Name: analysis of spliceosomal snrna localization in human hela cells using microinjection
Uploaded: 2019-08-06T14:45:00
Description: Watch this Scientific Journal Video about Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection at JoVE.com

이 작품은 체코 과학 재단 (18-10035S), 국가 지속 가능성 프로그램 I (LO1419), 기관 지원 (RVO68378050), 유럽 지역 개발 기금 (CZ.02.1.01/0.0/0.0/16_013/0001775)에 의해 지원되었습니다. 찰스 대학 (GAUK 134516). 우리는 또한 빛 현미경 코어 시설, IMG CAS, 프라하, 체코 (보조금에 의해 지원됩니다 (체코 - 바이오 이미징 - LM2015062)를 인정합니다.

1. 미세 주입을위한 snRNAs의 준비
<ol><li>다음 PCR 설정을 사용하여 PCR에 의한 snRNA의 전체 길이 또는 잘린/돌연변이 버전을 포함하는 DNA 템플릿을 준비합니다: 60s의 경우 98°C, 15초의 경우 98°C, 30초동안 68°C, 1분동안 72°C, 15초용 98°C35x , 5 분 동안 72 °C.</li>
	<li>순방향 프라이머는 제1 전사 뉴클레오티드의 상류에 대한 시험관내 전사에 대한 프로모터 서열을 포함해야 한다. T7 프로모터 및 역프라이머...

<ol>
	<li>Ishikawa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+truncated+forms+of+U1+snRNA+reveals+a+novel+RNA+degradation+pathway+during+snRNP+biogenesis.">Identification of truncated forms of U1 snRNA reveals a novel RNA degradation pathway during snRNP biogenesis.</a> Nucleic Acids Research. 42 (4), 2708-2724 (2014).</li><li>Stanek, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cajal+bodies+and+snRNPs+-+friends+with+benefits.">Cajal bodies and snRNPs - friends with benefits.</a> RNA Biology. 14 (6), 671-679 (2017).</li><li>Stanek, D., Fox, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+bodies:+news+insights+into+structure+and+function.">Nuclear bodies: news insights into structure and function.</a> Curentr Opinion in Cell Biology. 46, 94-101 (2017).</li><li>Novotny, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SART3-Dependent+Accumulation+of+Incomplete+Spliceosomal+snRNPs+in+Cajal+Bodies.">SART3-Dependent Accumulation of Incomplete Spliceosomal snRNPs in Cajal Bodies.</a> Cell Reports. 10, 429-440 (2015).</li><li>Roithova, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sm-core+mediates+the+retention+of+partially-assembled+spliceosomal+snRNPs+in+Cajal+bodies+until+their+full+maturation.">The Sm-core mediates the retention of partially-assembled spliceosomal snRNPs in Cajal bodies until their full maturation.</a> Nucleic Acids Research. 46 (7), 3774-3790 (2018).</li><li>Fischer, U., Sumpter, V., Sekine, M., Satoh, T., Luhrmann, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleo-cytoplasmic+transport+of+U+snRNPs:+definition+of+a+nuclear+location+signal+in+the+Sm+core+domain+that+binds+a+transport+receptor+independently+of+the+m3G+cap.">Nucleo-cytoplasmic transport of U snRNPs: definition of a nuclear location signal in the Sm core domain that binds a transport receptor independently of the m3G cap.</a> EMBO Journal. 12 (2), 573-583 (1993).</li><li>Shukla, S., Parker, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quality+control+of+assembly-defective+U1+snRNAs+by+decapping+and+5&#39;-to-3&#39;+exonucleolytic+digestion.">Quality control of assembly-defective U1 snRNAs by decapping and 5&#39;-to-3&#39; exonucleolytic digestion.</a> Proceeding of the National Academy of U S A. 111 (32), E3277-E3286 (2014).</li><li>Weil, T. T., Parton, R. M., Davis, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Making+the+message+clear:+visualizing+mRNA+localization.">Making the message clear: visualizing mRNA localization.</a> Trends in Cell Biology. 20 (7), 380-390 (2010).</li><li>Klingauf, M., Stanek, D., Neugebauer, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+U4/U6+small+nuclear+ribonucleoprotein+particle+association+in+Cajal+bodies+predicted+by+mathematical+modeling.">Enhancement of U4/U6 small nuclear ribonucleoprotein particle association in Cajal bodies predicted by mathematical modeling.</a> Molecular Biology of the Cell. 17 (12), 4972-4981 (2006).</li><li>Mhlanga, M. M., Vargas, D. Y., Fung, C. W., Kramer, F. R., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=tRNA-linked+molecular+beacons+for+imaging+mRNAs+in+the+cytoplasm+of+living+cells.">tRNA-linked molecular beacons for imaging mRNAs in the cytoplasm of living cells.</a> Nucleic Acids Research. 33 (6), 1902-1912 (2005).</li></ol>

우리는 핵 카잘 바디로 snRNA 현지화를 위해 중요한 순서를 결정하기 위하여 형광표지된 snRNAs의 미세 주입을 이용했습니다. 라벨이 붙은 RNA의 신속하고 다소 간단한 제제로 인해 (PCR에 의한 DNA 템플릿의 준비와 시험관 내 전사) 이 방법은 다양한 서열이 RNA 국소화에 어떻게 기여하는지에 대한 효과적인 분석을 제공합니다. 비교적 짧은 시간에, 우리는 U2 snRNA의 10개의 상이한 삭제 또는 치환을 분석?...

RNA 접합은 스플리세오좀이라고 불리는 큰 리보뉴클레오단백질 복합체에 의해 촉매되는 유전자 발현의 중요한 단계 중 하나입니다. 총 150개 이상의 단백질과 5개의 작은 핵 RNA(snRNAs)가 접합 경로의 다른 단계에서 스플리세오좀에 통합됩니다. U1, U2, U4, U5 및 U6 snRNAs는 주요 GU-AG 인트론의 접합에 참여하고 있습니다. 이러한 snRNAs는 snRNA, snRNA(또는 U6 snRNA와 연관된 유사 Sm 단백질)와 연관된 7개의 Sm 단백질을 포함하는 미리 형성된 작은 핵 리보핵단백질 입자(snRNPs)와 각 snRNP에 특이적인 1-12개의 단백질로 스플리세오좀을 결합한다.
snRNPs의 집합은 세포질과 핵 단계를 관련시킵니다. 새로 전사된 snRNA는 세포질로 수출되어 7개의 Sm 단백질로부터 조립된 고리를 획득합니다. Sm 링은 이후에 핵으로 다시 수입되는 snRNA에 대한 신호로서 작용한다. Sm 단백질과 연관시키지 못하는 결함이 있는 snRNAs는 세포질1에서 유지됩니다. 새로 수입된 snRNPs는 먼저 snRNP 특이적 단백질을 만나고 그들의 성숙을 완료하는 Cajal바디에서 나타납니다 (참조 2,3에서검토). 우리는 최근에 최종 성숙 단계의 억제가 카잘 바디4,5에있는 미성숙한 snRNPs의 격리 귀착된다는 것을 보여주었습니다 . 우리는 최종 snRNP 성숙이 snRNP 특이적 단백질의 추가 및 활성 snRNPs의 형성을 감시하는 품질 관리의 밑에 있는 모형을 제안했습니다. 그러나, 세포가 정확하게 조립된 성숙한 미성숙한 입자를 구별하는 방법의 분자 세부사항은 애매한 남아 있습니다.
핵 카잘 바디에 있는 snRNA의 표적으로 하고 축적을 위해 필수적인 snRNA 순서를 결정하기 위하여는, 우리는 형광으로 표지된 snRNA의 미세 주입을 채택하기로 결정했습니다. 미세 주주사는 선택의 방법이었다: 1) 합성 snRNAs를 구별하기 위해 추가 서열 태그를 필요로하지 않는 것은 여분의 태그 서열의 삽입을위한 작은 공간과 짧은 RNA에 특히 중요하다 자신의 내인성 대응을 형성; 2) 생물 발생에 중요한 서열을 분석 할 수 있습니다. 예를 들어, Sm 서열은 SM 링 어셈블리및핵6으로 재가져오기에 필수적이다. snRNAs가 세포에서 발현될 때, Sm 서열이 결여된 snRNAs는 세포질에서 분해되고 핵및 카잘 바디 7에 도달하지 않는다. 그러나, Sm 서열이 없는 snRNAs는 핵 내로 직접 미세주입될 수 있고 따라서 Cajal 체국화에서 Sm 서열의 잠재적인 역할은 분석되었다.
여기서, 우리는 카잘 바디 5로 snRNA를 표적으로 하는 데 필요한 snRNA 서열을결정하기 위하여 적용한 미세 주입 방법을 상세히 기술합니다. Sm및 SMN 바인딩 사이트가 함께 필요하고 snRNA뿐만 아니라 다양한 짧은 비 코딩 RNA를 Cajal 본문에 지역화하기에 충분하다는 것을 보여주었습니다. 미세 주입뿐만 아니라 다른 증거에 기초하여, 우리는 SM 결합 부위에 조립 된 SM 링이 Cajal 몸 국소화 신호라고 제안했다.

<table>
	<tbody>
		<tr>
			<td>ChromaTide Alexa fluor 488-5-UTP</td>
			<td>ThermoFisher</td>
			<td>C11403</td>
			<td>Stock concentration 1 mM</td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium - high glucose</td>
			<td>Sigma-Aldrich</td>
			<td>D5796</td>
			<td>Containing 4.5 g&#8260;L D-glucose, Phenol red and antibiotics</td>
		</tr>
		<tr>
			<td>FemtoJet express Injector</td>
			<td>Eppendorf</td>
			<td>5247000013</td>
			<td></td>
		</tr>
		<tr>
			<td>Femtotips II</td>
			<td>Eppendorf</td>
			<td>930000043</td>
			<td>Microinjection needle of 0.5 &#181;m inner and 0.7 &#181;m outer diameter</td>
		</tr>
		<tr>
			<td>Fluoromont G with DAPI</td>
			<td>SouthernBiotech</td>
			<td>0100-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycogen</td>
			<td>ThermoFisher</td>
			<td>AM9510</td>
			<td>Stock concentration 5 mg/mL</td>
		</tr>
		<tr>
			<td>Gridded Glass Coverslips</td>
			<td>Ibidi</td>
			<td>10817</td>
			<td>Coverslips with a grid, no direct experience with them</td>
		</tr>
		<tr>
			<td>InjectMan NI 2 Micromanipulator</td>
			<td>Eppendorf</td>
			<td>5181000017</td>
			<td></td>
		</tr>
		<tr>
			<td>m3-2,2,7G(5&#39;)ppp(5&#39;)G trimethyled cap analogue</td>
			<td>Jena Bioscience</td>
			<td>NU-853-1</td>
			<td>Stock concentration 40 mM</td>
		</tr>
		<tr>
			<td>MEGAshortscript T7 Transcription Kit</td>
			<td>ThermoFisher</td>
			<td>AM1354</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Cover Glasses 12 mm, No. 1</td>
			<td>Paul Marienfeld GmbH</td>
			<td>111520</td>
			<td>For routine work</td>
		</tr>
		<tr>
			<td>Microscope Cover Glasses 12 mm, No. 1.5</td>
			<td>Paul Marienfeld GmbH</td>
			<td>117520</td>
			<td>For high resolution images</td>
		</tr>
		<tr>
			<td>Microscope DeltaVision</td>
			<td>GE Healthcare</td>
			<td></td>
			<td>For image acquisition</td>
		</tr>
		<tr>
			<td>Microscope DMI6000</td>
			<td>Leica</td>
			<td></td>
			<td>For microinjection</td>
		</tr>
		<tr>
			<td>Paraformaldehyde 32% solution EM grade</td>
			<td>EMS</td>
			<td>15714</td>
			<td>Dissolved in PIPES to the final concentration 4%</td>
		</tr>
		<tr>
			<td>Phenol:Chloroform 5:1</td>
			<td>Sigma-Aldrich</td>
			<td>P1944</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers for U2 amplification: Forward: 5&#8217;-TAATACGACTCACTATAGGGATCGCTTCTCGGCCTTTTGG, 
			Reverse: 5&#180; TGGTGCACCGTTCCTGGAGGT</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>T7 rpromoter sequence in italics</td>
		</tr>
		<tr>
			<td>Phusion High Fidelity DNA polymerase</td>
			<td>BioLab</td>
			<td>M0530L</td>
			<td></td>
		</tr>
		<tr>
			<td>RNasin Plus</td>
			<td>Promega</td>
			<td>N2615</td>
			<td>Stock concentration 40 mM</td>
		</tr>
		<tr>
			<td>Tetramethylrhodamine isothiocyanate Dextran 65-85 kDa</td>
			<td>Sigma-Aldrich</td>
			<td>T1162</td>
			<td>Dissolved in water, stock concentration 1 mg/mL</td>
		</tr>
		<tr>
			<td>Triton-X100</td>
			<td>Serva</td>
			<td>37240</td>
			<td>Dissolved in water, stock concentration 10%</td>
		</tr>
	</tbody>
</table>

analysis of spliceosomal snrna localization in human hela cells using microinjection

스플리케오소말 snRNA의 생물 발생은 핵 및 세포질 상과 마지막 단계가 카잘 바디에게 불린 핵 구획에서 생기는 둘 다 관련시키는 복잡한 프로세스입니다. 그러나, 이 비핵화 구조로 snRNA 국소화를 지시하는 서열은 최근까지 알려지지 않았다. Cajal 바디에 있는 snRNAs의 축적을 위해 중요한 순서를 결정하기 위하여는, 우리는 형광으로 표지된 snRNAs의 미세 주입을 세포 안쪽에 그들의 현지화에 선행했습니다. 첫째, 우리는 snRNA 결실 돌연변이를 준비, 생체 외 전사에 대한 DNA 템플릿을 합성하고 Alexa488와 결합 된 UTP의 존재에 snRNAs를 전사. 표지된 스노르나스를 TRITC와 결합한 70 kDa-Dextran과 혼합하고, 인간 HeLa 세포의 핵 또는 세포질에 미세주입하였다. 세포는 1시간 동안 배양하고 고정하고 카잘 체 마커 코일린을 간접 면역형광에 의해 가시화하였고, 핵 또는 세포질 주입의 마커 역할을 하는 snRNA 및 dextran은 형광 현미경을 사용하여 직접 관찰되었다. 이 방법은 다양한 서열이 세포 내부의 RNA 국소화에 미치는 영향을 효율적이고 신속하게 테스트 할 수 있습니다. 여기서, 우리는 Cajal 바디로 snRNA의 능률적인 현지화를 위한 Sm 결합 순서의 중요성을 보여줍니다.

snRNA 국소화 및 Cajal 바디 표적화에서 Sm 결합 부위의 역할을 모니터링하기 위해, 우리는 Sm 결합 부위를 형성하는 7개의 뉴클레오티드(AUUUUUG)가 결여된 T7 프로모터 및 전신 U2 snRNA 또는 U2 snRNA를 포함하는 DNA 템플릿을 준비하였다. snRNAs는 시험관 내 전사, 고립 및 TRITC 결합 된 덱스트란-70kDa와 혼합되었다. 우리는 체외에서 전사된 snRNA를 HeLa 세포의 핵 또는 세포질로 포함하는 혼합물을 미세주입했습?...

Watch this Scientific Journal Video about Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection at JoVE.com

Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection

스플리케오소말 snRNA의 생물 발생은 다양한 세포 구획을 포함하는 복잡한 과정입니다. 여기에서, 우리는 세포 안쪽에 그들의 수송을 감시하기 위하여 형광으로 표지된 snRNAs의 마이크로 주입을 이용했습니다.

미세 주입을 사용하여 인간 헬라 세포에서 스플리세오소말 snRNA 국소화 분석

Biogenesis of spliceosomal snRNAs is a complex process involving both nuclear and cytoplasmic phases and the last step occurs in a nuclear compartment ...

여기서 우리는 짧은 핵 RNA를 Cajal 바디에게 불린 핵 구조물로 현지화하기 위하여 필수적인 RNA 순서를 검출하기 위하여 형광표시 RNA의 미세 주입을 적용했습니다. 이 기술은 두 가지 주요 장점이 있습니다. 첫째, 레이블을 지정하고 추적하기가 어려운 짧은 RNA에 적용할 수 있습니다.둘째, 상이한 서열의 신속한 선별을 허용하고 RNA 국소화에서 그들의 역할을 시험할 수 있다. 12밀리미터에 미세 주입, 씨앗 HeLa 또는 다른 부착 세포 전에 12 밀리미터 커버립은 미세 주입 시 50 %의 합류에 도달합니다. 먼저, 준비된 커버슬립을 페트리 접시의 중앙에 놓고 셀과 2밀리미터의 배양 매체를 추가합니다.다음 날, 세포 채워진 페트리 접시를 현미경 단계에 놓습니다. 마이크로 로더를 사용하여, 바늘에 snRNA 혼합물의 3 마이크로 리터를로드하고 페트리 접시의 표면에 대하여 45도의 각도로 마이크로 인젝터의 홀더에 바늘을 설치합니다. 바늘을 찾기 위해 10배 장거리 목표를 사용합니다.먼저, 인젝터에 속도를 거칠게 설정하고 배양 배지에 닿을 때까지 바늘을 낮춥춥시다. 현미경 쌍안경을 사용하여 바늘이 배양 배지에 닿는 장소인 밝은 지점을 찾습니다. 바늘의 끝이 관찰 될 때까지 현미경으로 조사하는 동안 미세하고 더 낮은 바늘로 속도를 변경합니다.시야 중간에 바늘을 이동하고 40배 장거리 목표로 전환합니다. 이 후 셀을 선택하고 바늘을 셀 위로 이동합니다. 세포 접촉에 대한 압력과 시간을 설정합니다.바늘을 셀로 아래로 이동한 다음 미세 조작기의 하한을 설정합니다. 하한을 설정하는 것은 프로토콜의 가장 중요한 부분입니다. 커버슬립 표면이 완벽하지 않고 각 셀이 다르기 때문에 주입 세션 중에 하한을 여러 번 설정해야 합니다.다음으로 바늘을 셀 위로 다시 이동하고 인젝터의 조이스틱에 있는 주입 버튼을 누릅니다. 바늘은 RNA 혼합물을 주입하기 위하여 한계가 설정된 장소로 세포 안쪽에 자동하게 움직입니다. 완료하려면 인젝터의 메뉴 버튼을 누르고 홀더에서 바늘을 제거합니다.그런 다음 인젝터와 마이크로 조작기를 끄기 전에 인젝터에서 튜브를 분리합니다. 미세 주입 후, 이산화탄소 인큐베이터로 세포를 반환하고 1 시간 동안 섭씨 37도에서 배양. 다음으로 실온에서 PBS로 셀을 세 번 헹구는 다.pH 6.9에서 0.1 어금니알데히드로 20분 동안 세포를 수정합니다. 그런 다음 실온 PBS로 셀을 세 번 씻으시면 됩니다. snRNA 국소화만 분석되면, 물에 세포를 간단히 헹구고 DAPI를 가진 마운팅 배지에 장착한다.추가 단백질 국소화의 경우, 실온에서 5 분 동안 PBS에서 0.5 %의 Triton X-100으로 세포를 투과화하십시오. PBS로 세포를 세 번 헹구고 텍스트 프로토콜에 설명된 바와 같이 적절한 1차 및 이차 항체로 얼룩지게 한다. 그런 다음 PBS로 세 번 헹구고 물에 한 번 헹구습니다.그 후, DAPI를 가진 마운팅 배지에 셀을 장착한다. 이미지 할 준비가되면 침수 목표가 장착 된 고급 형광 현미경 시스템을 사용하여 이미지를 획득하십시오. 마이크로 주입 된 세포가 확인되면, 샘플 당 200 나노 미터 Z 단계와 20 Z 섹션의 스택을 수집하고 수학 감소에 따라.형광 신호를 정량화하려면 먼저 ImageJ의 현미경 이미지를 열고 채널을 창으로 분할합니다. 동기화창 도구로 창을 동기화합니다. 다음으로, 코일린 면역스테인링에 의해 확인된 카잘 몸 주위의 관심 영역을 그립니다.코일린 정의 ROI에서 snRNA 신호의 강도를 측정합니다. 임의로 뉴클레오플라즘에 배치된 ROI에서 snRNA 형광의 강도를 결정한다. 측정값을 저장하고 카잘 본체 및 뉴클레오플라즘에서 RNA 신호의 비율을 계산합니다.이 연구에서는 형광으로 표시된 snRNAs가 세포 내부의 수송을 모니터링하기 위해 마이크로 주입됩니다. SM 부위가 카잘 체증에 중요한지 여부를 테스트하기 위해 SM 부위가 부족한 스RNA는 핵으로 직접 마이크로 주입된다. 세포질내 주사는 대조군 역할을 하며 전체 길이의 snRNA는 마이크로인주사되어 긍정적인 대조군역할을 한다.인큐베이션 후, 마이크로인주사 세포가 고정되고 카잘 체내 마커 코일린이 간접면역형광에 의해 시각화된다. 전체 길이 snRNA핵과 세포질 주사 후 카잘 바디에 축적. 대조적으로, SM 부위가 부족한 snRNA는 이 구획에 미세주입 후 세포질에 남아 있는 반면, SM 부위가 없는 스네RNA의 핵 미세주입은 이 스RNA가 핵에 남아 있으나 카잘체에 축적되지 않기 때문에 카잘 체내에서 국소화에 중요하다는 것을 보여준다.때로는 하나의 셀룰러 구획으로의 미세 주입이 실패하고 속여 서번 70 킬로달톤은 핵과 세포질 모두에서 찾을 수 있습니다. 이 세포는 추가 분석에서 버려지립니다. 형광으로 표지된 snRNAs가 주입 전에 음의 80°C에 저장된다는 사실에도 불구하고 RNA 분해가 발생할 수 있습니다.세포질에 주입된 열화된 snRNA는 핵으로 이송되지 않으며 세포질에서 국한된 상태를 유지한다. 이러한 snRNA를 폐기해야 하며 새로운 snRNA를 합성해야 합니다. 세포 유형에 대한 주입 및 보상 압력을 올바르게 조정하는 것이 중요합니다.그리고 이전과 같이, 세포 주입에 대 한 정확한 하한을 설정 하는 것은 좋은 미세 주입에 대 한 필수적이다. RNA 격리 중에 사용되는 페놀 클로로폼은 위험하며 미세 주입 바늘이 날카로운 물체임을 기억하십시오. 이러한 재료를 취급할 때는 주의하십시오.

Research

JoVE Journal

Neuroscience

Time-lapse Live Imaging of Clonally Related Neural Progenitor Cells in the Developing Zebrafish Forebrain

개발 Zebrafish Forebrain에 Clonally 관련 신경 전구 세포의 시간 경과 라이브 영상

Precise patterns of division, migration and differentiation of neural progenitor cells are crucial for proper brain development and function1,2. To ...

연구

신경과학

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

Live-cell Imaging of Sensory Organ Precursor Cells in Intact Drosophila Pupae

손상의 감각 오르간 전구체 세포 라이브 셀 이미징 Drosophila Pupae

Since the discovery of Green Fluorescent Protein (GFP), there has been a revolutionary change in the use of live-cell imaging as a tool for understanding ...

Electrophysiological Measurements and Analysis of Nociception in Human Infants

Electrophysiological 측정과 인간 유아의 Nociception 분석

Pain is an unpleasant sensory and emotional experience. Since infants cannot verbally report their experiences, current methods of pain assessment are ...

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

작은 분자와 유도 Pluripotent 인간 배아 줄기 세포에서 인간의 연결을 Progenitors과 뉴런의 효율 유도

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

Visualization and Genetic Manipulation of Dendrites and Spines in the Mouse Cerebral Cortex and Hippocampus using In utero Electroporation

사용하는 마우스 대뇌 피질과 해마의 시각화 및 Dendrites와 쪽이의 유전자 조작<em&gt; utero에서</em&gt; Electroporation

In utero electroporation (IUE) has become a powerful technique to study the development of different regions of the embryonic nervous system 1-5. To date ...

Micromanipulation of Gene Expression in the Adult Zebrafish Brain Using Cerebroventricular Microinjection of Morpholino Oligonucleotides

모르 올리고 뉴클레오티드의 Cerebroventricular 미세 주입을 사용하여 성인 Zebrafish의 두뇌에서 유전자 발현의 미세 조작

Manipulation of gene expression in tissues is  required to perform functional studies. In this paper, we demonstrate the  cerebroventricular ...

Quantification of Cerebral Vascular Architecture using Two-photon Microscopy in a Mouse Model of HIV-induced Neuroinflammation

HIV 유도 된 신경 염증의 마우스 모델에서 이광자 현미경을 사용하여 뇌 혈관 구조의 정량

Human Immunodeficiency Virus 1 (HIV-1) infection frequently results in HIV-1 Associated Neurocognitive Disorders (HAND), and is characterized by a chronic ...

Quantification of Endosome and Lysosome Motilities in Cultured Neurons Using Fluorescent Probes

형광 프로브를 이용한 배양 된 뉴런의 엔도 좀과 리소좀 기능의 정량화

In the brain, membrane trafficking systems play important roles in regulating neuronal functions, such as neuronal morphology, synaptic plasticity, ...

3D Kinematic Analysis for the Functional Evaluation in the Rat Model of Sciatic Nerve Crush Injury

Sciatic 신경 호감 상해의 쥐 모형에 있는 기능 평가를 위한 3D 운동학 분석

Compared to the Sciatic Functional Index (SFI), kinematic analysis is a more reliable and sensitive method for performing functional evaluations of ...

In Vivo Targeting of Neural Progenitor Cells in Ferret Neocortex by In Utero Electroporation

자궁 에서 뇌포화에 의해 페렛 신피질에서 신경 전구 세포의 생체 포팅

Manipulation of gene expression in vivo during embryonic development is the method of choice when analyzing the role of individual genes during mammalian ...