 표준 배양 배지를 가진 시드 HEK293T 세포. 세포가 50 ~ 70 %의 합류에 도달하면 변환을 위해 다음 혼합을 준비하십시오. 50 밀리리터 원심분리기 튜브에서 동일한 양의 벡터 플라스미드와 pDG 시리즈 도우미 플라스미드를 추가합니다.</p><p>Tris-EDTA 버퍼를 144 마이크로리터의 최종 부피에 추가한 다음 초순수 수를 추가하여 총 1296마이크로리터를 혼합합니다. 다음으로, 2.5 어금다 칼슘 염화칼슘의 144 마이크로리터를 추가하고 혼합합니다. 그 후, DNA 용액과 소용돌이에 즉시 HBS의 1.92 밀리리터를 추가합니다.</p><p>정확히 60 초 동안 실온에서 배양. 이어서, 용액을 신선한 세포 배양 배지의 28 밀리리터로 이송하고 혼합한다. 플라스크의 배지를 트랜스빙 믹스를 포함하는 매체로 바꿉다.</p><p>3 일 동안 기다렸다가 미디어를 낭비로 옮기. 각 플라스크에 5밀리리터의 수확 버퍼를 추가한 다음 각 플라스크에 4밀리리터의 DPBS를 추가하여 나머지 셀과 풀을 셀 용액으로 헹구세요. 수확한 세포를 섭씨 4도에서 5분간 1, 000 x g에서 원심분리합니다.</p><p>원심 분리 후, 상체를 제거하고 용해 버퍼의 15 밀리리터에 펠릿을 용해. 50 밀리리터 원심분리기 튜브를 드라이 아이스에 15분간 얼리고 섭씨 영하 20도에 보관하십시오. 사용하기 전에 수확한 셀을 섭씨 37도에서 수조에 담근 해동하십시오.</p><p>이 절차에서는 iodixanol 그라데이션 극심분리에 의한 AAV 정화를 수행하고 실온에서 1시간 45분 동안 350, 000 x g의 원심분리가 있는 초원심분리기 천장 튜브를 사용합니다. AAV 함유 위상을 추출하려면 10 밀리리터 주사기를 18 게이지 바늘로 삽입하여 40 내지 60%의 위상 테두리 아래 약 2밀리미터에서 배꼽을 위쪽으로 향하고 철회한다. 바이러스 벡터의 5 ~6 밀리리터가 추출 된 후 단백질 밴드에 도달하기 전에 중지해야합니다.</p><p>이어서, 희석된 이오디산올 그라데이션을 애니메이션 교환 필터를 통해 정화하고 농축하여 초당 1방울 이하로 빠르게 밀어내지 않는다. 그 후 필터를 통해 IE 버퍼 3밀리리터를 천천히 밀어 씻어내도록 합니다. 다음으로, 용출 버퍼의 1 ~ 2 밀리리터와 원심 필터 단위로 혼합물을 엘테.</p><p>장치에 DPBS를 추가하여 4밀리리터의 최종 볼륨에 추가합니다. DPBS의 0.5 밀리리터 미만이 필터에 남아있을 때까지 실온에서 2, 000 x g의 원심분리기. 그 후, 튜브의 바닥에서 액체를 제거하고 DPBS의 4 밀리리터로 리필하고 원심분리기를 다시 작성합니다.</p><p>이 단계를 두 번 더 반복하면 필터에 집중된 벡터의 부피가 마지막 원심 분리 후 약 200 마이크로리터인지 확인합니다. 파이펫을 사용하여 200 마이크로리터 농축 벡터를 제거하고 0.22 마이크로미터 필터를 통해 눌러 멸균합니다. 다음으로, aliquot 200 마이크로 리터는 연동 된 삽입 유리 유리 바이알에.</p><p>재프로그래밍 요인을 주입하려면 스테레오탁스 프레임에 마취된 마우스를 배치합니다. 수술 초기에 적절한 진통을 투여한 다음 브레그마 바로 위에 주사 바늘의 유리 모세관 끝을 가져옵니다. 모세관 팁이 A-P 와 M-L 평면 모두에서 완벽하게 직선인지 확인하십시오.</p><p>디지털 좌표 카운터에서 M-L 및 A-P 값을 모두 0.0으로 재설정합니다. 동물의 머리가 완벽하게 평평한 위치에 있는지 확인하려면 디지털 좌표 카운터를 사용하여 A-P 암이 2.0 및 마이너스 2.0에 있을 때와 M-L 암이 2.0 및 마이너스 2.0에 있을 때 D-V 좌표 값을 측정합니다. 치아 막대와 이어 바의 높이를 그에 따라 조정합니다.</p><p>그 후 주사기를 약간 올리고 주사 좌표에서 치과 드릴을 사용하여 구멍을 뚫습니다. 현장에서 드릴을 시작하여 원형과 부드러운 방식으로 작업합니다. 그런 다음, 열린 절개 위에 면 거즈 조각을 놓고 식염수 용액으로 주사기를 플러시하십시오.</p><p>플러싱 후, 바이러스 벡터를 포함하는 용액의 기포와 다음 하나의 마이크로 리터를 그립니다. 바이러스 성 솔루션이 기포 아래에 쉽게 시각화 될 수 있는지 확인하십시오. 다음으로 주사기를 낮추고 원하는 깊이로 천천히 진행하며 궤적이 뼈 조각이 명확하지 않은지 확인합니다.</p><p>그 후, 분당 0.4 마이크로리터의 속도로 바이러스 용액의 마이크로리터 1개를 주입한다. 주사가 완료되면 주사기 가출되기 전에 2 분 동안 확산을 허용하십시오. 확산 후, 모세관의 끝이 뇌에서 완전히 철회 될 때까지 주사기를 천천히 철회 한 다음 절개를 조심스럽게 봉합하고 스테레오 테틱 프레임에서 동물을 제거합니다.</p><p>의식이 회복 될 때까지 수술 후 역에서 동물을 모니터링합니다. 동물은 최대 보관 12 성숙한 뉴런으로 재프로그래밍 하는 주민 glia 를 허용 하기 위해 바이러스 주입 후 주. 진동을 사용하여 전기 생리학에 대한 뇌 조각을 준비하기 위해, 가장 장밋빛 부분에서 고속으로 줄무늬 수준으로 뇌를 섹션.</p><p>그런 다음 striatum을 초당 0.1 밀리미터에서 275 마이크로미터로 관상으로 단면합니다. 각 섹션 후, 신중하게 비 주입 된 striatal 측면을 제거하고 실온에서 수조에 바닥 그물과 산소 CREB 감각 슬라이드와 유리병으로 주입 측을 전송합니다. 모든 섹션이 절단 될 때까지 실온에서 유리병을 유지합니다.</p><p>그 후, 천천히 수조의 온도를 섭씨 37도로 높이고 30 분 동안 방치 한 다음 히터를 끄고 실온으로 식힙니다. 전기 생리학을 위한 기록 챔버에 1개의 조직 단면을 전송한 후에, 기록 전극에 유리 파이펫을 장착하고 용액으로 낮춥니까. 전극의 저항을 다시 확인합니다.</p><p>그런 다음, 파이펫으로 리프로그래밍된 셀에 천천히 접근하여 전극에 약간의 양압을 유지하여 팁을 연결하지 않도록 하고, 패치 전에 세포가 GFP 양성지있는지 확인합니다. 세포가 패치되면 현재 클램프의 셀을 마이너스 60에서 마이너스 70 밀리볼트로 유지하고, 마이너스 20에서 90 피코아페레스까지 500밀리초 전류를 주입하여 10개의 피코팜페레이 증분을 사용하여 작용 잠재력을 유도한다. 이것은 신경 성숙과 성공적인 재프로그래밍을 나타냅니다.</p><p>그 후, 전압 클램프로 전환하고 10 밀리볼트의 탈극 단계에서 내측 나트륨 및 지연 된 정류 칼륨 전류를 측정합니다. 여기에 성숙한 신경 형태와 수지상 척추를 보여주는 재 프로그래밍 된 뉴런을 기록 한 게시물기록입니다. 여기서, 리프로그래밍된 뉴런의 전기생리학적 기록은 자발적인 활동 측정을 가진 포스트냅스 기능적 연결의 존재를 보여준다.</p><p>추적은 피크로톡신으로 막힌 억제 활성을 보여 주며, GABAA 수용체 길항제 및 AMPA 수용체 길항제인 CNQX로 막힌 흥분 작용활동을 보여줍니다. 패치 된 뉴런은 이미 5 주 후 주사 후 포스트 냅 스 활동을 표시, 그리고 에서 계속 8 그리고 12 주 후 주입. 현재 유도 된 작용 잠재력을 가진 뉴런의 수는 또한 시간이 지남에 따라 증가합니다.</p><p>더 상세한 분석은 세포의 대다수가 parvalbumin interneurons와 유사한 빠른 스파이크 활동을 보여주는 몇몇 명백한 발사 패턴을 제시했습니다. 12주 에서 면역화성 분석은 기자 GFP와 파르살알린의 공동 발현을 보여주었다. 이 절차에 따라 패치 추구 기술로 유전자 발현을 검사하거나 단신분석 추적 및 iDISCO를 통한 3차원 시냅스 연결을 평가할 수 있습니다.</p><p>이제 상주 신경교를 인터뉴런을 표현하는 parvalbumin으로 재프로그래밍할 수 있게 되었으므로, 우리는 이들이 정통인지, 치료 도구로 사용될 수 있는지 조사하기 시작했습니다. 동물을 취급하고 AAV 바이러스를 사용할 때 확립된 프로토콜 및 지침을 따르는 것을 기억하십시오.</p>

Research

JoVE Journal

Neuroscience

Intracranial Injection of Adeno-associated Viral Vectors

Adeno - 관련 바이러스성 벡터의 Intracranial 분사

Intracranial injection of viral vectors engineered to express a fluorescent protein is a versatile labeling technique for visualization of specific ...

연구

신경과학

Autologous Blood Injection to Model Spontaneous Intracerebral Hemorrhage in Mice

마우스에서 자연 했습니다만 출혈을 모델로 Autologous 혈액 주입

Investigation of the pathophysiology of injury after intracerebral
hemorrhage (ICH) requires a reproducible animal model.  While ICH
accounts for 10-15% ...

Transfection of Mouse Retinal Ganglion Cells by <em>in vivo</em> Electroporation

Transfection of Mouse Retinal Ganglion Cells by in vivo Electroporation

마우스 망막 신경절 세포 Transfection로<em> 생체내에</em> Electroporation

The targeting and refinement of RGC projections to the midbrain is a popular and powerful model system for studying how precise patterns of neural ...

Expansion of Embryonic and Adult Neural Stem Cells by <em>In Utero</em> Electroporation or Viral Stereotaxic Injection

Expansion of Embryonic and Adult Neural Stem Cells by In Utero Electroporation or Viral Stereotaxic Injection

의 배아와 성인 신경 줄기 세포의 확장<em&gt; 자궁에</em&gt; Electroporation 또는 바이러스 성 Stereotaxic 주입

Somatic stem cells can divide to generate additional stem cells (expansion) or more differentiated cell types (differentiation), which is fundamental for ...

Lineage-reprogramming of Pericyte-derived Cells of the Adult Human Brain into Induced Neurons

유도 된 신경 세포로 성숙한 인간 두뇌의 혈관 주위 세포에서 파생 된 세포의 리니지 - 프로그래밍

Direct lineage-reprogramming of non-neuronal cells into induced neurons (iNs) may provide insights into the molecular mechanisms underlying neurogenesis ...

Inducing Plasticity of Astrocytic Receptors by Manipulation of Neuronal Firing Rates

신경 발사 환율의 조작에 의해 성상 세포 수용체의 가소성을 유도

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be ...

Limbal Approach-Subretinal Injection of Viral Vectors for Gene Therapy in Mice Retinal Pigment Epithelium

마우스 망막 색소 상피의 유전자 치료에 대한 바이러스 벡터의 윤부 접근 - 망막 주입

The eye is a small and enclosed organ which makes it an ideal target for gene therapy. Recently various strategies have been applied to gene therapy in ...

Intracerebroventricular and Intravascular Injection of Viral Particles and Fluorescent Microbeads into the Neonatal Brain

신생아 뇌에 바이러스 성 입자와 형광 마이크로 비즈의 뇌실과 혈관 내 주입

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the ...

Cannula Implantation into the Cisterna Magna of Rodents

설치류의 시스테 마그나에 정 맥 주입

Cisterna magna cannulation (CMc) is a straightforward procedure that enables direct access to the cerebrospinal fluid (CSF) without operative damage to ...

Rat Model of Widespread Cerebral Cortical Demyelination Induced by an Intracerebral Injection of Pro-Inflammatory Cytokines

프로 염증 성 사이토카인의 인트레이스렐 주입에 의해 유도된 광범위한 대뇌 피질 탈량의 쥐 모델

Multiple sclerosis (MS) is the most common immune-mediated disease of the central nervous system (CNS) and progressively leads to physical disability and ...