Name: spatial and temporal control of murine melanoma initiation from mutant melanocyte stem cells
Uploaded: 2019-06-07T14:45:00
Description: Watch this Scientific Journal Video about Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells at JoVE.com

이 작업은 W81XWH-16-1-0272에서 피어 검토 된 암 연구 프로그램을 통해 건강 문제에 대 한 국방부 장관 비서에 의해 지원 되었습니다. 의견, 해석, 결론 및 권장 사항은 저자의 것 이며 반드시 국방부가 승인 하지는 않습니다. 이 작업은 또한 A.C. 흰색에 코넬 줄기 세포 프로그램에서 종자 그랜트에 의해 지원 되었다. H. 달은 척추 동물 유전체학 학자 프로그램에 대 한 코넬 센터에 의해 지원 되었다.

모든 동물 절차는 코넬 대학 기관 동물 관리 및 사용 위원회 (IACUC)에 따라 수행 됩니다.
1. 준비
<ol><li>
12 일간의 산 후 마우스에서 꼬리 클립을 수집 하 고 400 µ L의 0.05에서 NaOH를 95 ° c에서 1 시간 동안 µ를 첨가 하 고 1M(1 M), pH 7의 1m 인 트리 스-HCl을 32 추가 하였다. 유전자 형 마우스는 잭슨 실험실을 통해 제공 된 PCR 프로토콜에 따라, 마우스를 관심의 유전자 형으로 식...

<ol>
	<li>Wernli, K. J., Henrikson, N. B., Morrison, C. C., Nguyen, M., Pocobelli, G., Blasi, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Screening+for+skin+cancer+in+adults:+updated+evidence+report+and+systematic+review+for+the+US+preventive+services+task+force.">Screening for skin cancer in adults: updated evidence report and systematic review for the US preventive services task force.</a> The Journal of the American Medical Association. 316 (4), 436-447 (2016).</li><li>Siegel, R. L., Miller, K. D., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+statistics,+2018.">Cancer statistics, 2018.</a> CA: A Cancer Journal for Clinicians. 68 (1), 7-30 (2018).</li><li>White, A. C., Lowry, W. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refining+the+role+for+adult+stem+cells+as+cancer+cells+of+origin.">Refining the role for adult stem cells as cancer cells of origin.</a> Trends in Cell Biology. 25 (1), 11-20 (2015).</li><li>Moon, H., Donahue, L. R., White, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+cancer+cells+of+origin+in+cutaneous+tumors.">Understanding cancer cells of origin in cutaneous tumors.</a> Cancer Stem Cells. , 263-284 (2016).</li><li>Blanpain, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracing+the+cellular+origin+of+cancer.">Tracing the cellular origin of cancer.</a> Nature Cell Biology. 15 (2), 126-134 (2013).</li><li>Moon, H., Donahue, L. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Melanocyte+stem+cell+activation+and+translocation+initiate+cutaneous+melanoma+in+response+to+UV+exposure.">Melanocyte stem cell activation and translocation initiate cutaneous melanoma in response to UV exposure.</a> Cell Stem Cell. 21 (5), 665-678 (2017).</li><li>Moon, H., White, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+path+from+melanocyte+stem+cells+to+cutaneous+melanoma+illuminated+by+UVB.">A path from melanocyte stem cells to cutaneous melanoma illuminated by UVB.</a> Molecular &#38; Cellular Oncology. 5 (2), e1409864 (2018).</li><li>Rabbani, P., Takeo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+activation+of+Wnt+in+epithelial+and+melanocyte+stem+cells+initiates+pigmented+hair+regeneration.">Coordinated activation of Wnt in epithelial and melanocyte stem cells initiates pigmented hair regeneration.</a> Cell. 145 (6), 941-955 (2011).</li><li>Chou, W. C., Takeo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+migration+of+follicular+melanocyte+stem+cells+to+the+epidermis+after+wounding+or+UVB+irradiation+is+dependent+on+Mc1r+signaling.">Direct migration of follicular melanocyte stem cells to the epidermis after wounding or UVB irradiation is dependent on Mc1r signaling.</a> Nature Medicine. 19 (7), 924-929 (2013).</li><li>Keyes, B. E., Segal, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nfatc1+orchestrates+aging+in+hair+follicle+stem+cells.">Nfatc1 orchestrates aging in hair follicle stem cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (51), (2013).</li><li>M&#252;ller-R&#246;ver, S., Handjiski, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+guide+for+the+accurate+classification+of+murine+hair+follicles+in+distinct+hair+cycle+stages.">A comprehensive guide for the accurate classification of murine hair follicles in distinct hair cycle stages.</a> The Journal of Investigative Dermatology. 117 (1), 3-15 (2001).</li><li>Kastenmayer, R. J., Fain, M. A., Perdue, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+retrospective+study+of+idiopathic+ulcerative+dermatitis+in+mice+with+a+C57BL/6+background.">A retrospective study of idiopathic ulcerative dermatitis in mice with a C57BL/6 background.</a> Journal of the American Association for Laboratory Animal Science&#8239;: JAALAS. 45 (6), 8-12 (2006).</li><li>Vultur, A., Herlyn, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SnapShot:+melanoma.">SnapShot: melanoma.</a> Cancer Cell. 23 (5), (2013).</li><li>Dankort, D., Curley, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Braf(V600E)+cooperates+with+Pten+loss+to+induce+metastatic+melanoma.">Braf(V600E) cooperates with Pten loss to induce metastatic melanoma.</a> Nature Genetics. 41 (5), 544-552 (2009).</li><li>Viros, A., Sanchez-Laorden, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultraviolet+radiation+accelerates+BRAF-driven+melanomagenesis+by+targeting+TP53.">Ultraviolet radiation accelerates BRAF-driven melanomagenesis by targeting TP53.</a> Nature. 511 (7510), 478-482 (2014).</li></ol>

피부 흑색 종 종양에서 자주 발견 되는 홀 마크 유전 변경은 잘 설명 되어 있습니다13. 가장 지배적 인 드라이버 돌연변이는 BrafV600E이 고, brafV600E매개 흑색 종을 위한 유전적으로 조작 된 마우스 모델은 보 센 버그 그룹14 에 의해 생성 되 고 잭슨 실험실에서 증 착 되었다. 이 마우스 모델을 사용 하 여, 우리의 최근 연구는 등 쪽 피?...

흑색 종, 멜 라 세포 종양의 악성 형태는 대부분의 피부 암 사망1을 담당 하는 피부 흑색 종으로 피부의 가장 공격적인 암입니다. 미국에서, 흑색 종은 일반적으로 진단 됩니다; 20182에서 추정 된 새로운 암 발병 사례 중 5th 내지 6번째 가장 흔한 암 유형으로 예상 된다. 더욱이, 전반적인 암 발생률은 최근 수십 년 동안 점진적으로 감소 하는 경향을 보이고 있지만, 지난 몇 십년 동안 피부 흑색 종 발생률은 두 성별 모두에서 지속적이 고 급속 한증가를 보여줍니다.
피부 흑색 종을 보다 효율적으로 퇴치 하기 위해, 임상적으로 효과적인 예방 방법을 더 잘 식별 하기 위해 원산지 세포에서 흑색 종 발달의 초기 사건을 명확 하 게 이해 하는 것이 중요 합니다. 현재 성체 줄기 세포는 피부 조직3,4,5등 다양 한 유형의 장기에서 암의 세포 기원으로 종양 형성에 크게 기여할 수 있는 것으로 알려져 있습니다. 마찬가지로, 뮤 린 등 쪽 피부에 있는 성체 멜 라 닌 세포 (MCSCs)는 Ras/Raf 및 Akt 통로의 변종 활성화 시 기원의 흑색 종 세포로 서 일할 수 있다6. 그러나, 이러한 발암 돌연변이 단독은 정 맥 내에서 종양 형성을 효율적으로 유도할 수 없다. 멜 리 세포 종양은 결국 MCSCs 자연 헤어 사이클링 동안 활성화 될 때 개발. 그러나,이 프로토콜에서, 우리는 인위적으로 흑색 종 개시6의 정확한 통제를 촉진 하는 종양에 걸리기 쉬운 mcscs의 세포 활성화를 유도 하는 방법을 설명할 것입니다,7.
여기에 설명 된 방법을 통해 서, 피부 흑색 종의 공간적 및 시간적 제어는 종양 발생 가능성이 있는 MCSCs에서 시작 하 여 Pten 발현 손실과 함께 발암 성 brafV600E 을 발현 하 여 성공적으로 수행 될 수 있습니다. 이전에 보고 된6. 이 방법은 탈모를 통해 모 낭 줄기 세포 활성화를 보여주는 이전 연구 결과를 통합 하 고 뮤 린 피부를 UV-B에 노출 시키는 방법 뿐만 아니라 모 낭에 거주 하는 MCSCs의 활성화와이 세포의 이식에 도움이 될 수 있습니다. 간 모 낭 표 피6,9,10에 대 한 하위 집단. 이러한 생체 내 모델 시스템은 피부에 흑색 종의 현저한 개시를 유도할 수 있는 흑색 종 경향이 있는 MCSCs의 세포 상태를 변화 시킬 수 있는 생리 적 및 환경적 변화가 어떻게 하는지에 관한 귀중 한 정보를 제공할 수 있다.

<table>
	<tbody>
		<tr>
			<td>Tamoxifen</td>
			<td>Sigma</td>
			<td>T5648-1G</td>
			<td>For systemic injection</td>
		</tr>
		<tr>
			<td>Tamoxifen</td>
			<td>Cayman Chemical</td>
			<td>13258</td>
			<td>For systemic injection</td>
		</tr>
		<tr>
			<td>Corn oil</td>
			<td>Sigma</td>
			<td>45-C8267-2.5L-EA</td>
			<td></td>
		</tr>
		<tr>
			<td>4OH-tamoxifen</td>
			<td>Sigma</td>
			<td>H7904-25MG</td>
			<td>For topical treatment</td>
		</tr>
		<tr>
			<td>26g 1/2&#34; needles</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>1 mL syringe</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Pet hair trimmer</td>
			<td>Wahl</td>
			<td>09990-502</td>
			<td></td>
		</tr>
		<tr>
			<td>Hair removal cream</td>
			<td>Nair</td>
			<td>n/a</td>
			<td>Available at most drug stores</td>
		</tr>
		<tr>
			<td>Cotton swabs</td>
			<td>various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Ultraviolet light bulb</td>
			<td>UVP</td>
			<td>95-0042-08</td>
			<td>model XX-15M midrange UV lamp</td>
		</tr>
		<tr>
			<td>200 proof ethanol</td>
			<td>various</td>
			<td></td>
			<td>pure ethanol</td>
		</tr>
		<tr>
			<td>Histoplast PE</td>
			<td>Fisher Scientific</td>
			<td>22900700</td>
			<td>paraffin pellets</td>
		</tr>
		<tr>
			<td>Neutral Buffered Formalin, 10%</td>
			<td>Sigma</td>
			<td>HT501128-4L</td>
			<td></td>
		</tr>
		<tr>
			<td>Clear-Rite 3</td>
			<td>Thermo Scientific</td>
			<td>6901</td>
			<td>xylene substitute</td>
		</tr>
		<tr>
			<td>O.C.T. Compound</td>
			<td>Thermo</td>
			<td>23730571</td>
			<td></td>
		</tr>
		<tr>
			<td>Tissue Cassette</td>
			<td>Sakura</td>
			<td>89199-430</td>
			<td>for FFPE processing</td>
		</tr>
		<tr>
			<td>Cryomolds</td>
			<td>Sakura</td>
			<td>4557</td>
			<td>25 x 20 mm</td>
		</tr>
		<tr>
			<td>FFPE metal mold</td>
			<td>Leica</td>
			<td>3803082</td>
			<td>24 x 24 mm</td>
		</tr>
		<tr>
			<td>Isoflurane</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Anesthesia inhalation system</td>
			<td>various</td>
			<td></td>
			<td>Veterinary grade</td>
		</tr>
		<tr>
			<td>Fine scissor</td>
			<td>FST</td>
			<td>14085-09</td>
			<td>Straight, sharp/sharp</td>
		</tr>
		<tr>
			<td>Fine scissor</td>
			<td>FST</td>
			<td>14558-09</td>
			<td>Straight, sharp/sharp</td>
		</tr>
		<tr>
			<td>Metzenbaum</td>
			<td>FST</td>
			<td>14018-13</td>
			<td>Straight, blunt/blunt</td>
		</tr>
		<tr>
			<td>Forcep</td>
			<td>FST</td>
			<td>11252-00</td>
			<td>Dumont #5</td>
		</tr>
		<tr>
			<td>Forcep</td>
			<td>FST</td>
			<td>11018-12</td>
			<td>Micro-Adson</td>
		</tr>
		<tr>
			<td>Tyr-CreER; LSL-BrafV600E; Pten-f/f</td>
			<td>Jackson Labs</td>
			<td>13590</td>
			<td></td>
		</tr>
		<tr>
			<td>LSL-tdTomato</td>
			<td>Jackson Labs</td>
			<td>007914</td>
			<td>ai14</td>
		</tr>
		<tr>
			<td>Cre-1</td>
			<td></td>
			<td>n/a</td>
			<td>GCATTACCGGTCGATGCAACGAGTGATGAG</td>
		</tr>
		<tr>
			<td>Cre-2</td>
			<td></td>
			<td>n/a</td>
			<td>GAGTGAACGAACCTGGTCGAAATCAGTGCG</td>
		</tr>
		<tr>
			<td>Braf-V600E-1</td>
			<td></td>
			<td>n/a</td>
			<td>TGAGTATTTTTGTGGCAACTGC</td>
		</tr>
		<tr>
			<td>Braf-V600E-2</td>
			<td></td>
			<td>n/a</td>
			<td>CTCTGCTGGGAAAGCGGC</td>
		</tr>
		<tr>
			<td>Kras-G12D-1</td>
			<td></td>
			<td>n/a</td>
			<td>AGCTAGCCACCATGGCTTGAGTAAGTCTGCA</td>
		</tr>
		<tr>
			<td>Kras-G12D-2</td>
			<td></td>
			<td>n/a</td>
			<td>CCTTTACAAGCGCACGCAGACTGTAGA</td>
		</tr>
		<tr>
			<td>Pten-1</td>
			<td></td>
			<td>n/a</td>
			<td>ACTCAAGGCAGGGATGAGC</td>
		</tr>
		<tr>
			<td>Pten-2</td>
			<td></td>
			<td>n/a</td>
			<td>AATCTAGGGCCTCTTGTGCC</td>
		</tr>
		<tr>
			<td>Pten-3</td>
			<td></td>
			<td>n/a</td>
			<td>GCTTGATATCGAATTCCTGCAGC</td>
		</tr>
		<tr>
			<td>tdTomato-1</td>
			<td></td>
			<td>n/a</td>
			<td>AAGGGAGCTGCAGTGGAGTA</td>
		</tr>
		<tr>
			<td>tdTomato-2</td>
			<td></td>
			<td>n/a</td>
			<td>CCGAAAATCTGTGGGAAGTC</td>
		</tr>
		<tr>
			<td>tdTomato-3</td>
			<td></td>
			<td>n/a</td>
			<td>GGCATTAAAGCAGCGTATCC</td>
		</tr>
		<tr>
			<td>tdTomato-4</td>
			<td></td>
			<td>n/a</td>
			<td>CTGTTCCTGTACGGCATGG</td>
		</tr>
	</tbody>
</table>

spatial and temporal control of murine melanoma initiation from mutant melanocyte stem cells

피부 흑색 종은 가장 공격적인 피부 암으로 잘 알려져 있습니다. 비록 위험 요인과 주요 유전 변화는 계속 해 서 증가 하는 깊이로 문서화 될 수 있지만, 피부 흑색 종의 발병 률은 최근 수십 년 동안 급속 하 고 지속적인 증가를 보이고 있다. 효과적인 예방 방법을 찾기 위해, 피부에 흑색 종 개시의 초기 단계를 이해 하는 것이 중요 합니다. 이전 데이터는 종양 생성 돌연변이 및 유전적 변경을 발현 할 때 성체 피부 조직에서 여 포 멜 라 닌 세포 (MCSCs)가 원산지의 흑색 종 세포로 작용할 수 있다는 것을 입증 하였다. 흑색 종에 걸리기 쉬운 MCSCs에서 발생 하는 종양은 대기에서 활성 상태로의 MCSCs 전이로 인해 유발 될 수 있다. 흑색 종 발생 가능한 MCSCs에서의 이러한 전환은 모 낭 줄기 세포의 활성 상태 또는 자외선-b와 같은 외적 환경적 요인을 통해 어느 하나의 변조에 의해 촉진 될 수 있다. 이러한 요인은 화학 탈모에 의해 실험실에서 인위적으로 조작 될 수 있으며,이는 모 낭 줄기 세포와 MCSCs를 정 동작 상태에서 활성 상태로, 그리고 벤치탑 광을 사용 하 여 UV-B 노출로 전환 시키는 원인이 됩니다. 이 방법 뮤 린 등 쪽 피부에 있는 피부 흑색 종 개시의 성공적인 공간 그리고 시간적 통제를 제공 합니다. 따라서, 이러한 생체 내 모델 시스템은 피부 흑색 종 개시의 초기 단계를 정의 하 고 종양 예방을 위한 잠재적인 방법을 시험 하는데 사용 될 수 있는 가치가 있을 것 이다.

화학 탈모에 의해 유도 된 피부 흑색 종 개시
화학 탈모의 절차는 그림 2에 묘사 되어 있습니다. 생쥐가 7 주 후 나 탈 때, 등 쪽 피부가 telogen에 있습니다. Telogen 동안, 모 낭 줄기 세포 및 MCSCs는 정 동작, 휴식 상태에 있는 것으로 알려져 있다. 피부는 면도 후 중요 한 머리카락의 성장을 표시 ?...

Watch this Scientific Journal Video about Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells at JoVE.com

Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells

돌연변이 멜 뮤 린 줄기 세포에서 시작 하는의 공간적 및 시간적 제어

다음 절차는 유전자 조작 된 마우스 모델을 사용 하 여 뮤 린 등 피부에 멜 라 세포 종양 개시의 공간적 및 시간적 제어를 위한 방법을 설명 합니다. 이 프로토콜은 거시적 뿐만 아니라 현미경 피부 흑색 종 개시를 설명 합니다.

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented ...

흑색종은 전 세계적으로 널리 진단되며, 발병률이 증가합니다. 이 프로토콜은 흑색종 개시의 초기 단계가 신중하게 통제될 수 있게 해주며, 그 발달의 연구를 용이하게 합니다. 흑색세포 줄기 세포 활성화의 시간과 위치를 제어함으로써, 우리는 줄기 세포 인구 내의 변화와 새로운 균주 흑색종 개시 내의 변화를 분별할 수 있는 능력을 가지고 있습니다.이 절차를 시연하는 것은 실험실대학원생인 김다히름과 윤예안이 될 것이다. 시술을 시작하기 2~3일 전에 전기 트리머를 사용하여 7주 된 각 마취된 마우스에서 등갈 피부를 면도합니다. 실험 당일면 면봉을 사용하여 노출된 피부에 얇은 탈모 크림층을 적용합니다.크림을 고르게 바르면 깨끗한 면봉을 사용하여 크림을 제거하고 젖은 천으로 부드럽게 닦아 잔류 크림을 제거하십시오. 그런 다음 전체 복구될 때까지 모니터링하여 각 마우스를 홈 케이지로 반환합니다. UV-B 조사의 경우, 원하는 부위만 노출되도록 UV-B 보호 재료로 등대 피부를 덮고 UV 내성 뚜껑으로 UV 챔버를 덮습니다.그런 다음 UV-B 램프를 켜서 마우스를 적절한 실험 기간 동안 조사한 후 마우스를 전체 복구할 때까지 모니터링하여 빈 케이지로 되돌린다. 피부 샘플을 격리하려면 전기 트리머를 사용하여 안락사 된 쥐의 등대 피부 영역에서 머리카락을 제거하고 노출된 피부를 보풀이없는 조직으로 가볍게 브러시하여 영역을 지웁웁습니다. 꼬리 의 바닥 바로 위에 날카로운 가위로 작은 절개를하고 피하 결합 조직을 분리하기 위해 절개에 크고 무딘 가위를 삽입합니다.날카로운 가위를 사용하여, 신중하게 조직 샘플을 격리하고 깨끗한 종이 타월에 절제 된 피부 조직을 배치하기 위해 관심의 피부 영역의 가장자리를 따라 잘라. 그런 다음 칙칙한 집게를 사용하여 피부를 스트레칭하여 수건을 부착하고 팽팽하게 합니다. 모든 샘플을 수확하면, 피부 샘플과 종이 타월을 주름에 바로 인접한 접힌 필터 용지에 넣고 시료가 매끄럽고 접히거나 구겨지지 않도록 주의하십시오.필터 용지의 측면을 스테이플로 닫고 용지를 다듬습니다. 그런 다음 실온에서 3~5시간 동안 10% 중성 버퍼링 포머닌에 샘플을 완전히 담그고, 5분간 의 세척을 사용하여 티슈를 탈온화된 물에 세척합니다. 두 번째 세척 후, 피부 조직에서 잔류 재료를 조심스럽게 제거하고 샘플의 가장자리를 다듬어 들쭉날쭉하지 않도록 합니다.다음으로 각 샘플에서 3개의 적발 절단을 만들어 스트립의 너비가 5밀리미터 를 넘지 않도록 하고, 샘플이 폭이 20밀리미터 이하가 되도록 횡방향 컷을 만듭니다. 최적의 절삭 온도 또는 OCT 매체를 포함하는 저온 몰드를 세로 방향으로 배치하고 10월 위에 4~5개의 스킨을 배치합니다. 모든 조각이 제자리에 있을 때, 두 쌍의 미세 한 집게를 사용하여 각 피부의 긴 가장자리를 극저온 금형의 바닥에 가져와 서 샘플이 10 월 내에 수직이고 곰팡이의 베이스에 수직이되도록하십시오.그런 다음 금형을 두 번째 입술에 추가 10월로 채우고 금형을 드라이 아이스 조각의 평평한 표면에 놓고, 집게를 사용하여 블록이 필요에 따라 동결되기 시작하면 이송 중에 이동했을 수 있는 모든 피부 조각을 조정합니다. 생쥐가 산후 7주일 때, 그들의 등갈 피부는 텔로겐에 있습니다. 텔로겐 동안, 모낭과 멜라닌 세포줄기 세포는 정지 휴식 상태에 있는 것으로 알려져 있고, 피부는 면도 후에 중요한 머리 성장을 보여주지 말아야 합니다.화학 적 분 멸, 그러나, 모낭 줄기 세포 활성화를 유도할 수 있습니다., 관심의 영역 내에서 상당한 머리 성장을 유도. 화학적 탈취가 모낭과 멜라닌세포 줄기세포의 활성화를 유의로 유도할 수 있으므로, 활성 상태에서 흑색종경향이 있는 흑색세포 줄기세포는 종양을 형성할 수 있고 미세한 흑색종 개시는 화학적 탈약2주 이내에 관찰될 수 있다. UV-B 조사는 또한 정지, 종양 경향이 멜라닌세포 줄기 세포에서 종양 개시를 유도할 수 있습니다.중요한 것은, UV-B는 여포 간 피피로 그들의 여포 줄기 세포 틈새에서 멜라노시스 줄기 세포의 직접적인 전좌를 유도합니다. 더욱이, UV-B는 피부 피연전 전반에 걸쳐 흑색세포 줄기 세포 유래 피부흑색종 형성을 유도할 수 있다. 등쪽 피부와 유사하게, UV-B 유도흑색종 개시는 귀 피부와 같은 그밖 피부 지역에서 주목할 수 있습니다.실제로 UV-내성 천으로 덮인 조절 귀 피부에 비해 UV-B에 노출된 귀 피부는 흑색종 개시의 부담이 높기 때문에 더 높은 색소 침착을 보여줍니다. UV-B의 다른 복용량 마우스 피부와 멜 라 닌 세포 활동에 다른 효과 있을 수 있습니다. 따라서 실험을 시작하기 전에 조사 용량을 결정하고 최적화하는 것이 중요합니다.

Research

JoVE Journal

Cancer Research

A Mouse Model of Fatigue Induced by Peripheral Irradiation

주변 방사선 조사에 의해 유도 된 피로의 마우스 모델

Cancer-related fatigue (CRF) is a distressing and costly condition that often affects patients receiving cancer treatments, including radiation therapy. ...

연구

암 연구학

Harnessing the DNA Dye-triggered Side Population Phenotype to Detect and Purify Cancer Stem Cells from Biological Samples

DNA 염료에 의한 측면 집단 표현형을 활용하여 생물학적 샘플에서 암 줄기 세포를 검출하고 정제

Cancer is a stem cell-driven disease and eradication of these cells has become a major therapeutic goal. Deciphering vulnerabilities of Cancer Stem Cells ...

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

CRISPR/Cas9를 사용 하 여 유전자 돌연변이 Calreticulin Cytokine 종속 조 혈 모 세포에서의 종양 활동을 조사 하기 위해 편집

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to ...

Investigation of Genetic Dependencies Using CRISPR-Cas9-based Competition Assays

CRISPR-Cas9-기반 경쟁 분석 실험을 사용 하 여 유전 종속성의 조사

Gene perturbation studies have been extensively used to investigate the role of individual genes in AML pathogenesis. For achieving complete gene ...

Mesenchymal Stem Cell Isolation from Pulp Tissue and Co-Culture with Cancer Cells to Study Their Interactions

펄프 조직 문화와 공동 암 세포와 그들의 상호 작용을 공부 하에서 중간 엽 줄기 세포 분리

Cancer as a multistep process and complicated disease is not only regulated by individual cell proliferation and growth but also controlled by tumor ...

Rapid Generation of Primary Murine Melanocyte and Fibroblast Cultures

1 차적인 뮤린 멜라닌세포 및 섬유아세포 배양물의 급속한 생성

Defects in fibroblast or melanocyte function are associated with skin diseases, including poor barrier function, defective wound healing, pigmentation ...

Flow Cytometric Analysis of Mitochondrial Reactive Oxygen Species in Murine Hematopoietic Stem and Progenitor Cells and MLL-AF9 Driven Leukemia

뮤린 조혈 줄기 및 선조 세포 및 MLL-AF9 구동 백혈병에서 미토콘드리아 반응성 산소 종의 유동 세포 분석

We present a flow cytometric approach for analyzing mitochondrial ROS in various live bone marrow (BM)-derived stem and progenitor cell populations from ...

Isolation of Exosome-Enriched Extracellular Vesicles Carrying Granulocyte-Macrophage Colony-Stimulating Factor from Embryonic Stem Cells

배아 줄기 세포에서 과립구-대식세포 식민지 자극 인자를 운반하는 외식 농축 세포 외 소포의 격리

Embryonic stem cells (ESCs) are pluripotent stem cells capable of self-renewal and differentiation into all types of embryonic cells. Like many other cell ...

Isolation of Stem-like Cells from 3-Dimensional Spheroid Cultures

3차원 스페로이드 배양에서 줄기와 같은 세포의 분리

Despite advances in adult stem cell research, identification and isolation of stem cells from tissue specimens remains a major challenge. While resident ...

Preparation of Mitochondria from Ovarian Cancer Tissues and Control Ovarian Tissues for Quantitative Proteomics Analysis

난소암 조직에서 미토콘드리아의 준비 및 정량적 프로테오믹스 분석을 위한 난소 조직 제어

Ovarian cancer is a common gynecologic cancer with high mortality but unclear molecular mechanism. Most ovarian cancers are diagnosed in the advanced ...