Name: preparation and application of a new bacterial biosensor for the presumptive detection of gunshot residue
Uploaded: 2019-05-09T14:45:00
Description: Watch this Scientific Journal Video about Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue at JoVE.com

저자는 BIOL 324 (유전학)의 롱 우드 대학에서 학생 들과 화학 403 안티 몬 및 리드 바이오 센서의 초기 준비 및 테스트에 관여 한 (고급 화학 실험실 문제 해결) 학생 들을 인정 하고자 합니다. MicRoboCop에 대 한 아이디어는 GCAT SynBIO 워크샵 (여름 2014)에서 잉태 되었으며,이는 NSF와 하 워드 휴즈 메디컬 인스티튜트가 자금을 지원 하며 메릴랜드 대학교에서 주최 합니다. 저자는 또한 롱 우드 대학의 요리사-콜 예술과 과학의 대학과 GCAT SynBio 동창 보조금에서 받은 자금을 인정 합니다.

참고: RFP를 발현 하는 대장균 의 합성이 제시 된다.
1. 대장균 에서 플라스 미드 DNA의 제조
<ol><li>Rfp 유전자와 암 피 실린 저항성 유전자를 갖는 플라스 미드를 포함 하는 대장균을 해 동 하 고, µ를 함유 100 하는 luria 브로스 (LB) 한 천 판에 대장균을 37 ° c에서 24 시간 동안 성장 시켰다. 예를 들어, 합성 생물학에 사용 되는 표준 생물학적 부품의 레지스트리에서 J1...

<ol>
	<li>Eschner, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#34;The+Story+of+the+Real+Canary+in+the+Coal+Mine.&#34;.">&#34;The Story of the Real Canary in the Coal Mine.&#34;.</a> The Smithsonian Magazine. , (2016).</li><li>Roda, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+in+chemical+luminescence-based+biosensors:+A+critical+review.">Progress in chemical luminescence-based biosensors: A critical review.</a> Biosensors &#38; Bioelectronics. 76, 164-179 (2016).</li><li>He, W., Yuan, S., Zhong, W. H., Siddikee, M. A., Dai, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+genetically+engineered+microbial+whole-cell+biosensors+for+combined+chemosensing.">Application of genetically engineered microbial whole-cell biosensors for combined chemosensing.</a> Applied Microbiology and Biotechnology. 100 (3), 1109-1119 (2016).</li><li>Dalby, O., Butler, D., Birkett, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Gunshot+Residue+and+Associated+Materials-A+Review.">Analysis of Gunshot Residue and Associated Materials-A Review.</a> Journal of Forensic Sciences. 55 (4), 924-943 (2010).</li><li>Bell, S., Seitzinger, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+binary+presumptive+assays+to+probabilistic+assessments:+Differentiation+of+shooters+from+non-shooters+using+IMS,+OGSR,+neural+networks,+and+likelihood+ratios.">From binary presumptive assays to probabilistic assessments: Differentiation of shooters from non-shooters using IMS, OGSR, neural networks, and likelihood ratios.</a> Forensic Science International. 263, 176-185 (2016).</li><li>O&#39;Mahony, A. M., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrochemical+Detection+of+Gunshot+Residue+for+Forensic+Analysis:+A+Review.">Electrochemical Detection of Gunshot Residue for Forensic Analysis: A Review.</a> Electroanalysis. 25 (6), 1341-1358 (2013).</li><li>Vigneshvar, S., Sudhakumari, C. C., Senthilkumaran, B., Prakash, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+Advances+in+Biosensor+Technology+for+Potential+Applications+-+An+Overview.">Recent Advances in Biosensor Technology for Potential Applications - An Overview.</a> Frontiers in Bioengineering and Biotechnology. 4, 9 (2016).</li><li>Fernandez, M., Morel, B., Ramos, J. L., Krell, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Paralogous+Regulators+ArsR1+and+ArsR2+of+Pseudomonas+putida+KT2440+as+a+Basis+for+Arsenic+Biosensor+Development.">Paralogous Regulators ArsR1 and ArsR2 of Pseudomonas putida KT2440 as a Basis for Arsenic Biosensor Development.</a> Applied and Environmental Microbiology. 82 (14), 4133-4144 (2016).</li><li>Porter, S. E. G., Barber, A. E., Colella, O. K., Roach, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+Biological+Organisms+as+Chemical+Sensors:+The+MicRoboCop+Project.">Using Biological Organisms as Chemical Sensors: The MicRoboCop Project.</a> Journal of Chemical Education. 95 (8), 1392-1397 (2018).</li><li>Borremans, B., Hobman, J. L., Provoost, A., Brown, N. L., Van der Lelie, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+functional+analysis+of+the+pbr+lead+resistance+determinant+of+Ralstonia+metallidurans+CH34.">Cloning and functional analysis of the pbr lead resistance determinant of Ralstonia metallidurans CH34.</a> Journal of Bacteriology. 183 (19), 5651-5658 (2001).</li><li>Hobman, J. L., Julian, D. J., Brown, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cysteine+coordination+of+Pb(II)+is+involved+in+the+PbrR-dependent+activation+of+the+lead-resistance+promoter,+PpbrA,+from+Cupriavidus+metallidurans+CH34.">Cysteine coordination of Pb(II) is involved in the PbrR-dependent activation of the lead-resistance promoter, PpbrA, from Cupriavidus metallidurans CH34.</a> Bmc Microbiology. 12, (2012).</li><li>Yagur-Kroll, S., Amiel, E., Rosen, R., Belkin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+2,4-dinitrotoluene+and+2,4,6-trinitrotoluene+by+an+Escherichia+coli+bioreporter:+performance+enhancement+by+directed+evolution.">Detection of 2,4-dinitrotoluene and 2,4,6-trinitrotoluene by an Escherichia coli bioreporter: performance enhancement by directed evolution.</a> Applied Microbiology and Biotechnology. 99 (17), 7177-7188 (2015).</li><li>Gorman, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=&#34;Guns+in+America:+The+Debate+Over+Lead+Based+Bullets.&#34;.">&#34;Guns in America: The Debate Over Lead Based Bullets.&#34;.</a> Newsweek. , (2017).</li><li>Yuksel, B., Ozler-Yigiter, A., Bora, T., Sen, N., Kayaalti, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFAAS+Determination+of+Antimony,+Barium,+and+Lead+Levels+in+Gunshot+Residue+Swabs:+An+Application+in+Forensic+Chemistry.">GFAAS Determination of Antimony, Barium, and Lead Levels in Gunshot Residue Swabs: An Application in Forensic Chemistry.</a> Atomic Spectroscopy. 37 (4), 164-169 (2016).</li><li>Blakey, L. S., Sharples, G. P., Chana, K., Birkett, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fate+and+Behavior+of+Gunshot+Residue-A+Review.">Fate and Behavior of Gunshot Residue-A Review.</a> Journal of Forensic Sciences. 63 (1), 9-19 (2018).</li><li>Yagur-Kroll, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+bioreporters+for+the+detection+of+2,4-dinitrotoluene+and+2,4,6-trinitrotoluene.">Escherichia coli bioreporters for the detection of 2,4-dinitrotoluene and 2,4,6-trinitrotoluene.</a> Applied Microbiology and Biotechnology. 98 (2), 885-895 (2014).</li></ol>

수정 및 문제 해결
표 4 에 기재 된 실험은 설계 된 센서에 적합 한 임의의 방식으로 변형 될 수 있다. 화학 센서의 가장 중요 한 측면은 민감도와 특이성을 평가 하는 것입니다. 센서의 유용한 분석 범위를 결정 하기 위해 분석 물의 광범위 한 농도가 분석 되도록 하는 것이 유리 합니다. 또한 세포에 대 한 분석 물의 최대 수준을 결정할 가치가 있습니?...

바이오 센서는 화학 물질 또는 분석 물의 검출에 사용 될 수 있는 반응을 생성 하는 생물학적 성분 (예컨대 단백질, 핵 산 또는 전체 유기 체)을 사용 하는 임의의 분석 장치 이다. 예를 들어 석탄 광산 산업은 20 세기의 대부분을 위해 석탄 광산1의 카나리아 인 독성 광산 가스의 존재를 감지 하는 바이오 센서를 사용 했습니다. 작업자를 보호 하기 위해 화학 물질 분석 물 (일산화 탄소)에 대 한 생물학적 유기 체의 반응 (카나리아의 사망 또는 고통)이 광부에 의해 관찰 되었습니다. 보다 현대적이 고 정교한 예에서, 박테리아는 형광 단백질의 발현과 같은 특이 적 반응을 나타내는 것에 의해 특정 화학적 분석 물질의 존재에 반응 하는 합성 생물학 기술을 사용 하 여 변경 될 수 있다.
합성 생물학은 자연적으로 존재 하지 않는 생물학적 장치 및 시스템의 건설을 지칭 하는 광범위 한 용어이 고, 또는 특정 목적을 위한 기존의 생물학적 시스템의 재설계2이다. 합성 생물학은 장치 및 시스템을 합성 하는 데 사용할 수 있는 표준 방법론 및 표준화 된 부품 (표준 합성 생물학 유전 요소)의 존재에 의해 유전 공학과 구별 된다. 일부 는 장치의게놈에 도입 되 고, 박테리아와 같은 생물체는 기능의 표시 역할을 할 특정 특성을 표현 합니다. 예를 들어, 많은 합성 장치에서, 형광 단백질의 발현은 리포터 단백질로 서 단일 세포 유기 체로 도입 된다. 여러 장치를 하나의 시스템으로 결합할 수 있습니다. 박테리아와 같은 미생물의 게놈은 이러한 방식으로 조작 하기 쉽습니다. 광범위 한 화학 분석 물에 특정 한 바이오 센서의 수많은 예가 지난 10년동안 문헌에서 보고 되었습니다.
이 작업에서, MicRoboCop 시스템은 법의학 및 환경 화학에 새로운 응용 프로그램과 합성 생물학 기술을 사용 하 여 설계 된 바이오 센서의 예로서 제시 된다. MicRoboCop은 결합 될 때, 대장균 이 사람의 손 또는 표면에서 수집 된 총 탄 잔류물 (gsr)의 존재 하에서 적색 형광 단백질 (rfp)을 발현 할 수 있게 하는 3 개의 분리 된 장치 시스템입니다. 3 개의 장치 각각은 GSR5의 구성 요소로 알려져 있는 특정 화학 물질 분석 물에 반응 합니다. 시스템이 응답 하는 3 개의 분석 물은 i. 2, 4, 6-트리니타로 톨루엔 (TNT) 및 관련 화합물 II. (납 이온의 형태로), III. 안티 몬 (이온의 형태로도).
GSR은 많은 다른 화학 물질로 구성 되어 있지만, 세 가지는 일반적으로 GSR은 바 륨, 납 및 안티 몬의5와 같은 잔류물을 식별 하는 데 사용 됩니다. GSR의 식별을 위한 표준 비 치열 시험은 에너지 분산형 X 선 형광을 가진 주사 전자 현미경 (SEM)을 사용 하는 것입니다. 분석가는 SEM을 통해 GSR의 고유한 형태와 원소 성분을 확인할 수 있습니다. 현재, 사용할 수 있는 몇 가지 널리 사용 되는 바이너리 추정 테스트. 최근에 출판 된 추정 테스트는 많은 실험실에서 사용 하지 못할 수 있는 특수 장비 인 이온 이동성 분광학 (IMS)을 사용 합니다. 그들은 일반적으로 거리 결정 또는 총알 구멍과 상처에 GSR 식별을 위해 사용 되지만, 사용할 수 있는 몇 가지 색상 "스팟" 테스트도 있습니다5. 또한, 잠재적으로 현장 휴대용, 또는 양극 스트리핑 voltammetric의 장점을가지고 있는 voltammetric 분석을 사용 하는 GSR에 대 한 전기 화학 시험 문헌에 몇 가지 제한 된 주의가 있었다,이는 매우 금속 원소에 대 한 민감한 방법7. GSR을 검출 하기 위한 목적으로 특별히 설계 된 바이오 센서 문헌에는 거의 언급 되어 있지 않지만, 다른 포렌식 어플리케이션을 위한 바이오 센서는8 개출판 되었습니다.
마이크로 보 캅 시스템에서 각 장치에 대 한 생물학적 원소 및 플라스 미드 시공이 도 1에 도시 되어 있다. 도 1b 의 곡선 화살표는 분석 물의 존재 하에서 활성화 되는 프로모터 영역을 나타내며, 상기 타원형은 리포터 단백질의 번역을 허용 하는 리보솜 결합 부위 이며, 회색 상자는 rfp 라는 표지는 적색을 표현 하는 유전자 형광 단백질, 및 적색 팔각형은 전사 종결 부위 이다. 세 장치 모두 GSR을 감지 하는 시스템으로 함께 사용 됩니다. 특정 프로모터 (SbRFP, PbRFP 및 TNT RFP)를 가진 각 장치는 시험 되는 샘플과 함께 인큐베이션 되 고 RFP의 형광이 측정 될 것 이다. RFP는 적절 한 화학적 분석 물질이 존재 하 고 프로모터 영역을 활성화 하는 경우에만 발현 될 것 이다. GSR에 존재 하는 일부 화학 물질에 반응 하는 세 가지 장치가 설계 되어이 작품에 제시 된다.
3 개의 microbocop 장치에서 사용 되는 프로모터는 비소 및 안티 몬 계 민감한 프로모터, sbrfp9,10, 리드 민감성 프로모터, pbrfp11,12 및 TNT 민감성 프로모터, TNT-RFP 13. 문헌에서의 검색은 바 륨에 반응 하도록 설계 된 프로모터를 밝혀 내지 않았기 때문에,이 프로모터는 다 수의 구조적으로 관련 된 화합물 (특히, 2, 4-딘 트로 톨루엔 및 dinitrobenzene)는 GSR에 남겨진 유기 화합물의 일부가 되는 것으로 알려져 있다. 이 프로모터는 매 립 지 지뢰13에서 TNT와 2, 4 딘 트로 톨루엔 (2, 4 DNT)의 분 량을 구체적으로 감지 하는 데 성공적으로 사용 되었습니다. 세 가지 장치를 시스템으로 함께 사용 하 여 GSR에 대 한 긍정적 인 테스트는 세 장치 모두에서 형광을 생성 합니다. 1 개 또는 2 개의 장치 에서만 형광 신호는 GSR에 남아 있는 유기 화합물이 아닌 화합물에 의해 활성화 된 분석 물 (들) 또는 TNT 프로모터의 경우에 다른 환경적 공급원을 나타낼 것 이다. 세 대의 장치를 모두 사용 함으로써, 환경 오염 원으로 인 한 거짓 양성 결과의 가능성을 최소화할 수 있습니다. 인기를 얻고 있는 무연 탄약은 여전히 미국에서 탄약 판매의 약 5%만을 나타냅니다. 따라서 납의 부재로 인 한 거짓 부정 결과는 가능성이 있지만 GSR14의 마커로 납을 사용 하는 센서에는 여전히 유틸리티가 있습니다. 이 특정 법의학 응용 프로그램 외에도 각 장치는 환경 오염 물질을 감지 하기 위해 개별적으로 사용할 수 있습니다.
제시 된 프로토콜은 장치의 기능을 확인 하 고 얻어진 형광 신호를 분석 하기 위해 장치 (센서 박테리아) 및 분석 기법을 만드는 데 사용 되는 합성 생물학 기술을 포함 한다. 프로토콜은 또한 표면에서 GSR을 수집 하는 용의자 또는 swabbing의 손에서 GSR을 수집 하는 손 닦는 형태의 법의학 증거의 수집을 포함 한다. 리드 센서 장치의 결과는 사용 된 카트리지 케이스를 사용한 GSR에 대 한 포지티브 테스트의 데모와 함께 예제 결과로 제시 됩니다.

<table>
	<tbody>
		<tr>
			<td>1,3-dinitrobenzene, 97%</td>
			<td>Aldrich</td>
			<td>D194255-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>2,4-dinitrotoluene, 97%</td>
			<td>Aldrich</td>
			<td>101397-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>Fisher Scientific</td>
			<td>BP1423-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Fisher Scientific</td>
			<td>BP1760-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Antimony, Reference Standard Solution (1000ppm &#177;1%/Certified)</td>
			<td>Fisher Scientific</td>
			<td>SA450-100</td>
			<td>Standard in dilute HNO3</td>
		</tr>
		<tr>
			<td>Cut Smart Buffer</td>
			<td>New England BioLabs</td>
			<td>B7204S</td>
			<td></td>
		</tr>
		<tr>
			<td>Duplex Buffer</td>
			<td>Integrated DNA Technologies</td>
			<td>11-01-03-00</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRI-HF Restriction Enzyme</td>
			<td>New England BioLabs</td>
			<td>R3101S</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol, HPLC grade, denatured</td>
			<td>Acros Organics</td>
			<td>AC611050040</td>
			<td>Solvents do not need to be HPLC grade, ACS or reagent grade will work.</td>
		</tr>
		<tr>
			<td>Eurofins Genomics SimpleSeq DNA Sequencing Kits</td>
			<td>Eurofins Genomics</td>
			<td>SimpleSeq Kit Standard</td>
			<td></td>
		</tr>
		<tr>
			<td>Forward primer for colony PCR</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GCCGCTTGAATTCGTCATATAT-3&#8217;</td>
		</tr>
		<tr>
			<td>Forward primer for DNA sequencing</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GTAAAACGACGGCCAGTG-3&#8217;</td>
		</tr>
		<tr>
			<td>IBI Science High Speed Plasmid Mini-kit</td>
			<td>IBI Scientific</td>
			<td>IB47101</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Broth, Miller</td>
			<td>Fisher Scientific</td>
			<td>BP1426-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Lead, Reference Standard Solution (1000ppm &#177;1%/Certified)</td>
			<td>Fisher Scientific</td>
			<td>SL21-100</td>
			<td>Standard in dilute HNO3</td>
		</tr>
		<tr>
			<td>LeadOff Disposable Cleaning and Decon Wipes</td>
			<td>Hygenall</td>
			<td>45NRCN</td>
			<td>Sold in canisters or individually wrapped, any alcohol based wipe will work.</td>
		</tr>
		<tr>
			<td>Methanol, HPLC grade</td>
			<td>Fisher Scientific</td>
			<td>A452-4</td>
			<td>Solvents do not need to be HPLC grade, ACS or reagent grade will work.</td>
		</tr>
		<tr>
			<td>NEB 5-alpha Competent E. coli cells</td>
			<td>New England BioLabs</td>
			<td>C2987I</td>
			<td></td>
		</tr>
		<tr>
			<td>NheI-HF Restriction Enzyme</td>
			<td>New England BioLabs</td>
			<td>R3131S</td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease free water</td>
			<td>New England BioLabs</td>
			<td>B1500S</td>
			<td></td>
		</tr>
		<tr>
			<td>OneTaq 2X Master Mix with Standard Buffer</td>
			<td>New England BioLabs</td>
			<td>M0482S</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmids from the registry of standard biological parts used for synthetic biology</td>
			<td>Registry of Standard Biological Parts</td>
			<td></td>
			<td>http://parts.igem.org/Main_Page</td>
		</tr>
		<tr>
			<td>Promoter Sequences</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>Sb promoter: 5&#8217;-GCATGAATTCAGTCAT 
			ATATGTTTTTGACTTATCCGCTTCGAAGAGAG 
			AGACACTACCTGCAACAATCGCTAGCGCAT-3&#8217; 3&#8217;-CGTACTTAAGCTCACTATATACAAAAACT 
			GAATAGGCGAAGCTTCTCTCTCTGTGATGGAC 
			GTTGTTAGCGATCGCGTA-5&#8217; 
			Pb promoter: 5&#8217;-GCATGAATTCGTCTTG 
			ACTCTATAGTAACTAAGGGTGTATAATCGGCA 
			ACGCGAGCTAGCGCAT-3&#8217; 3&#8217;-CGTACTTAAGCAGAACTGAGATATCATTG 
			ATCTCCCACATCTTAGCCGTTGCGCTGCGATCGCGTA-5&#8217; 
			TNT promoter: 5&#8217;GCATTCTAGATCAATT 
			TATTTGAACAAGGCGGTCAATTCTCTTCGATT 
			TTATCTCTCGTAAAAAAACGTGATACTCATCA 
			CATCGACGAAACAACGTCACTTATACAAAAAT 
			CACCTGCGAGAGATTAATTGAATTCGCAT3&#8217; 3&#8217;CGTAAGATCTAGTTAAATAAACTTGTTCCG 
			CCAGTTAAGAGAAGCTAAAATAGAGAGCATTT 
			TTTTGCACTATGAGTAGTGTAGCTGCTTTGTT 
			GCAGTGAATATGTTTTTAGTGGACGCTCTCTA 
			ATTAACTTAAGCGTA5&#8217;</td>
		</tr>
		<tr>
			<td>Reverse primer for colony PCR</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GCCGCTTGAATTCGTCTAGACT- 3&#8217;</td>
		</tr>
		<tr>
			<td>Reverse primer for DNA sequencing</td>
			<td>Integrated DNA Technologies</td>
			<td></td>
			<td>5&#8217;- GGAAACAGCTATGACCATG-3&#8217;</td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>New England BioLabs</td>
			<td>M0202S</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and application of a new bacterial biosensor for the presumptive detection of gunshot residue

MicRoboCop은 법의학 화학에서 독특한 응용을 위해 설계 된 바이오 센서입니다. MicRoboCop는 3 개의 주요 분석 물 (안티 몬, 납 및 유기 성분 GSR의)의 존재 하에서 형광 신호를 제조 함으로써 함께 사용 될 때, 총 탄 잔류물 (GSR)의 존재를 나타낼 수 있는 세 개의 장치로 구성 된 시스템 이다. 이 프로토콜은 대장균 (대장균)을 사용 하 는 바이오 센서의 합성 및 센서의 선택성 및 민감도를 평가 하는 데 사용 되는 분석 화학 방법을 설명 합니다. 시스템의 기능은 사용 된 카트리지 케이스의 내부에서 수집한 GSR을 통해 입증 됩니다. 일단 준비 되 면, 바이오 센서는 필요할 때까지 보관할 수 있으며 이러한 주요 분석 물에 대 한 테스트로 사용할 수 있습니다. 3 개의 분석 물 모두에서 긍정적 인 반응은 GSR에 대 한 추정 양성 검사를 제공 하는 반면, 각 개별 장치에는 다른 샘플의 분석 물을 검출 하는 응용 프로그램이 있습니다 (예: 식 수의 납 오염 검출기). 시스템의 주요 제한은 양성 신호에 필요한 시간입니다. 미래 작업은 응답 시간을 최적화 하기 위해 다른 유기 체를 연구 하는 것을 수반할 수 있습니다.

이 작품에 사용 된 RFP 변이체에 대 한 형광 스펙트럼은 도 2에 나타내 었 다. 이 데이터는 PbRFP 장치에서 리드 및 TNT-RFP 장치에 응답 하므로 두 개의 분석 물, 2, 4 DNT 및 1, 3 DNB에 응답 합니다. 이 수치는 음성 대조 군 (분석 물이 첨가 되지 않음)의 스펙트럼과 추가 된 두 가지 상이한 분석 물 레벨에서 스펙트럼을 보여줍니다. 사용 된 RFP 변이체에 대 한 최대 형광 ...

Watch this Scientific Journal Video about Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue at JoVE.com

Preparation and Application of a New Bacterial Biosensor for the Presumptive Detection of Gunshot Residue

프로토콜은 총 총 잔류물의 분석을 위한 세균 바이오 센서의 세트를 합성 하 고, 형광 분 광 법을 사용 하 여 그들의 의도 된 사용을 위한 장치의 기능을 테스트 하기 위해 합성 생물학 기술을 사용 하 여 제시 된다.

총 탄 잔류물의 추정 검출을 위한 새로운 세균 바이오 센서의 제조 및 적용

MicRoboCop is a biosensor that has been designed for a unique application in forensic chemistry. MicRoboCop is a system made up of three devices that, ...

이 프로토콜은 총성 잔류물의 화학 성분을 감지하도록 설계된 독특한 바이오 센서의 준비 및 분석을 설명합니다. 법의학 응용 분야에 바이오 센서를 사용하는 것은 독특합니다. 일반적으로 법의학 실험실에서 사용되는 고도로 전문화된 계측에 대한 대안을 사용하기 간편하고 사용하기 간편합니다.설명된 합성 생물학 방법은 표준 합성 생물학 부분을 사용하는 모든 시스템에 사용될 수 있습니다. 설명된 화학 분석은 적색 형광 단백질을 표현하는 모든 바이오 센서에 적용됩니다. 절차를 시연하는 것은 롱우드 대학의 학부 생인 안드레아 솔스와 엘 리차드슨이 될 것입니다.이 절차를 시작하려면 이전에 격리 된 J10060 플라스미드 DNA의 10 마이크로 리터를 미세 원심 분리기 튜브에 추가하십시오. 8개의 마이크로리터의 물과 에코리와 NHEL 효소 각각의 마이크로리터 1개를 완충제 1마이크로리터와 미리 혼합합니다. 프로모터 DNA의 경우, 신선한 미세 원심 분리기 튜브에 아닐 프로모터 DNA 서열10마이크로리터를 추가합니다.8개의 마이크로리터의 물과 에코리와 NHEL 효소 각각의 마이크로리터 1개를 완충제 1마이크로리터와 미리 혼합합니다. 10 마이크로리터로 설정된 파이펫을 사용하여 샘플을 위아래로 부드럽게 피펫하여 혼합합니다. 샘플을 섭씨 37도에서 30분 동안 배양합니다.그런 다음 효소를 섭씨 80도에서 5분간 가열하고 활성화합니다. 소화된 DNA를 냉동실에 보관하여 준비될 때까지 보관합니다. 먼저, 이전에 소화된 플라스미드 및 프로모터 DNA를 사용하여 텍스트 프로토콜 중 하나에 설명된 바와 같이 얼음에 미세트리퍼지 튜브에 반응을 설정합니다.T4 DNA 리구아제 마지막을 추가해야 합니다. 파이펫을 위아래로 부드럽게 위아래로 작용하고 원심분리기를 짧게 섞습니다. 실온에서 10분 동안 배양하세요.그런 다음 10 분 동안 65도에서 가열하고 활성화하십시오. 텍스트 프로토콜에 설명된 대로 변환을 수행합니다. 먼저 텍스트 프로토콜의 표 2에 설명된 대로 PCR에 대한 반응 혼합물을 설정합니다.부드럽게 위아래로 파이펫하여 반응을 혼합합니다. 노란색 파이펫 팁을 사용하여 변형된 대장균의 식민지를 긁어냅니다. 이 대장균을 분리한 새로운 LB-암피실린 한고 판에 스 와이프한 다음 PCR 튜브에 파이펫 팁을 삽입합니다.파이펫 팁을 흔들어 E.Coli와 PCR 믹스를 혼합합니다. 추가 식민지에 대한이 과정을 세 번 더 반복합니다. 그런 다음 PCR 튜브를 PCR 기계에 로드하고 텍스트 프로토콜의 표 3에 설명된 대로 써모사이클링을 시작합니다.텍스트 프로토콜의 표 4에 설명된 대로 적절한 수의 멸균 배양 튜브에 레이블을 지정합니다. 각 튜브에 준비된 배양 국물의 2밀리리터를 추가합니다. 테이블 4에 설명된 대로 튜브에 애니라이트 스톡 솔루션을 추가합니다.그런 다음 배양 튜브에 스냅 캡을 배치하여 튜브로 공기가 유입될 수 있도록 느슨해지도록 합니다. 각 배양 튜브를 소용돌이. 그 후, 튜브를 섭씨 37도, RPM 220에서 24시간 이상 흔들리는 인큐베이터에 넣습니다.먼저, 손가락을 포함하여 손의 모든 표면을 닦아 리드를 제거하기 위해 설계된 에탄올 기반 의 닦기를 사용합니다. 분석할 때까지 적절하게 레이블이 부착된 밀봉 가능한 가방에 물티슈를 보관합니다. 시험할 큰 표면을 닦아 알코올 기반 닦아.에탄올로 적신 면 스왑을 사용하여 테스트할 작은 표면을 닦아냅니다. 깨끗한 장갑을 착용하고 알코올로 청소 한 가위를 사용하여 닦아 중심에서 약 1 평방 센티미터인 부분을 잘라냅니다. 그런 다음, 절단된 물살 또는 면봉을 센서 박테리아의 2밀리리터를 포함하는 배양 튜브에 직접 넣고 국물에 완전히 침수되도록 한다.분광계를 준비하여 RFP 변종에 적합한 파장에서 형광 성출물을 수집하며, 500나노미터의 난동을 갖는다. 그런 다음 소용돌이 믹서를 사용하여 튜브를 흔들어 줍니다. 각 상체를 소량의 큐벳으로 조심스럽게 옮기고 배출 강도를 수집합니다.소용돌이 믹서를 사용하여 튜브를 흔들어주세요. 국물의 200 마이크로리터를 우물판에 잘 옮기다. 이 플레이트의 각 우물에 어떤 샘플이 들어갔는지 기록합니다.RFP 변종에 적합한 파장에서 방출 강도를 수집하기 위해 밀가루계를 설정합니다. 대표적인 RFP 변종에 대한 형광 스펙트럼은 추가된 두 개의 다른 수준의 음수 제어와 스펙트럼을 모두 나타낸다. 이 작업에 사용되는 RFP 변이체에 대한 최대 형광 신호는 575 나노미터에서 관찰된다.대표적인 데이터는 휴대용 분광계와 불소계 모두에서 동일한 솔루션 집합에 대해 수집됩니다. 음광의 농도가 증가함에 따라 형광이 증가하는 일반적인 추세가 있다. 리드 센서의 경우 10억 개당 약 800개 이상의 고농도에서 이러한 고농도에서 납의 독성으로 인해 응답이 떨어진다는 점은 주목할 가치가 있다.지출 된 40 구경 카트리지 케이스의 내부에서 에탄올 면봉 샘플의 분석은 원리 결과의 증거를 제공합니다. 세 가지 센서 박테리아 각각의 긍정적 인 결과는 총성 잔류물에 대한 긍정적 인 테스트를 나타냅니다. 이 프로토콜에 준비된 바이오 센서는 식품, 물 또는 환경 샘플의 오염을 감지하기 위해 개별적으로 사용할 수도 있습니다.이 기술은 연구원이 다양한 화학 적 음염에 대한 표준 합성 생물학 기술을 사용하여 바이오 센서를 개발할 수있는 길을 열어줍니다. 개인 보호 장비를 착용해야 하며, 분석가들은 E.coli를 취급한 후 손을 씻고 표면을 소독해야 합니다. 폐기물은 자동화되어야 하며 중금속이 함유된 폐기물은 그에 따라 처리되어야 합니다.

Research

JoVE Journal

Chemistry

Preparation and Use of Samarium Diiodide (SmI2) in Organic Synthesis: The Mechanistic Role of HMPA and Ni(II) Salts in the Samarium Barbier Reaction

Preparation and Use of Samarium Diiodide SmI2 in Organic Synthesis: The Mechanistic Role of HMPA and NiII Salts in the Samarium Barbier Reaction

준비와 사마륨 Diiodide 이용 (SMI<sub&gt; 2</sub&gt;) 유기 합성의 : 사마륨 Barbier 반응에 HMPA과 니켈 (II) 소금의 기계론의 역할

Although initially considered an esoteric reagent, SmI2 has become a common tool for synthetic organic chemists. SmI2 is generated through the addition of ...

연구

화학

Synthesis of Hypervalent Iodonium Alkynyl Triflates for the Application of Generating Cyanocarbenes

생성 Cyanocarbenes의 응용 프로그램에 대한 고원자가 요오드 알키 트라이 플레이트의 합성

The procedures described in this article involve the synthesis and isolation of hypervalent iodonium alkynyl triflates (HIATs) and their subsequent ...

Isolation and Preparation of Bacterial Cell Walls for Compositional Analysis by Ultra Performance Liquid Chromatography

초성능 액체 크로마토그래피에 의한 조성 분석을 위한 세균세포벽의 격리 및 준비

The bacterial cell wall is critical for the determination of cell shape during growth and division, and maintains the mechanical integrity of cells in the ...

Preparation of Mica and Silicon Substrates for DNA Origami Analysis and Experimentation

DNA 종이 접기 분석 및 실험에 대한 운모와 실리콘 기판의 제조

The designed nature and controlled, one-pot synthesis of DNA origami provides exciting opportunities in many fields, particularly nanoelectronics. Many of ...

Protocol for the Synthesis of Ortho-trifluoromethoxylated Aniline Derivatives

Protocol for the Synthesis of Ortho-trifluoromethoxylated Aniline Derivatives

의 합성을위한 프로토콜<em&gt; 직교</em&gt; -trifluoromethoxylated 아닐린 파생 상품

Molecules bearing trifluoromethoxy (OCF3) group often show desired pharmacological and biological properties. However, facile synthesis of ...

Synthesis of Protein Bioconjugates via Cysteine-maleimide Chemistry

Synthesis of Protein Bioconjugates via Cysteine-maleimide Chemistry

The chemical linking or bioconjugation of proteins to fluorescent dyes, drugs, polymers and other proteins has a broad range of applications, such as the ...

Facile Synthesis of Worm-like Micelles by Visible Light Mediated Dispersion Polymerization Using Photoredox Catalyst

Photoredox 촉매를 사용하여 가시 광선 중재 분산 중합에 의해 웜 형상 미셀 손쉬운 합성

Presented herein is a protocol for the facile synthesis of worm-like micelles by visible light mediated dispersion polymerization. This approach begins ...

Preparation and Evaluation of 99mTc-labeled Tridentate Chelates for Pre-targeting Using Bioorthogonal Chemistry

Preparation and Evaluation of 99mTc-labeled Tridentate Chelates for Pre-targeting Using Bioorthogonal Chemistry

준비 및 평가<sup&gt; 99m</sup&gt; Bioorthogonal 화학을 사용하여 사전이 타겟팅에 대한 세자리 킬레이트를 Tc를 표지

Pre-targeting combined with bioorthogonal chemistry is emerging as an effective way to create new radiopharmaceuticals. Of the methods available, the ...