Name: inducing and characterizing vesicular steatosis in differentiated heparg cells
Uploaded: 2019-07-18T13:30:00
Description: Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

نشكر البروفيسور كريستيان تريبو (INSERM U871، ليون، فرنسا)، الذي تكرم بتوفير خلايا HepaRG. ونحن ممتنون لريتا أبيوديا على مساعدتها الإدارية. وقد تم دعم هذا العمل من قبل MIUR- Ministero dell'istruzione, dell'università e della ricerca (FIRB 2011-2016 RBAP10XKNC) وجامعة سابينزا في روما (prot. C26A13T8PS; بروت. C26A142MCH; بروت. C26A15LSXL).

1. إعداد وسائل الإعلام الثقافية والكواشف
<ol><li>تكاثر المتوسطة: تكملة وليام E المتوسطة مع الجلوتاماكس, 10% مصل البقر الجنيني (FBS), 1% البنسلين / العقديات, 5 ميكروغرام / مل الأنسولين و 0.5 μM هيدروكورتيزون هيميسوتشينات.</li>
	<li>التمايز المتوسط: تكملة وليام E المتوسطة مع الجلوتاماكس، 10٪ FBS، 1٪ البنسلين / ا...

<ol>
	<li>Starley, B. Q., Calcagno, C. J., Harrison, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonalcoholic+fatty+liver+disease+and+hepatocellular+carcinoma:+a+weighty+connection.">Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection.</a> Hepatology. 51 (5), 1820-1832 (2010).</li><li>Byrne, C. D., Targher, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NAFLD:+a+multisystem+disease.">NAFLD: a multisystem disease.</a> Journal of Hepatology. 62 (1), 47-64 (2015).</li><li>Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+and+mechanisms+of+progression+of+non-+alcoholic+steatohepatitis.">Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis.</a> Trends in Molecular Medicine. 14, 72-81 (2008).</li><li>Chalasani, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diagnosis+and+management+of+nonalcoholic+fatty+liver+disease:+Practice+guidance+from+the+American+Association+for+the+Study+of+Liver+Diseases.">The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases.</a> Hepatology. 67 (1), 328-357 (2018).</li><li>Banini, B. A., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+future+pharmacologic+treatment+of+nonalcoholic+steatohepatitis.">Current and future pharmacologic treatment of nonalcoholic steatohepatitis.</a> Current Opinion in Gastroenterology. 33 (3), 134-141 (2017).</li><li>Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+pharmacological+therapies+for+nonalcoholic+fatty+liver+disease/nonalcoholic+steatohepatitis.">Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis.</a> World Journal of Gastroenterology. 21 (13), 3777-3785 (2015).</li><li>Younossi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+burden+of+NAFLD+and+NASH:+trends,+predictions,+risk+factors+and+prevention.">Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention.</a> Nature Reviews Gastroenterology &amp; Hepatology. 15 (1), 11-20 (2018).</li><li>Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+models+of+non-alcoholic+fatty+liver+disease.">Preclinical models of non-alcoholic fatty liver disease.</a> Journal of Hepatology. 68 (2), 230-237 (2018).</li><li>Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+mouse+models+for+the+study+of+nonalcoholic+fatty+liver+disease.">Genetically modified mouse models for the study of nonalcoholic fatty liver disease.</a> World Journal of. Gastroenterology. 18 (11), 1141-1153 (2012).</li><li>Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+scientific+discovery:+the+need+for+preclinical+models+of+nonalcoholic+steatohepatitis.">Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis.</a> Hepatology International. 12 (1), 6-16 (2018).</li><li>Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+human+hepatic+cell+lines+for+in+vitro+testing+and+research+purposes.">Immortalized human hepatic cell lines for in vitro testing and research purposes.</a> Methods in Molecular Biology. 1250, 53-76 (2015).</li><li>G&#243;mez-Lech&#243;n, M. J., Donato, M. T., Castell, J. V., Jover, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatocytes+in+primary+culture:+the+choice+to+investigate+drug+metabolism+in+man.">Human hepatocytes in primary culture: the choice to investigate drug metabolism in man.</a> Current Drug Metabolism. 5 (5), 443-462 (2004).</li><li>Marion, M. J., Hantz, O., Durantel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+HepaRG+cell+line:+biological+properties+and+relevance+as+a+tool+for+cell+biology,+drug+metabolism,+and+virology+studies.">The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies.</a> Methods in Molecular Biology. 640, 261-272 (2010).</li><li>Gripon, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+a+human+hepatoma+cell+line+by+hepatitis+B+virus.">Infection of a human hepatoma cell line by hepatitis B virus.</a> Proceedings of the National Academy of Sciences. 99 (24), 15655-15660 (2002).</li><li>Anth&#233;rieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+vesicular+steatosis+by+amiodarone+and+tetracycline+is+associated+with+up-regulation+of+lipogenic+genes+in+HepaRG+cells.">Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells.</a> Hepatology. 53 (6), 1895-1905 (2011).</li><li>Rouge, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PPAR+agonists+reduce+steatosis+in+oleic+acid-overloaded+HepaRG+cells.">PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells.</a> Toxicology and Applied Pharmacology. 276 (1), 73-81 (2014).</li><li>Belloni, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+phospho-STAT3-miRNAs+pathway+improves+vesicular+hepatic+steatosis+in+an+in+vitro+and+in+vivo+model.">Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model.</a> Scientific Reports. 8, 13638 (2018).</li><li>Nunn, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+deacetylase+inhibiting+drug+Entinostat+induces+lipid+accumulation+in+differentiated+HepaRG+cells.">The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells.</a> Scientific Reports. 6, 28025 (2016).</li><li>Donato, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytometric+analysis+for+drug-induced+steatosis+in+HepG2+cells.">Cytometric analysis for drug-induced steatosis in HepG2 cells.</a> Chemico-Biological Interactions. 181 (3), 417-423 (2009).</li><li>Hellerer, T., Ax&#228;ng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+lipid+storage+in+Caenorhabditis+elegans+using+coherent+anti-Stokes+Raman+scattering+(CARS)+microscopy.">Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy.</a> Proceedings of the National Academy of Sciences. 104 (37), 14658-14663 (2007).</li><li>Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+evaluation+of+hepatic+microvesicular+steatosis+with+multimodal+coherent+anti-Stokes+Raman+scattering+microscopy.">Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy.</a> PLoS One. 7 (11), 51092 (2012).</li><li>Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+hepatoma+HepaRG+cells:+a+highly+differentiated+model+for+studies+of+liver+metabolism+and+toxicity+of+xenobiotics.">The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics.</a> Chemico-Biological Interactions. 168 (1), 66-73 (2007).</li><li>Nelson, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatic+HepaRG+cells+maintain+an+organotypic+phenotype+with+high+intrinsic+CYP450+Activity/metabolism+and+significantly+outperform+standard+HepG2/C3A+cells+for+pharmaceutical+and+therapeutic+applications.">Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications.</a> Basic &amp; Clinical Pharmacology &amp; Toxicology. 120 (1), 30-37 (2017).</li><li>Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+human+hepatocytes,+HepG2+cells,+and+HepaRG+cells+at+the+mRNA+level+and+CYP+activity+in+response+to+inducers+and+their+predictivity+for+the+detection+of+human+hepatotoxins.">Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins.</a> Cell Biology and Toxicology. 28 (2), 69-87 (2012).</li><li>Pusl, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+sensitize+hepatocytes+to+bile+acid-induced+apoptosis.">Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis.</a> Biochemical and Biophysical Research Communications. 371 (3), 441-445 (2008).</li><li>Gentile, C. L., Pagliassotti, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+fatty+acids+in+the+development+and+progression+of+nonalcoholic+fatty+liver+disease.">The role of fatty acids in the development and progression of nonalcoholic fatty liver disease.</a> The Journal of Nutritional Biochemistry. 19 (9), 567-576 (2008).</li><li>Mei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+roles+of+unsaturated+and+saturated+fatty+acids+on+autophagy+and+apoptosis+in+hepatocytes.">Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes.</a> Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).</li><li>Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+induce+JNK-dependent+hepatocyte+lipoapoptosis.">Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis.</a> Journal of Biological Chemistry. 281, 12093-12101 (2006).</li><li>Moravcov&#225;, A., &#268;ervinkov&#225;, Z., Ku&#269;era, O., Mezera, V., Rychtrmoc, D., Lotkov&#225;, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+oleic+and+palmitic+acid+on+induction+of+steatosis+and+cytotoxicity+on+rat+hepatocytes+in+primary+culture.">The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture.</a> Physiological Research. 64, 627-636 (2015).</li><li>Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pitfall+in+using+BODIPY+dyes+to+label+lipid+droplets+for+fluorescence+microscopy.">A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy.</a> Histochemistry and Cell Biology. 133 (4), 477-480 (2010).</li><li>Rinia, H. A., Burger, K. N., Bonn, M., M&#252;ller, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+label-free+imaging+of+lipid+composition+and+packing+of+individual+cellular+lipid+droplets+using+multiplex+CARS+microscopy.">Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy.</a> Biophysical Journal. 95 (10), 4908-4914 (2008).</li><li>Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+in+situ+imaging+of+oil+body+dynamics+and+chemistry+in+germination.">Label-free in situ imaging of oil body dynamics and chemistry in germination.</a> Journal of The Royal Society Interface. 13 (123), (2016).</li><li>J&#252;ngst, C., Winterhalder, M. J., Zumbusch, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+long+term+lipid+droplet+tracking+with+CARS+microscopy.">Fast and long term lipid droplet tracking with CARS microscopy.</a> Journal of Biophotonics. 4 (6), 435-441 (2011).</li><li>Welte, M. A., Gould, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplet+functions+beyond+energy+storage.">Lipid droplet functions beyond energy storage.</a> Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862 (10), 1260-1272 (2017).</li><li>Cohen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+as+organelles.">Lipid droplets as organelles.</a> International Review of Cell and Molecular Biology. 337, 83-110 (2018).</li><li>Farese, R. V., Walther, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+finally+get+a+little+R-E-S-P-E-C-T.">Lipid droplets finally get a little R-E-S-P-E-C-T.</a> Cell. 139 (5), 855-860 (2009).</li></ol>

يصف هذا البروتوكول كيفية التمييز بين خلايا HepaRG وكيفية الحث على steatosis الحويصلي عن طريق علاج oleate الصوديوم (الشكل1A). في الواقع، بالمقارنة مع غيرها من خطوط الخلايا سرطان الخلايا الكبدية البشرية (HCC)، يعرض خط الخلية HepaRG ملامح من خلايا الكبد البشرية البالغة، مما يمثل بدي...

يتم تعريف steatosis الكبد يُعرف بتراكم الدهون داخل الكبد، داخل قطرات الدهون المحتوية على الدهون الثلاثية، التي لا تقل عن 5% من وزن الكبد. تخزين الدهون الكبدية لفترات طويلة هو عملية يمكن عكسها، ومع ذلك، فإنه يمكن أن يؤدي إلى خلل في الكبد الأيضي، والتهاب وأشكال متقدمة من أمراض الكبد الدهنية غير الكحولية (NAFLD)، السبب الرئيسي لأمراض الكبد المزمنة في أجزاء كثيرة من العالم1,2. NAFLD هو مرض متعدد العوامل قد يتطور إلى التهاب الكبد غير الكحولي (ناش) الأكثر عدوانية، والذي بدوره يمكن أن يتطور إلى تليف الكبد، وفي نسبة صغيرة من المرضى، إلى سرطان الخلايا الكبدية (HCC)1،3. لا يوجد علاج معتمد متاح حاليا كعلاج محدد لNAFLD ومزيج من النظام الغذائي وتعديلات نمط الحياة لا يزال ركيزة إدارة NAFLD وناش4،5،6.
الآليات الجزيئية المؤدية إلى تطوير steatosis الكبد في مسببات الأمراض من NAFLD لا تزال ليتم توضيحها7. في هذا السياق، تم تطوير نماذج الماوس لدراسة تطور مرض steatosis البشري. يوجد عدد لا يحصى من النماذج المختلفة، ولكل منها مزاياها وعيوبها، بما في ذلك النماذج الوراثية والتغذوية والكيميائية التي تجمع بين نُهج مختلفة. الفئران المعدلة وراثيا (المعدلة وراثيا أو بالضربة القاضية) تلقائيا تطوير أمراض الكبد. ومع ذلك، تجدر الإشارة إلى أن هذه الطفرات نادرة جدا في البشر وحذف أو الإفراط في التعبير عن جين واحد (على سبيل المثال، OB / OB الماوس) قد لا تحاكي مسببات المرض البشري متعدد العوامل على المستوى الجزيئي8،9. وبالمثل ، فإن المرض الذي تكتسبه الفئران بعد التلاعب الغذائي أو الدوائي قد لا يحاكي آثار الوجبات الغذائية البشرية المرتبطة بتطوير NAFLD في الرجل8. غير أن النماذج الحيوانية قد يسرت التطورات في فهم الـ NAFLD، وهذا النهج هو حالياً الاستراتيجية الأكثر استخداماً في البحوث المختبرية. ومع ذلك، فإن تكرار النتائج التي تم الحصول عليها في النماذج الحيوانية في البشر قد فشل مرارا وتكرارا، مما تسبب في سوء الترجمة إلى العيادة10.
ولذلك، فإن النماذج المختبرية من NAFLD قد تلعب دورا أساسيا في توضيح الآليات الجزيئية لتقدم NAFLD، وأنها تمثل أداة قيمة لفحص عدد كبير من المركبات. وقد استخدمت على نطاق واسع ثقافات الخلايا الأولية، وخطوط الخلايا الخالدة والخزعات الكبد لأغراض البحث11. تشبه خلايا الكبد البشرية الأولية الظروف السريرية البشرية بشكل وثيق، ولكن هناك عدد محدود من المتبرعين، وتظهر ثقافات الخلايا الأولية ضعف قابلية الاستعادة بسبب تقلب الخلايا. وقد أدت هذه الملاحظات، إلى جانب القضايا الأخلاقية واللوجستية، إلى الحد من استخدام خلايا الكبد الأولية البشرية12. وهكذا، فإن خطوط الخلايا الكبدية تمثل بديلاً مناسباً، وجود العديد من المزايا الأساسية على الثقافة الأولية، حيث تنمو خطوط الخلايا الكبدية بشكل مطرد، ولها فترة حياة غير محدودة تقريباً، ولها نمط ظاهري مستقر. وعلاوة على ذلك، يمكن الوصول بسهولة إلى خطوط الخلايا الخلوية، كما أن الظروف الثقافية لخطوط الخلايا الكبدية أبسط من تلك الموجودة في خلايا الكبد الأولية وموحدة بين مختبرات مختلفة.
هنا، ونحن نصف بالتفصيل نموذج في المختبر القائم على الخلايا من التهاب الكبد الحويصلي، ممثلة بخلايا الكبد المتمايزة HepaRG تعامل مع حمض دهني أوليات الصوديوم. تم تأسيس خط الخلية HepaRG من المريضة المتضررة من التهاب الكبد C وEdmondson الصف الأول ورم الكبد المتمايزة جيدا14. خط الخلية HepaRG هو خط خلية الذرية ثنائية القدرة البشرية قادرة على التمييز عند التعرض ل2٪ ثنائي ميثيل سولفوكسيد (DMSO) نحو اثنين من الأنماط الظاهرية الخلية المختلفة: الخلايا الشبيهة الصفراوية والكبد ية. خلايا HepaRG المتمايزة (dHepaRG) تشترك في بعض الميزات والخصائص مع خلايا الكبد الكبار وتمتلك القدرة على التعبير عن الجينات الخاصة بالكبد بشكل لا يُقدر مثل الزلال، الألدلاسب، السيتوكروم P450 2E1 (CYP2E1)، وCytochrome P450 3A4 (CYP3A4)13 (الخطوة 3). علاج خلايا dHepaRG مع الأحماض الدهنية الملح الصوديوم oleate (250 درجة مئوية) لمدة 5 أيام يؤدي إلى توليد قطرات الدهون السيتوبلازمية، تقليد آثار الكبد الدهني14،15،17،18 ( الخطوة 4). تراكم قطرات الدهون يمكن الكشف عنها بسهولة عن طريق النفط الأحمر O تلطيخ (الخطوة 5)، صبغة الليسوكروم القابلة للذوبان في الدهون التي تلطيخ الدهون الثلاثية محايدة والدهون الحمراء والبرتقالية. لتحديد الدهون بكفاءة في dHepaRG الدهنية، وهنا نقوم بتوضيح تحليل الفلوروفلوري بعد تلطيخ مع 4،4-difluoro-1،3،5،7-tetramethyl-4-bora-3a،4a-ديازا-s-indacene (بوديبي 505/515) (الخطوة 6)، وهو مسبار الفلورسنت lipophilic أن توطين إلى أجسام الدهون داخل الخلايا، وقد استخدمت لتسمية قطرات الدهون19. وعلاوة على ذلك، هنا نعرض كيفية تقييم steatosis عن طريق تفاعل متسلسل بوليميراز كمي (qPCR) (الخطوة 7) التعبير الجيني إلغاء الضوابط التنظيمية للعديد من الجينات الأيضية في خلايا dHepaRG. لمزيد من توصيف وقياس تراكم قطرات الدهون بعد العلاج الأوليات الصوديوم، قمنا بإجراء متسقة المضادة ستوكس رامان مبعثر (CARS) المجهرية (الخطوة 8)، وهي تقنية مبتكرة تمكن من التصور والقياس الكمي لل قطرات الدهون دون وضع العلامات20،21.

<table border="0" cellpadding="0" cellspacing="0" style="width:799px;" width="797">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Hyclone HyClone Fetal Clone II&#160;</td>
			<td style="width:240px;">GE Healthcare</td>
			<td style="width:143px;">SH30066</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">William&#8217;s E medium with GlutaMAX&#160;</td>
			<td style="width:240px;">Thermofisher</td>
			<td>32551087</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/streptomycin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>P4333</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Insulin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>I9278</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">hydrocortisone hemisuccinate</td>
			<td style="width:240px;">SIGMA</td>
			<td>H2270</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">DMSO, dimethyl sulfoxide</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">D2438&#160;&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Sodium Oleate</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O7501&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Methanol</td>
			<td style="width:240px;">SIGMA</td>
			<td>179337</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Isopropanol</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">278475</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BODIPY 505/515</td>
			<td>Thermofisher</td>
			<td>D3921</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">PBS</td>
			<td style="width:240px;">Thermofisher</td>
			<td>14190-250</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution</td>
			<td style="width:240px;">SIGMA</td>
			<td>252549</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">RNAse free DNAseI</td>
			<td style="width:240px;">Promega</td>
			<td>M198A&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glass-bottomed dishes</td>
			<td style="width:240px;">Willco Wells</td>
			<td style="width:143px;">GWST-5040</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Oil Red solution</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O625</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">CellTiter 96 AQueous One Solution</td>
			<td style="width:240px;">Promega&#160;</td>
			<td style="width:143px;">G3582</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">q-PCR oligo name</td>
			<td>Sequence</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ACACB FOR</td>
			<td>CAAGCCGATCACCAAGAGTAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">ACACB REV</td>
			<td>CCCTGAGTTATCAGAGGCTGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin FOR</td>
			<td style="width:240px;">GCACTCTTCCAGCCTTCCT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin REV</td>
			<td style="width:240px;">AGGTCTTTGCGGATGTCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN FOR</td>
			<td>TGCTTGAATGTGCTGATGACAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN REV</td>
			<td>AAGGCAAGTCAGCAGGCATCTCATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB FOR</td>
			<td>GCATCTGTCAGCAGAATGGA&#160;</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB REV</td>
			<td>TAGACAGCAGCCAGGACCTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB FOR</td>
			<td>CCTCCGTTTTGGTGGTAGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB REV</td>
			<td>&#160;CCTAAAAGCTGGGAAGCTGA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 FOR</td>
			<td>CTCAGCTTCATGCAGGGTTA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 REV</td>
			<td>GGTGCTCCAGTAGTCTTTCAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A FOR</td>
			<td>TCATCAAGAAATGTCGCACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A REV</td>
			<td>GCCTCGTATGTGAGGCAAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 FOR</td>
			<td>TTGAAGCCTCTCGTTGACCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 REV</td>
			<td>CGTGGTGGGATACAGCCAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 FOR</td>
			<td>CTTCATCCAATGGACTGCATAAAT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 REV</td>
			<td>TCCCAAGTATAACACTCTACACAGACAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH FOR</td>
			<td>TGACAACTTTGGTATCGTGGAAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH REV</td>
			<td>AGGGATGATGTTCTGGAGAGCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM FOR</td>
			<td>TCTTTGGGTTTGCGGAATGTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM REV</td>
			<td>ATGCACATCTCGCTCTTGAATAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 FOR</td>
			<td>CCTGAACCTTCCAAAGATGGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 REV</td>
			<td>ACCTCAAACTCCAAAAGACCAGTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 FOR</td>
			<td>ACAGACAGGAAACCCAAGCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 REV</td>
			<td>TGGAGGTGAGAAGGAACATACACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 FOR</td>
			<td>TTGCAGTTGCCAATACCTATGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 REV</td>
			<td>CCAGTCACAGTAGTCGTCACA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 FOR</td>
			<td>AATGAGTTGGAGGGGCTGGGGGACATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 REV</td>
			<td>GGTCACCTAAACGAACGAAGTAGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD FOR</td>
			<td>TCTAGCTCCTATACCACCACCA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD REV</td>
			<td>TCGTCTCCAACTTATCTCCTCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 FOR</td>
			<td>TGCTCATCAACCGCAACGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 REV</td>
			<td>CCGACTCTCTTCCTTCATCTCCTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S FOR</td>
			<td>CGCCGCTAGAGGTGAAATTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S REV</td>
			<td>TTGGCAAATGCTTTCGCTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

inducing and characterizing vesicular steatosis in differentiated heparg cells

يصف هذا البروتوكول طريقة فعالة للحث على وتوصيف steatosis الحويصلي في خلايا HepaRG المختلفة DMSO عن طريق علاج oleate الصوديوم (الشكل1A).
تمايز خلايا HepaRG. للحث على التمايز بكفاءة، يجب أن تكون الخلايا المتكاثرة بذرًا بكثافة منخفضة (2.5 × 104 خلايا/سم<sup...

Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells

في هذه الدراسة، ونحن نصف بروتوكول مفصل لتحفيز الكبد الحويصلي في خلايا HepaRG المتمايزة مع حمض دهني الملح الصوديوم oleate واستخدام أساليب للكشف عن والقياس الكمي لتراكم الدهون، بما في ذلك متماسكة المضادة للستوكس رامان التشتت (CARS) المجهرية، وتحليل السيتوفلورمتري، النفط الأحمر يا تلطيخ، وqPCR.

تحفيز وتوصيف التسيادي الحويصلي في خلايا HepaRG المتمايزة

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive ...

يصف هذا البروتوكول كيفية الحث على ترسب الكبد في خلايا الكبد المختلفة وطرق الكشف عن تراكم الدهون وتحديد كمه. يمثل هذا النموذج خلية الإنسان في المختبر بديلا قيما لنماذج الفئران في الجسم الحي و الكبدات البشرية الأولية. ذوبان النيتروجين cryopreserved دفعة منخفضة الممر من خلايا HepaRG عن طريق غمرها في حمام 37 درجة مئوية حتى تذاب.نقل الخلايا بسرعة إلى أنبوب 15 ملليلتر تحتوي على 10 ملليلتر من المتوسط المتكاثر. بعد الطرد المركزي لمدة خمس دقائق ، والتخلص من السوبر وrsuspend الخلايا في خمسة ملليلتر من المتوسط المتكاثر. عد الخلايا وتمييع من أجل لوحة 250، 000 خلية لكل سنتيمتر مربع.لوحة الخلايا على 100 ملليمتر أطباق ثقافة الخلية وتجديد المتوسطة كل يومين أو ثلاثة أيام. تتكاثر الخلايا مع تضاعف الوقت حوالي 24 ساعة. مرة واحدة في خلايا HepaRG تصل إلى 80٪ التقاء، وفصل لهم من خلال حضانة لمدة ثلاث إلى خمس دقائق مع 0.05٪ تريبسين الحل.جمع الخلايا في المتوسط المتكاثر والطرد المركزي لمدة خمس دقائق كما كان من قبل. تجاهل افراط وإعادة تعليق الخلايا مع خمسة ملليلتر من المتوسط المتكاثر. مرة أخرى، عد الخلايا وتمييع من أجل لوحة 250، 000 خلية لكل سنتيمتر مربع.في هذه المرحلة، تضخيم الخلايا بتكرار هذه الخطوات للوصول إلى عدد مناسب من الخلايا لبدء التجارب. للتبريد خلايا HepaRG، قم بفصل الخلايا بعد 24 ساعة من الطلاء من خلال حضانة لمدة ثلاث إلى خمس دقائق مع محلول 0.05٪trypsin. جمع الخلايا في المتوسط المتكاثر والطرد المركزي لمدة خمس دقائق كما كان من قبل.تجاهل supernatant، resuspend الخلايا في ملليلتر واحد لكل دفعة من متوسط التجميد، ولتبريد دفعات في النيتروجين السائل. في اليوم صفر، بذور خلايا HepaRG في 250،000 الخلايا في سنتيمتر مربع في الأطباق المعالجة بالثقافة مع حجم مناسب من متوسط الانتشار. هناك طبقان يجب أن يكون مطليا لكل مقايسة، أحدهما لخلايا التحكم و الآخر للخلايا المعالجة بالوليات.في اليوم الثاني واليوم الرابع، قم بتغيير الوسط مع حجم مناسب من وسيط الانتشار ودع الخلايا تنمو حتى تصل إلى التقاء. في اليوم السابع، يجب أن تكون الخلايا 100٪. غسل الخلايا مرة واحدة مع 1X PBS.ثم، إزالة 1X PBS وإضافة حجم مناسب من التمايز المتوسطة. في الأيام ثمانية وتسعة و12 و15 و18، تغسل الخلايا مرة واحدة مع 1X PBS قبل إضافة حجم مناسب من المتوسط التمايز. في اليوم 21، لاحظ خلايا HepaRG تحت المجهر وتأكد من أن الخلايا هي ثقافات متباينة التقاء.كتحكم، حصاد طبق تحكم واحد لإجراء تحليل التعبير الجيني للجينات علامة التمايز. في اليوم 21، يمكن أن تكون خلايا هيبارج المتمايزة في النيتروجين السائل. في اليوم 21، تخفيف الأوليات الصوديوم مع حجم مناسب من التمايز الكامل المتوسطة إلى التركيز النهائي من 250 ميكرومولار.إضافة 99٪ الميثانول بنسبة واحد إلى 400 في aliquot آخر من التمايز المتوسطة لجعل معالجة التحكم في السيارة. غسل الخلايا مرة واحدة مع 1X PBS وإضافة السيارة أو الصوديوم oleate المتوسطة. في اليوم 23 واليوم 25، قم بتغيير الوسط مع الحجم المناسب من المتوسط الطازج.في اليوم 26 ، لاحظ الخلايا عن طريق المجهر البصري. قطرات الدهون تتراكم في الخلايا المعالجة oleate الصوديوم و يمكن رؤيتها بسهولة مثل قطرات شفافة في السيتوبلازم. لأداء النفط الأحمر O تلطيخ، أولا غسل الخلايا مرة واحدة مع 1X PBS وإزالة برنامج تلفزيوني 1X تماما.أضف 4٪ شبه شكلي واحتضان لمدة 15 دقيقة في درجة حرارة الغرفة. إزالة شبهformaldehyde وغسل الخلايا مرتين مع 1X PBS. بعد إزالة برنامج تلفزيوني، احتضان الخلايا مع 60٪ isopropanol لمدة خمس دقائق في درجة حرارة الغرفة.إزالة ايزوبروبانول والسماح للخلايا الجافة تماما في درجة حرارة الغرفة. الآن إضافة زيت الأحمر O حل العمل إلى الخلايا واحتضان في درجة حرارة الغرفة لمدة 30 دقيقة. حجم حل العمل المطلوبة لكل عينة يتوافق مع حجم الوسائط المستخدمة لمعالجة الخلايا.قم بإزالة محلول Oil Red O وأضيف الماء المقطر المزدوج على الفور. بعد غسل الخلايا أربع مرات مع الماء المقطر المزدوج، الحصول على الصور تحت المجهر للتحليل. ل elute صبغة O النفط الأحمر، وإزالة كل الماء والسماح لتجف.ثم، إضافة ملليلتر واحد من 100٪ isopropanol واحتضان لمدة 10 دقائق مع اهتزاز لطيف في درجة حرارة الغرفة. الميبت ايزوبروبانول مع زيت مائل O صبغة صعودا وهبوطا عدة مرات، وضمان أن جميع O النفط الأحمر هو في الحل. نقل الحل إلى cuvette.قياس الكثافة البصرية في 500 نانومتر بواسطة القياس الطيفي واستخدام 100٪ isopropanol كما فارغة. غسل الخلايا مرة واحدة مع 1X PBS. ثم، احتضان مع 100 نانومولار من بوديبي المخفف في 1X PBS في الظلام لمدة 40 دقيقة في 37 درجة مئوية.يجب تضمين عنصر تحكم غير ملوث في قياسات قياس قياس التدفق. إزالة حل تلطيخ وغسل الخلايا مرة واحدة مع 1X PBS. ثم، وغسل الخلايا مرة أخرى وإزالة برنامج تلفزيوني تماما.أضف 4٪ شبه شكلي واحتضان لمدة 15 دقيقة في درجة حرارة الغرفة. إزالة شبهformaldehyde وغسل العينات ثلاث مرات لمدة خمس دقائق في برنامج تلفزيوني. يمكن الاحتفاظ بالخلايا في PBS 1X عند أربع درجات مئوية أو تصويرها على الفور.للتخزين، والتفاف مع بارا فيلم وتغطية مع رقائق الألومنيوم لمنع الخلايا من التجفيف. للتحقق من كفاءة الحث على ستاتيس، كانت ملطخة oleate-المعالجة والتحكم خلايا HepaRG مع زيت الأحمر O صبغة. بعد تلطيخ، قطرات الدهون مرئية بسهولة كما قطرات حمراء.يمكن قياس تلطيخ بواسطة قياس الطيفي لصبغة الزيت R O مع الايزوبروبانول. امتصاص زيت أحمر O مائل من الخلايا يتناسب بشكل مباشر مع تراكم قطرات الدهون السيتوبلازمية. تم تحديد تركيز الأوليات الصوديوم ووقت التعرض من قبل MTT قياس الخلية قياسي قياسي.يتم تحديد كمية المنتج Formosan من خلال امتصاصه في 490 نانومتر وتناسباً مباشراً مع عدد الخلايا الحية في الثقافة. تمت مقارنة علاج أوليات الصوديوم لعلاج بالميتات الصوديوم. تم استخدام دوكسوروبيسين المخدرات المبرمجة كتحكم.لقياس الزيادة في محتوى الدهون الخلوية بعد علاج الأوليات الصوديوم، تم استخدام تلطيخ مع صبغة بوديبي لتسمية قطرات الدهون. باستخدام تحليل cytofluorometric ، فمن الممكن تحديد محتوى الدهون الثلاثية بواسطة بوديبي يعني كثافة الفلورسنت ، وهو أعلى في الخلايا المعالجة الأوليات بالمقارنة مع الخلايا التحكم. وهذا يشير إلى تراكم الدهون كفاءة بعد المعالجة oleate.في الواقع، تظهر صور الخلايا الملطخة بصدبي قطرات الدهون الفلورية الخضراء الساطعة في الخلايا المعالجة بال oleate التي لا تظهر في خلايا التحكم. لمزيد من وصف تراكم قطرات الدهون بعد معالجة الأوليات الصوديوم، يمكن إجراء المجهر CARS كما هو موضح في بروتوكول النص الذي يتيح تكميم قطرات الدهون دون وضع العلامات. هذا النموذج القائم على الخلايا قد يزيد من المعرفة بالآليات الجزيئية المشاركة في أمراض الكبد الدهنية غير المُتَزَهَنة ويمكن أن يؤدي إلى وضع علامات جديدة للتشخيص المبكر واستراتيجيات العلاج الجديدة.

Research

JoVE Journal

Medicine

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

العزلة، وتوصيف المقارن التمييز بين الخلايا الجذعية البشرية الأسنان اللب المستمدة من الأسنان الدائمة باستخدام طريقتين مختلفتين

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

حمل عضلية للبطانة الشريانية الحميد مقابل تصلب الشرايين في فئران: مقدمة من اثنين من نماذج صالحة

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

Minimal Invasive Surgical Procedure of Inducing Myocardial Infarction in Mice

الحد الأدنى من الإجراءات الجراحية للتحريض احتشاء عضلة القلب في الفئران

Myocardial infarction still remains the main cause of death in western countries, despite considerable progress in the stent development area in the last ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

دراسة سرطان البنكرياس الجذعية خصائص الخلايا لتطوير استراتيجيات علاجية جديدة

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

الإجراءات في يحفز الزرق<em&gt; في فيفو</em&gt; نموذج الفأر وجبل لالجامع إعداد الشبكية

Glaucoma is a disease of the central nervous system affecting retinal ganglion cells (RGCs). RGC axons making up the optic nerve carry visual input to the ...

Inducing Ischemia-reperfusion Injury in the Mouse Ear Skin for Intravital Multiphoton Imaging of Immune Responses

حمل إصابة نقص التروية ضخه في الجلد الأذن ماوس لحيوي داخلي Multiphoton التصوير من الاستجابات المناعية

Ischemia-reperfusion injury (IRI) occurs when there is transient hypoxia due to the obstruction of blood flow (ischemia) followed by a subsequent ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin-الناجم عن تورم في الأمعاء Organoids: ل<em&gt; في المختبر</em&gt; الفحص لتقييم الاستجابة للدواء في التليف الكيسي المرضى

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

تحليل الأمثل ل<em&gt; في فيفو</em&gt; و<em&gt; في المختبر</em&gt; كبدي تشحم

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

إحداث إصابات الرئة الحادة في الفئران عن طريق التبيل المباشر للكيس الشحمي داخل الرغامى

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. ...

A Revised Method for Inducing Secondary Lymphedema in the Hindlimb of Mice

طريقه منقحه للحث علي الوذمه اللمفية الثانوية في الأطراف السفلية من الفئران

Animal models are of paramount importance in the research of lymphedema in order to understand the pathophysiology of the disease but also to explore ...