Name: preparation of neutrally-charged, ph-responsive polymeric nanoparticles for cytosolic sirna delivery
Uploaded: 2019-05-02T15:00:00
Description: Watch this Scientific Journal Video about Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery at JoVE.com

저자는 크레이그 듀발과 레 베 카 쿡이 연구를 수행 하기 위한 데이터 및 실험실 리소스에 액세스 할 수 있도록 감사 합니다. 저자는 DLS와 TEM (NSF EPS 1004083) 계기에 접근 하기를 위한 나노 규모 과학 및 공학 (VINSE)에 대 한 밴 더 빌 트 연구소에 감사 합니다. 저자 들은 대학원 연구 펠로 우 십 프로그램 (NSF # 1445197)을 지원 하기 위한 국립 과학 재단에 감사 드립니다. 저자는 재정 지원 (NIH R01 EB019409)에 대 한 국가의 건강 연구소에 감사 합니다. 저자는 국방 CDMRP (OR130302) 재정 지원을 위한 국방부 의회 감독 의료 연구 프로그램에 감사 드립니다.

1. 시-NPs의 준비 및 특성화
<ol><li>si-NP 준비<ol>
<li>3.33 Mg/ml의 구 연산 완충 액 (pH 4.0)에서 10 mM의 고분자를 녹 이세요. 중합체는 먼저 용 해를 보장 하기 위해 에탄올에 10 배 농도로 용 해 될 수 있다. 참고: 고분자는 낮은 농도에서 용 해 될 수 있지만, 3.33 mg/m l 이상의 농도에서 사용 하 여 균질 한 NP 형성을 방지할 수 있습니다.</li>
		<li>SiRNA (50 μ m)를 추가하 여 N+:P 10의 비율로 생성...

<ol>
	<li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Elbashir, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duplexes+of+21-nucleotide+RNAs+mediate+RNA+interference+in+cultured+mammalian+cells.">Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.</a> Nature. 411 (6836), 494-498 (2001).</li><li>Soutschek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+silencing+of+an+endogenous+gene+by+systemic+administration+of+modified+siRNAs.">Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs.</a> Nature. 432 (7014), 173-178 (2004).</li><li>Hannon, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference.">RNA interference.</a> Nature. 418, 244 (2002).</li><li>Dykxhoorn, D. M., Palliser, D., Lieberman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+silent+treatment:+siRNAs+as+small+molecule+drugs.">The silent treatment: siRNAs as small molecule drugs.</a> Gene Therapy. 13 (6), 541-552 (2006).</li><li>Wittrup, A., Lieberman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knocking+down+disease:+a+progress+report+on+siRNA+therapeutics.">Knocking down disease: a progress report on siRNA therapeutics.</a> Nature Reviews Genetics. 16 (9), 543 (2015).</li><li>Li, H. E., Nelson, C. C., Evans, B., Duvall, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+Intracellular-Acting+Biologics+in+Pro-Apoptotic+Therapies.">Delivery of Intracellular-Acting Biologics in Pro-Apoptotic Therapies.</a> Current Pharmaceutical Design. 17 (3), 293-319 (2011).</li><li>Bartlett, D. W., Davis, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+siRNA+nuclease+stability+on+the+in+vitro+and+in+vivo+kinetics+of+siRNA-mediated+gene+silencing.">Effect of siRNA nuclease stability on the in vitro and in vivo kinetics of siRNA-mediated gene silencing.</a> Biotechnology and Bioengineering. 97 (4), 909-921 (2007).</li><li>Zuckerman, J. E., Choi, C. H., Han, H., Davis, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycation-siRNA+nanoparticles+can+disassemble+at+the+kidney+glomerular+basement+membrane.">Polycation-siRNA nanoparticles can disassemble at the kidney glomerular basement membrane.</a> Proceedings of the National Academy of Sciences USA. 109 (8), 3137-3142 (2012).</li><li>Dominska, M., Dykxhoorn, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breaking+down+the+barriers:+siRNA+delivery+and+endosome+escape.">Breaking down the barriers: siRNA delivery and endosome escape.</a> Journal of Cell Science. 123 (Pt 8), 1183-1189 (2010).</li><li>Gilleron, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Image-based+analysis+of+lipid+nanoparticle&#8211;mediated+siRNA+delivery,+intracellular+trafficking+and+endosomal+escape.">Image-based analysis of lipid nanoparticle&#8211;mediated siRNA delivery, intracellular trafficking and endosomal escape.</a> Nature Biotechnology. 31 (7), 638 (2013).</li><li>Sahay, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficiency+of+siRNA+delivery+by+lipid+nanoparticles+is+limited+by+endocytic+recycling.">Efficiency of siRNA delivery by lipid nanoparticles is limited by endocytic recycling.</a> Nature Biotechnology. 31 (7), 653-658 (2013).</li><li>Wittrup, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+lipid-formulated+siRNA+release+from+endosomes+and+target+gene+knockdown.">Visualizing lipid-formulated siRNA release from endosomes and target gene knockdown.</a> Nature Biotechnology. 33 (8), 870-876 (2015).</li><li>Kanasty, R., Dorkin, J. R., Vegas, A., Anderson, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+materials+for+siRNA+therapeutics.">Delivery materials for siRNA therapeutics.</a> Nature Materials. 12 (11), 967-977 (2013).</li><li>Adams, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patisiran,+an+RNAi+Therapeutic,+for+Hereditary+Transthyretin+Amyloidosis.">Patisiran, an RNAi Therapeutic, for Hereditary Transthyretin Amyloidosis.</a> New England Journal of Medicine. 379 (1), 11-21 (2018).</li><li>Dang, C. V., Reddy, E. P., Shokat, K. M., Soucek, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+'undruggable'+cancer+targets.">Drugging the 'undruggable' cancer targets.</a> Nature Reviews Cancer. 17 (8), 502 (2017).</li><li>Alexis, F., Pridgen, E., Molnar, L. K., Farokhzad, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Factors+affecting+the+clearance+and+biodistribution+of+polymeric+nanoparticles.">Factors affecting the clearance and biodistribution of polymeric nanoparticles.</a> Molecular Pharmaceutics. 5 (4), 505-515 (2008).</li><li>Verbaan, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fate+of+poly(2-dimethyl+amino+ethyl)methacrylate-based+polyplexes+after+intravenous+administration.">The fate of poly(2-dimethyl amino ethyl)methacrylate-based polyplexes after intravenous administration.</a> International Journal of Pharmaceutics. 214 (1-2), 99-101 (2001).</li><li>Lv, H., Zhang, S., Wang, B., Cui, S., Yan, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toxicity+of+cationic+lipids+and+cationic+polymers+in+gene+delivery.">Toxicity of cationic lipids and cationic polymers in gene delivery.</a> Journal of Controlled Release. 114 (1), 100-109 (2006).</li><li>Shi, J., Kantoff, P. W., Wooster, R., Farokhzad, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+nanomedicine:+progress,+challenges+and+opportunities.">Cancer nanomedicine: progress, challenges and opportunities.</a> Nature Reviews Cancer. 17 (1), 20 (2016).</li><li>Torchilin, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+delivery+of+macromolecular+drugs+based+on+the+EPR+effect.">Tumor delivery of macromolecular drugs based on the EPR effect.</a> Advanced Drug Delivery Reviews. 63 (3), 131-135 (2011).</li><li>Duncan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dawning+era+of+polymer+therapeutics.">The dawning era of polymer therapeutics.</a> Nature Reviews Drug Discovery. 2 (5), 347 (2003).</li><li>Tang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+the+optimal+size+of+anticancer+nanomedicine.">Investigating the optimal size of anticancer nanomedicine.</a> Proceedings of the National Academy of Sciences USA. 111 (43), 15344-15349 (2014).</li><li>Nelson, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Balancing+Cationic+and+Hydrophobic+Content+of+PEGylated+siRNA+Polyplexes+Enhances+Endosome+Escape,+Stability,+Blood+Circulation+Time,+and+Bioactivity+in+vivo.">Balancing Cationic and Hydrophobic Content of PEGylated siRNA Polyplexes Enhances Endosome Escape, Stability, Blood Circulation Time, and Bioactivity in vivo.</a> ACS Nano. 7 (10), 8870-8880 (2013).</li><li>Jackson, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zwitterionic+Nanocarrier+Surface+Chemistry+Improves+siRNA+Tumor+Delivery+and+Silencing+Activity+Relative+to+Polyethylene+Glycol.">Zwitterionic Nanocarrier Surface Chemistry Improves siRNA Tumor Delivery and Silencing Activity Relative to Polyethylene Glycol.</a> ACS Nano. , (2017).</li><li>Akinc, A., Thomas, M., Klibanov, A. M., Langer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+polyethylenimine-mediated+DNA+transfection+and+the+proton+sponge+hypothesis.">Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis.</a> The Journal of Gene Medicine. 7 (5), 657-663 (2005).</li><li>de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., Subramani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Firefly+luciferase+gene:+structure+and+expression+in+mammalian+cells.">Firefly luciferase gene: structure and expression in mammalian cells.</a> Molecular and Cellular Biology. 7 (2), 725-737 (1987).</li><li>Aggarwal, P., Hall, J. B., McLeland, C. B., Dobrovolskaia, M. A., McNeil, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanoparticle+interaction+with+plasma+proteins+as+it+relates+to+particle+biodistribution,+biocompatibility+and+therapeutic+efficacy.">Nanoparticle interaction with plasma proteins as it relates to particle biodistribution, biocompatibility and therapeutic efficacy.</a> Advanced Drug Delivery Reviews. 61 (6), 428-437 (2009).</li><li>Geng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shape+effects+of+filaments+versus+spherical+particles+in+flow+and+drug+delivery.">Shape effects of filaments versus spherical particles in flow and drug delivery.</a> Nature Nanotechnology. 2 (4), 249 (2007).</li><li>Chauhan, V. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+nanorods+and+nanospheres+for+real-time+in+vivo+probing+of+nanoparticle+shape-dependent+tumor+penetration.">Fluorescent nanorods and nanospheres for real-time in vivo probing of nanoparticle shape-dependent tumor penetration.</a> Angewandte Chemie International Edition. 50 (48), 11417-11420 (2011).</li><li>Chu, K. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma,+tumor+and+tissue+pharmacokinetics+of+Docetaxel+delivered+via+nanoparticles+of+different+sizes+and+shapes+in+mice+bearing+SKOV-3+human+ovarian+carcinoma+xenograft.">Plasma, tumor and tissue pharmacokinetics of Docetaxel delivered via nanoparticles of different sizes and shapes in mice bearing SKOV-3 human ovarian carcinoma xenograft.</a> Nanomedicine. 9 (5), 686-693 (2013).</li><li>Werfel, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+mTORC2+Inhibitor+Therapeutically+Blocks+Breast+Cancer+Cell+Growth+and+Survival.">Selective mTORC2 Inhibitor Therapeutically Blocks Breast Cancer Cell Growth and Survival.</a> Cancer Research. 78 (7), 1845-1858 (2018).</li><li>Sarett, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipophilic+siRNA+targets+albumin+in+situ+and+promotes+bioavailability,+tumor+penetration,+and+carrier-free+gene+silencing.">Lipophilic siRNA targets albumin in situ and promotes bioavailability, tumor penetration, and carrier-free gene silencing.</a> Proceedings of the National Academy of Sciences USA. 114 (32), E6490-E6497 (2017).</li><li>Williams, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+apoptotic+pathway+activation+increases+response+to+anti-estrogens+in+luminal+breast+cancers.">Intrinsic apoptotic pathway activation increases response to anti-estrogens in luminal breast cancers.</a> Cell Death and Disease. 9 (2), 21 (2018).</li><li>Evans, B. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+Vivo+Red+Blood+Cell+Hemolysis+Assay+for+the+Evaluation+of+pH-responsive+Endosomolytic+Agents+for+Cytosolic+Delivery+of+Biomacromolecular+Drugs.">Ex Vivo Red Blood Cell Hemolysis Assay for the Evaluation of pH-responsive Endosomolytic Agents for Cytosolic Delivery of Biomacromolecular Drugs.</a> Journal of Visualized Experiments. (73), e50166 (2013).</li><li>Werfel, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+Optimization+of+PEG+Architecture+and+Hydrophobic+Content+Improves+siRNA+Polyplex+Stability,+Pharmacokinetics,+and+Potency+In+vivo.">Combinatorial Optimization of PEG Architecture and Hydrophobic Content Improves siRNA Polyplex Stability, Pharmacokinetics, and Potency In vivo.</a> Journal of Controlled Release. , (2017).</li><li>Kilchrist, K. V., Evans, B. C., Brophy, C. M., Duvall, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism+of+Enhanced+Cellular+Uptake+and+Cytosolic+Retention+of+MK2+Inhibitory+Peptide+Nano-polyplexes.">Mechanism of Enhanced Cellular Uptake and Cytosolic Retention of MK2 Inhibitory Peptide Nano-polyplexes.</a> Cellular and Molecular Bioengineering. 9 (3), 368-381 (2016).</li><li>Kilchrist, K. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gal8+Visualization+of+Endosome+Disruption+Predicts+Carrier-Mediated+Biologic+Drug+Intracellular+Bioavailability.">Gal8 Visualization of Endosome Disruption Predicts Carrier-Mediated Biologic Drug Intracellular Bioavailability.</a> ACS Nano. , (2019).</li></ol>

여기에 설명 된 si-NPs는 음이온 성 siRNA와 양이온 고분자를 폴 리 이온 복합체 (폴 리 플렉스)로 정전기 협회에 의해 형성 됩니다. PEG-DB 중합체의 siRNA 및 양이온 DB 블록의 정전기 적 복합체는 낮은 pH (4.0)에서 혼합 하 여 촉진 된다. PH 4.0에서 DMAEMA는 고도로 양성자 화 되어 결과적으로 DB 블록이 매우 충전 됩니다. 이것은 중합체가 미 셀을 형성 하는 것과 반대로 용액에서 unimers로 용 해 되 고 siRNA로 ?...

Sirnas는 mRNA 서 열에서 단백질의 번역을 억제 하기 때문에 이론적으로는 모든 알려진 병 리 제1,2,4,5의 약물에 사용 될 수 있습니다. 그러나, 의학에서 sirna의 사용은 sirna 분자6,7의 포괄적으로 가난한 약물 동태 학적 프로 파일에 의해 제한 된다. 정 맥 주사 시, sirnas는 뉴 클레 아 제8,9에 의해 신장 및/또는 저하를 통해 급속히 제거 된다. 그것의 큰 크기 및 음 전 하 때문에, siRNA는 세포에 들어갈 수 없고 또는 내 생포 하는 통로를 이스케이프 하 여 사이토 솔 (10)에 상주 하는 RNA 유도 침묵 복합체 (RISC)에 접근 하 고, 13. 따라서, 광범위 한 노력은 siRNA 전달 전략 (14)의 설계 및 구현에 초점을 맞추고 있다. 이러한 노력은 주로 siRNA를 패키지 하는 지질 및 폴리머 기반 나노 입자의 개발에 초점을 맞추고, 생체 내에서의 클리어런스 및 분해 로부터 보호 하 고, 이온화 가능한 양이온 성 아민 기를 통해 세포 흡수 및 내 염색체 탈출을 개시 한다. 많은 사전 임상 성공이 보고 되 고 가장 최근에는 유전 트랜스 티 레 틴 매개 (해 트) 아 밀 로이드 증15를 치료 하기 위해 나노 입자 기반 간 siRNA 전달에 대 한 첫 번째 임상 성공은 보고 되었습니다.
기존의 약리학 (즉, 소 분자 약물)에 의해 현재 "undruggable" 되는 많은 암 유발 유전자 들이 암 치료 용 고분자 siRNA 나노 입자의 설계에 동기를 부여 하 고 있다. 그러나, 비 간장 siRNA 납품을 위해 고려 되어야 하는 디자인 매개 변수의 개별적인 세트가 있습니다. 전달 시스템은 전신 순환17,18,19내에서 응집을 야기 하는 폴 리 플렉스의 양이온 성 전 하를 차폐 한다. 종양 전달을 위해, 구체적으로, si-NP 안정성은 향상 된 투과성 및 유지 (epr) 효과를 통해 종양 내에 축적이 증가 하 고 따라서 긴 순환을 부여 하는 것이 필수적 이다20,21. 더욱이, si-NP 크기에 대 한 제어는 약 20-200 nm 직경 크기의 나노 입자만을 레버리지로 서 필수적 이며, 보다 작은 Si-NPs (~ 20 50 nm 직경) 더 큰 크기의 나노 입자에 대 한 개선 된 종양 침투를 나타낸다 미세 입자23.
이러한 추가적인 설계 제약을 해결 하기 위해 정 맥 내 투여에 따르는 siRNA의 전신 종양 전달을 위한, 중성-충전, pH 반응 시-NPs가 개발 되었다 (도 1)24. 이러한 si-NPs는 페 길 화 된, 또는 가장 최근에는, 중성 표면 전 하 및 순환에 있는 단백질 흡착 및 오 손 화에 저항을 위한 Zwitterionated25입니다. 그들은 세포내 전달을 구동 하기 위해 양이온 성 문자에 전적으로 의존 할 수 없기 때문에, 매우 효율적인 내 염색체 탈출은 강력한 유전자 침묵을 달성 하기 위한 필수적 이다. 따라서, 이러한 si-NPs의 코어는 세포 외 pH (7.4)에서 불활성 인 고 내 분 비 핵으로 구성 되어 있으 나,이는 내 리소 소 통로의 산성화 조건에서 스위치 유사 방식으로 촉발 된다 [pH 6.8 (초기 내 상 염색체) – 5.0 ( ). 마지막으로, si-NPs의 코어 내에서 양이온 성 및 소수 성 함량의 혼합물은 정전기 및 반 데르 발스 안정화 힘을 모두 제공 하 여, 단지 양이온 시스템에 비해 혈액에서의 시-NPs의 안정성을 향상 시킨다.
다양 한 기능을 비교적 단순한 설계로 통합 하는 것은 가역 적인 추가-프 래그 멘 테이 션 체인 트랜스퍼 (뗏목) 제어 중 합을 사용 하 여 복잡 한 구조와 정밀한 조성을 가진 폴리머를 생산할 수 있습니다. 중성 표면 전 하, pH 반응성 및 NP 안정성을 갖춘 dimethylamino를 생산 하기 위해 폴 리 에틸렌 글리콜을 합성 하는 데 사용 됩니다() 에틸 메타 크 릴레이 트공동부 틸 메타 크 릴레이 트)) (PEG-DB; 그림 1a). PEG-DB는 PEG 코로나 및 DB/siRNA 코어를 사용 하 여 시-NPs를 형성 하는 siRNA와 함께 정전기 적으로 복합 화 된다 (도 1b). PEG는 si-NP 코로나 상에 서 불활성의 중립-충전 된 친수성 층을 형성 한다. 상기 DB 블록은 2-dimethylamino) 에틸 메타 크 릴레이 트 (DMAEMA) 및 부 틸 메타 크 릴레이 트 (BMA)의 50:50 몰 비로 이루어진다. 양이온 DMAEMA 정전기 적으로 복합체는 음으로 충전 된 siRNA. BMA는 np 안정성을 증가 시키고 반 데르 발스 상호 작용에의 한 NP 코어 내에서의 자가 동료 이다. 함께, DMAEMA 및 BMA는 DB 폴리머 블록에 pH 의존적 지질 이중-용 해 거동을 부여 한다. 세포 외 pH에서, DB 블록은 si-NP 코어에 금속 화 되 고 지질 이중 층에 불활성 이다. 내 상 염색체 통로 내에 있는 것과 같은 산 성 조건 하에서, DB 블록 내 이온화 가능한 DMAEMA는 양성자 스폰지 효과를 용이 하 게 하 고, 내 상 염색체 완충은 삼 투 팽 윤 및 파열을 유도 한다26. 추가적으로, DB 블록 내의 소수 성 BMA 모이 어 티는 지질 이중 층으로 활발 하 게 통합 되 고, 강력한 내 혈관 분해를 초래 한다. 따라서, siRNA는 PEG-DB와 함께 복합 화 되어 세포 외 pH에서 중립으로 충전 되 고 안정성이 높게 유지 되 고 있으 나 산 성 pH에서 지질 이중 층을 교란 시켜 siRNA 페이로드의 세포 졸 전달을 보장 한다.
본 명세서는 PEG-DB 로부터 si-NPs를 생산 하는 실험 절차를 설명 한다. 이 화학적 매개 변수를 특성화 하는 방법과 si-NPs의 생물 활성을 제시 하 고 논의 합니다. 신속 하 게 si-NP 생물 활성을 평가 하기 위해, 루시퍼 라 제는 녹 다운 연구를 위한 모델 유전자로 서 사용 된다. 반딧불이의 루시퍼 라 제에는 ' 글로우 '를 담당 하는 프로 틴27가 있습니다. 이에 따라, 상기 반딧불 루시퍼 라 제 유전자로 형질 감염 된 포유류 세포는 루미 노 미터를 이용 하 여 포획 하 여 루시퍼 라 제 발현 수준을 정량화 할 수 있는 바이오 발광 ' 발광 '을 생성 한다. 여기서 우리는 루시퍼 라 제를 사용 하 여 루시퍼 라 제에 대 한 siRNA를 제공 하 고 루시퍼 라 제 발현 세포의 생물 발광에 상응 하는 감소를 정량화 하 여 스크램블 된 siRNA를 받는 세포와 비교 하 여 시-NPs의 생물 활성을 평가 합니다.

<table>
	<tbody>
		<tr>
			<td>0.45 mm pore-size syringe filters</td>
			<td>Thermo Fisher Scientific</td>
			<td>F25133</td>
			<td>17 mm diameter, PTFE membrane</td>
		</tr>
		<tr>
			<td>0-14 pH test strips</td>
			<td>Millipore Sigma</td>
			<td>P4786</td>
			<td></td>
		</tr>
		<tr>
			<td>10x TAE buffer</td>
			<td>Thermo Fisher Scientific/Invitrogen</td>
			<td>AM9869</td>
			<td></td>
		</tr>
		<tr>
			<td>6-7.7 pH test strips</td>
			<td>Millipore Sigma</td>
			<td>P3536</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well black walled plates</td>
			<td>Corning</td>
			<td>3603</td>
			<td>Tissue-culture treated</td>
		</tr>
		<tr>
			<td>Agarose Powder</td>
			<td>Thermo Fisher Scientific/Invitrogen</td>
			<td>16500</td>
			<td></td>
		</tr>
		<tr>
			<td>Citric acid monohydrate</td>
			<td>Millipore Sigma</td>
			<td>C1909</td>
			<td></td>
		</tr>
		<tr>
			<td>dibasic sodium phosphate dihydrate</td>
			<td>Millipore Sigma</td>
			<td>71643</td>
			<td></td>
		</tr>
		<tr>
			<td>D-luciferin</td>
			<td>Thermo Fisher Scientific</td>
			<td>88294</td>
			<td>Monopotassium Salt</td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>11995065</td>
			<td>High glucose and pyruvate</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Millipore Sigma</td>
			<td>459836</td>
			<td></td>
		</tr>
		<tr>
			<td>ethidium bromide</td>
			<td>Thermo Fisher Scientific/Invitrogen</td>
			<td>15585011</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS</td>
			<td>Gibco</td>
			<td>26140079</td>
			<td></td>
		</tr>
		<tr>
			<td>loading dye</td>
			<td>Thermo Fisher Scientific/Invitrogen</td>
			<td>R0611</td>
			<td></td>
		</tr>
		<tr>
			<td>Luciferase siRNA</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Antisense Strand Sequense: GAGGAGUUCAUUAUCAGUGCAAUUGUU Sense Strand Sequense: CAAUUGCACUGAUAAUGAACUCCT*C* *DNA bases</td>
		</tr>
		<tr>
			<td>MDA-MB-231 / Luciferase (Bsd) stable cells</td>
			<td>GenTarget Inc</td>
			<td>SC059-Bsd</td>
			<td>Luciferase-expressing cells sued to assess si-NP bioactivity</td>
		</tr>
		<tr>
			<td>monobasic sodium phosphate monohydrate</td>
			<td>Millipore Sigma</td>
			<td>S9638</td>
			<td></td>
		</tr>
		<tr>
			<td>Scarmbled siRNA</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Antisense Strand Sequense: AUACGCGUAUUAUACGCGAUUAACGAC Sense Strand Sequense: CGUUAAUCGCGUAUAAUACGCGUA*T* *DNA bases</td>
		</tr>
		<tr>
			<td>square polystyrene cuvettes</td>
			<td>Fisher Scientific</td>
			<td>14-955-129</td>
			<td>4.5 mL capacity</td>
		</tr>
		<tr>
			<td>TEM grids</td>
			<td>Ted Pella, Inc.</td>
			<td>1GC50</td>
			<td>PELCO Center-Marked Grids, 50 mesh, 3.0mm O.D., Copper</td>
		</tr>
		<tr>
			<td>Trisodium citrate dihydrate</td>
			<td>Millipore Sigma</td>
			<td>S1804</td>
			<td></td>
		</tr>
		<tr>
			<td>uranyl acetate</td>
			<td>Polysciences, Inc.</td>
			<td>21447-25</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation of neutrally-charged, ph-responsive polymeric nanoparticles for cytosolic sirna delivery

표적으로 하는 분자 의학으로 siRNA의 성공은 병리학 조직 내 세포에 대 한 효율적인 사이토 졸 전달에 달려 있습니다. 이전 ' undruggable ' 간 질환 표적을 siRNA로 치료 하기 위한 임상 성공이 달성 되었다. 그러나 효율적인 종양 siRNA 전달은 긴 순환 시간, 틈새 장기의 회피 (예: 간과 신장) 및 종양 침투 및 유지 를 포함 하는 추가적인 약동 학적 설계 고려 사항을 필요로 합니다. 여기서, 우리는 특히 종양과 같은 비 간 조직에 효율적인 siRNA 전달을 위해 설계 된 중합체 나노 입자의 제제 및 시험관 내 물리 화학적/생물학적 특성화를 설명 한다. 상기 siRNA 나노 입자는 폴 리 이온 복합체를 형성 하는 siRNA와 디 블록 공중 합체 (dimethylamino) 에틸 메타 크 릴레이 트코뷰 틸 메타 크 릴레이 트) (PEG-db)의 정전기 적 복합체에 의해 제조 된다 ( 상기 siRNA는 폴 리 플렉스 코어 내에 금속 이온이 격리 되 고, PEG는 친수성, 중 화제의 코로나를 형성 한다. 더욱이, 상기 DB 블록은 내 상 염색체 통로의 소포가 산성화 함에 따라 막 용 해 되 고 (< pH 6.8), 내 상 염색체의 탈출 및 siRNA의 사이토 솔 릭 전달을 유발 한다. SiRNA의 물리 화학적 특성을 특성화 하는 방법으로는 크기, 표면 전 하, 입자 형태학 및 siRNA 하 중 등이 기재 되어 있다. SiRNA 나노 입자의 생물 활성은 신속 하 고 높은 처리량의 유전자 침묵 분석에서 모델 유전자로 서 루시퍼 라 제를 사용 하 여 측정 된다. 이러한 초기 테스트를 통과 한 설계 (예: PEG-DB 기반 폴 리 플렉스)는 종양 또는 병리학의 다른 사이트에 대 한 siRNA의 전달을 평가 하는 전 임상 동물 연구로의 번역에 적합 한 것으로 간주 됩니다.

생체 내 siRNA 전달을 위한 효과적인 si-NPs의 몇 가지 필수적인 특성은 적절 한 크기 (~ 200 nm 직경), siRNA 패키징 및 유전자 침묵 생물 활성 이다. 이것은 완전 한 목록 (토론에서 언급 된 대로)이 아니지만, 이러한 기본 특성은 제제의 추가 테스트를 고려 하기 전에 확인 되어야 합니다.
도 2 는 제제 화 시의 SI-...

Watch this Scientific Journal Video about Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery at JoVE.com

Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery

화학적 성질을 준비 및 특성화 하는 방법 및 중성 충전 된, pH 반응 siRNA 나노 입자의 생물 활성이 제시 된다. 성공적인 siRNA에 대 한 기준은 크기, 형태학, 표면 전 하, siRNA 하 중 및 유전자 침묵과 같은 나노 의약품에 대해 논의 된다.

사이토 솔 릭 siRNA 전달을 위한 중성 충전, pH 반응 형 고분자 나노 입자의 제조

The success of siRNA as a targeted molecular medicine is dependent upon its efficient cytosolic delivery to cells within the tissue of pathology. Clinical ...

현재 프로토콜은 연구원이 siRNA 로드 된 나노 입자를 생성하고 이러한 나노 입자를 적절하게 특성화하여 후속 연구 전에 동물에 대한 투여적합성을 보장하기 때문에 중요합니다. 이러한 접근법의 장점은 siRNA의 생체 이용률을 증가시키고 중하되어 전신 투여에 적합한 나노입자를 생성하는 나노입자를 생산하는 것이다. 이 기술은 siRNA 나노 입자암, 심혈관 질환 및 자가 면역 질환을 포함한 전신 투여가 필요한 무수한 질병을 치료하기 위해 적용될 수 있기 때문에 영향을 미칩니다.시작하려면 밀리리터당 33.3 밀리그램의 농도로 에탄올에 폴리머를 녹이고 용해를 보장하기 위해 저어줍니다. 그런 다음 파이펫을 사용하여 폴리머 용액을 10 밀리머 구연산 버퍼로 이송하여 밀리리터당 3.33 밀리그램의 농도에 도달합니다. 50 마이크로몰라의 농도를 달성하기 위해 작은 간섭 RNA를 포함하는 튜브에 증류수를 추가합니다.10의 인산염 비율을 달성하기 위해 위아래로 파이프팅하여 폴리머 및 작은 간섭 RNA 용액을 튜브에 철저히 혼합한다. 튜브를 주변 온도에서 30분 동안 배치합니다. 그런 다음 pH 8에서 1밀리미터 인산염 버퍼1밀리리터를 튜브에 추가하여 밀리리터당 0.28 밀리그램의 농도를 달성하고 튜브를 피펫팅하거나 반전하여 부드럽게 섞습니다.최종 pH가 중성임을 확인하기 위해, 약 7.2 ~ 7.5, pH 테스트 스트립에 작은 간섭 RNA 나노 입자 용액의 파이펫 10 마이크로리터. 먼저, 밀리리터당 0.28 밀리그램의 농도로 밀리리터당 0.28밀리리터를 정사각형 석영 또는 폴리스티렌 큐벳으로 여과하여 다이나믹 라이트 산란 시료를 준비한다. 그런 다음 제조업체의 사양에 따라 동적 광 산란 장비를 사용하여 크기와 표면 충전 측정을 기록합니다.전송 전자 현미경을 사용하여 작은 간섭 RNA 나노 입자의 크기 및 형태를 확인하기 위해 먼저 각 TEM 그리드에 밀리리터 당 0.28 밀리그램에서 여과 된 작은 간섭 RNA 나노 입자 용액의 5 마이크로 리터를 추가합니다. 그리드를 주변 온도에 60초 동안 배치합니다. 3초 동안 필터 용지로 블롯 드라이.다음으로 각 그리드에 3%의 우라일 아세테이트 용액 5개를 추가하고 20초 동안 배양합니다. 블롯은 3초 동안 건조합니다. 그런 다음 전염 전자 현미경 검사법에서 이미징하기 전에 밤새 건조기에 그리드를 놓습니다.아가로즈 젤 지체를 수행하기 위해 먼저 2 그램의 전기 포망등급 아가로즈 파우더를 100 밀리리터에 1X 트리아세테이트-EDTA 버퍼를 비커에 넣어 2%의 아가로즈 젤을 생산합니다. 아가로즈를 중단하기 위해 저어주세요. 모든 아가로즈가 용해 될 때까지 1 ~ 3 분 동안 가열전자 레인지에 발견 된 비커를 놓습니다.냉각되면 밀리리터당 10밀리그램의 농도로 에티듐 브로마이드 5마이크로리터를 비커에 넣고 잘 섞어보세요. 그런 다음 아가로즈를 젤 트레이에 붓고 빗을 놓아 우물을 생산합니다. 젤을 30분 동안 건조시키십시오.조심스럽게 빗을 제거하여 적재 우물을 남기고 1X Tris-acetate-EDTA 버퍼를 젤 트레이에 부어 최대 채우기 라인을 채웁니다. 그런 다음 SDS없이 염색염을 적재하거나 각 작은 간섭 RNA 나노 입자 제형에 대한 파라핀 필름에 대한 두 개의 마이크로 리터 알리쿼트를 다른 질소에서 인산염 비에 배치합니다. 파이펫은 파라핀 필름에 염색을 적재하는 작은 간섭 RNA 나노 입자 용액의 10 마이크로리터를 혼합합니다.아가로즈 젤 웰에 혼합물을 넣습니다. 전기 전광 시스템을 전원 공급 장치에 연결하고 전압 소스를 100볼트에서 35분 동안 또는 샘플이 젤 길이의 80%를 통과할 때까지 전력 공급 장치에 연결합니다. 트레이에서 UV 트랜실루미나이터로 젤을 옮기고 제조업체의 사양에 따라 UV 트랜실루미나이터에 있는 작은 간섭 RNA 밴드를 시각화한다.겔 의 바닥에 작은 간섭 RNA 대역의 실종에 기초하여 인산염 비율에 최적의 질소를 결정합니다. 모델 유전자 루시파아제를 노크하기 위해, 10%의 밀도로 DMEM을 가진 96웰 블랙 월판에서 첫 번째 종자 루시파아제를 발현하는 세포는 웰당 2, 000 세포의 밀도로. 세포를 부착할 수 있도록 밤새 인큐베이터에 접시를 넣습니다.아침에 는 미디어를 제거하고 100 나노 몰라의 최종 작은 간섭 RNA 농도에 대한 전체 혈청 매체로 희석 작은 간섭 RNA 나노 입자의 우물 당 10 마이크로 리터를 추가합니다. 작은 간섭 RNA 나노 입자로 세포를 취급하기 위해 24 시간 동안 인큐베이터에 우물을 반환합니다. 다음 날, 밀리리터 D-루시페린 당 150 마이크로그램을 포함하는 전체 혈청 매체로 미디어를 대체하십시오.플레이트 판독기에서 발광을 측정하기 전에 실온에서 5분 동안 세포를 배양합니다. 그런 다음 D-luciferin이 없는 신선한 풀 세럼 미디어로 미디어 다과를 두 번 반복한 다음 24시간 동안 인큐베이션을 반복합니다. 미디어를 밀리리터 D-루시페린당 150밀리그램이 함유된 전체 혈청 매체로 교체하고 실온에서 5분 동안 배양합니다.48시간 시점에서 발광을 측정합니다. 세로 연구의 경우, 생체 안전 캐비닛 외부의 경우 우물 판 위에 뚜껑을 두어 멸균 조건하에서 세포를 유지하고 루시페린 함유 미디어를 신선한 전체 매체로 대체한 후 인큐베이션을 계속하십시오. 동적 광 산란 측정은 작은 간섭 RNA 나노 입자 하나 35 나노 미터의 평균 직경을 가지고 있음을 보여줍니다.피크 폭이 좁은 단일 피크의 존재는 단모달 분포와 낮은 다각형성을 나타냅니다. TEM 측정은 동적 광 산란으로부터의 크기 측정을 확인하여 작은 간섭 RNA 나노입자의 균일한 집단의 존재를 시사하고 작은 간섭 RNA 나노입자의 구형 형태를 드러냈다. 준비 단계에서 중합체의 너무 높은 농도는 200 나노미터 이상의 바람직하지 않은 직경, 멀티 모달 및 다분산 인구, 그리고 뚜렷한 입자 형태를 형성하지 않는 용액의 골재에서 작은 간섭 RNA 나노 입자 2를 초래했다.작은 간섭 RNA 나노 입자 하나 와 두 개의 디스플레이 중립 표면 전하 는 거의 제로에 의해 표시 제타 잠재적 인 값을 의미한다. 아가로즈 겔 지체 분석은 중합체에 작은 간섭 RNA의 복합화를 나타내는 젤 바닥에 작은 간섭 RNA 밴드의 실종을 나타낸다. 중합체 복합소형 간섭 RNA는 겔을 통해 마이그레이션할 수 없으며 따라서 하중 우물 근처의 겔 의 상부에 시각화된다.인산염 에 대한 질소가 증가함에 따라 겔 바닥에 있는 작은 간섭 RNA 대역의 강도감소로 나타난 바와 같이 작은 간섭 RNA 복합체가 증가한다. 생리활성 루시파아제 작은 간섭 RNA 나노입자 1은 스크램블 컨트롤과 비교했을 때 루시파라기 활성을 현저히 감소시켰다. 대조적으로, 루시파라제작은 간섭 RNA 나노입자 2는 생리활성으로 간주되지 않는다.원하는 물리화학적 특성을 가진 일관된 siRNA 나노 입자를 생성하려면 적절한 농도를 가진 폴리머 솔루션을 사용하고 프로토콜의 각 단계에서 완충액의 pH를 검증해야 합니다. 우리의 연구에서 이러한 방법을 사용하여 우리는 이전에 마약이 없는 암을 일으키는 유전자를 위한 siRNA 나노 입자 기지를 둔 치료를 생성하고 유방암의 전 임상 모형에 있는 이 치료의 효험을 시험할 수 있었습니다.

Research

JoVE Journal

Bioengineering

Formulation of Diblock Polymeric Nanoparticles through Nanoprecipitation Technique

Nanoprecipitation 기법을 통해 디블록 고분자 Nanoparticles의 제형

Nanotechnology is a relatively new branch of science that involves harnessing the unique properties of particles that are nanometers in scale ...

연구

생체공학

Evaluation of Polymeric Gene Delivery Nanoparticles by Nanoparticle Tracking Analysis and High-throughput Flow Cytometry

고분자 유전자 배달에 대한 평가는 Nanoparticle 추적 분석 및 높은 처리량 유동 세포 계측법에 의해 나노 입자

Non-viral gene delivery using polymeric nanoparticles has emerged as an attractive approach for gene therapy to treat genetic diseases1 and as a ...

Programming Stem Cells for Therapeutic Angiogenesis Using Biodegradable Polymeric Nanoparticles

생분해 성 고분자 나노 입자를 사용하여 치료 혈관 신생에 대한 프로그래밍 줄기 세포

Controlled vascular growth is critical for successful tissue regeneration and wound healing, as well as for treating ischemic diseases such as stroke, ...

Microfluidic Fabrication of Polymeric and Biohybrid Fibers with Predesigned Size and Shape

미리 설계된 크기와 모양의 중합체 및 바이오 하이브리드 섬유의 미세 유체 제조

A &#8220;sheath&#8221; fluid passing through a microfluidic channel at low Reynolds number can be directed around another &#8220;core&#8221; stream and ...

Harmonic Nanoparticles for Regenerative Research

재생 연구를위한 고조파 나노 입자

In this visualized experiment, protocol details are provided for in vitro labeling of human embryonic stem cells (hESC) with second harmonic generation ...

Porous Silicon Microparticles for Delivery of siRNA Therapeutics

siRNA를 치료제의 전달을위한 다공성 실리콘 미세 입자

Small interfering RNA (siRNA) can be used to suppress gene expression, thereby providing a new avenue for the treatment of various diseases. However, the ...

Polymeric Microneedle Array Fabrication by Photolithography

포토 리소그래피에 의해 고분자 미세 바늘 어레이 제작

This manuscript describes the fabrication of polymeric microneedle (MN) arrays by photolithography. It involves a simple mold-free process by using a ...

Fabricating Superhydrophobic Polymeric Materials for Biomedical Applications

바이오 메디컬 응용 프로그램에 대한 초 소수성 고분자 재료를 제조

Superhydrophobic materials, with surfaces possessing permanent or metastable non-wetted states, are of interest for a number of biomedical and industrial ...

Delivery of Therapeutic siRNA to the CNS Using Cationic and Anionic Liposomes

양이온과 음이온 리포좀을 사용 CNS에 치료의 siRNA 배달

Prion diseases result from the misfolding of the normal, cellular prion protein (PrPC) to an abnormal protease resistant isomer called PrPRes.  The ...