Name: inducing and characterizing vesicular steatosis in differentiated heparg cells
Uploaded: 2019-07-18T13:30:00
Description: Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Wij danken Prof. Christian Trepo (INSERM U871, Lyon, Frankrijk), die vriendelijk de HepaRG cellen geleverd. We zijn Rita Appodia dankbaar voor administratieve hulp. Dit werk werd gesteund door MIUR-Ministero dell'istruzione, dell'università e della Ricerca (FIRB 2011 – 2016 RBAP10XKNC) en Sapienza universiteit van Rome (prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

1. bereiding van de kweek media en reagentia
<ol><li>Prolifererend medium: supplement William's E medium met GlutaMAX, 10% foetaal runderserum (FBS), 1% penicileen/streptomycine, 5 μg/mL insuline en 0,5 μM hydrocortison hemisuccinaat.</li>
	<li>Differentiatie medium: supplement William's E medium met GlutaMAX, 10% FBS, 1% penicileen/streptomycine, 5 μg/mL insuline, 50 μM hydrocortison hemisuccinaat en 2% DMSO.</li>
	<li>Vries medium: supplement prolifererend medium met 10% DMSO.</li>
	<li>Natriumoleaat: oplossen in...

<ol>
	<li>Starley, B. Q., Calcagno, C. J., Harrison, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonalcoholic+fatty+liver+disease+and+hepatocellular+carcinoma:+a+weighty+connection.">Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection.</a> Hepatology. 51 (5), 1820-1832 (2010).</li><li>Byrne, C. D., Targher, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NAFLD:+a+multisystem+disease.">NAFLD: a multisystem disease.</a> Journal of Hepatology. 62 (1), 47-64 (2015).</li><li>Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+and+mechanisms+of+progression+of+non-+alcoholic+steatohepatitis.">Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis.</a> Trends in Molecular Medicine. 14, 72-81 (2008).</li><li>Chalasani, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diagnosis+and+management+of+nonalcoholic+fatty+liver+disease:+Practice+guidance+from+the+American+Association+for+the+Study+of+Liver+Diseases.">The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases.</a> Hepatology. 67 (1), 328-357 (2018).</li><li>Banini, B. A., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+future+pharmacologic+treatment+of+nonalcoholic+steatohepatitis.">Current and future pharmacologic treatment of nonalcoholic steatohepatitis.</a> Current Opinion in Gastroenterology. 33 (3), 134-141 (2017).</li><li>Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+pharmacological+therapies+for+nonalcoholic+fatty+liver+disease/nonalcoholic+steatohepatitis.">Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis.</a> World Journal of Gastroenterology. 21 (13), 3777-3785 (2015).</li><li>Younossi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+burden+of+NAFLD+and+NASH:+trends,+predictions,+risk+factors+and+prevention.">Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention.</a> Nature Reviews Gastroenterology &amp; Hepatology. 15 (1), 11-20 (2018).</li><li>Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+models+of+non-alcoholic+fatty+liver+disease.">Preclinical models of non-alcoholic fatty liver disease.</a> Journal of Hepatology. 68 (2), 230-237 (2018).</li><li>Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+mouse+models+for+the+study+of+nonalcoholic+fatty+liver+disease.">Genetically modified mouse models for the study of nonalcoholic fatty liver disease.</a> World Journal of. Gastroenterology. 18 (11), 1141-1153 (2012).</li><li>Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+scientific+discovery:+the+need+for+preclinical+models+of+nonalcoholic+steatohepatitis.">Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis.</a> Hepatology International. 12 (1), 6-16 (2018).</li><li>Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+human+hepatic+cell+lines+for+in+vitro+testing+and+research+purposes.">Immortalized human hepatic cell lines for in vitro testing and research purposes.</a> Methods in Molecular Biology. 1250, 53-76 (2015).</li><li>G&#243;mez-Lech&#243;n, M. J., Donato, M. T., Castell, J. V., Jover, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatocytes+in+primary+culture:+the+choice+to+investigate+drug+metabolism+in+man.">Human hepatocytes in primary culture: the choice to investigate drug metabolism in man.</a> Current Drug Metabolism. 5 (5), 443-462 (2004).</li><li>Marion, M. J., Hantz, O., Durantel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+HepaRG+cell+line:+biological+properties+and+relevance+as+a+tool+for+cell+biology,+drug+metabolism,+and+virology+studies.">The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies.</a> Methods in Molecular Biology. 640, 261-272 (2010).</li><li>Gripon, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+a+human+hepatoma+cell+line+by+hepatitis+B+virus.">Infection of a human hepatoma cell line by hepatitis B virus.</a> Proceedings of the National Academy of Sciences. 99 (24), 15655-15660 (2002).</li><li>Anth&#233;rieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+vesicular+steatosis+by+amiodarone+and+tetracycline+is+associated+with+up-regulation+of+lipogenic+genes+in+HepaRG+cells.">Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells.</a> Hepatology. 53 (6), 1895-1905 (2011).</li><li>Rouge, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PPAR+agonists+reduce+steatosis+in+oleic+acid-overloaded+HepaRG+cells.">PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells.</a> Toxicology and Applied Pharmacology. 276 (1), 73-81 (2014).</li><li>Belloni, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+phospho-STAT3-miRNAs+pathway+improves+vesicular+hepatic+steatosis+in+an+in+vitro+and+in+vivo+model.">Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model.</a> Scientific Reports. 8, 13638 (2018).</li><li>Nunn, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+deacetylase+inhibiting+drug+Entinostat+induces+lipid+accumulation+in+differentiated+HepaRG+cells.">The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells.</a> Scientific Reports. 6, 28025 (2016).</li><li>Donato, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytometric+analysis+for+drug-induced+steatosis+in+HepG2+cells.">Cytometric analysis for drug-induced steatosis in HepG2 cells.</a> Chemico-Biological Interactions. 181 (3), 417-423 (2009).</li><li>Hellerer, T., Ax&#228;ng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+lipid+storage+in+Caenorhabditis+elegans+using+coherent+anti-Stokes+Raman+scattering+(CARS)+microscopy.">Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy.</a> Proceedings of the National Academy of Sciences. 104 (37), 14658-14663 (2007).</li><li>Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+evaluation+of+hepatic+microvesicular+steatosis+with+multimodal+coherent+anti-Stokes+Raman+scattering+microscopy.">Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy.</a> PLoS One. 7 (11), 51092 (2012).</li><li>Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+hepatoma+HepaRG+cells:+a+highly+differentiated+model+for+studies+of+liver+metabolism+and+toxicity+of+xenobiotics.">The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics.</a> Chemico-Biological Interactions. 168 (1), 66-73 (2007).</li><li>Nelson, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatic+HepaRG+cells+maintain+an+organotypic+phenotype+with+high+intrinsic+CYP450+Activity/metabolism+and+significantly+outperform+standard+HepG2/C3A+cells+for+pharmaceutical+and+therapeutic+applications.">Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications.</a> Basic &amp; Clinical Pharmacology &amp; Toxicology. 120 (1), 30-37 (2017).</li><li>Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+human+hepatocytes,+HepG2+cells,+and+HepaRG+cells+at+the+mRNA+level+and+CYP+activity+in+response+to+inducers+and+their+predictivity+for+the+detection+of+human+hepatotoxins.">Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins.</a> Cell Biology and Toxicology. 28 (2), 69-87 (2012).</li><li>Pusl, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+sensitize+hepatocytes+to+bile+acid-induced+apoptosis.">Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis.</a> Biochemical and Biophysical Research Communications. 371 (3), 441-445 (2008).</li><li>Gentile, C. L., Pagliassotti, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+fatty+acids+in+the+development+and+progression+of+nonalcoholic+fatty+liver+disease.">The role of fatty acids in the development and progression of nonalcoholic fatty liver disease.</a> The Journal of Nutritional Biochemistry. 19 (9), 567-576 (2008).</li><li>Mei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+roles+of+unsaturated+and+saturated+fatty+acids+on+autophagy+and+apoptosis+in+hepatocytes.">Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes.</a> Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).</li><li>Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+induce+JNK-dependent+hepatocyte+lipoapoptosis.">Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis.</a> Journal of Biological Chemistry. 281, 12093-12101 (2006).</li><li>Moravcov&#225;, A., &#268;ervinkov&#225;, Z., Ku&#269;era, O., Mezera, V., Rychtrmoc, D., Lotkov&#225;, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+oleic+and+palmitic+acid+on+induction+of+steatosis+and+cytotoxicity+on+rat+hepatocytes+in+primary+culture.">The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture.</a> Physiological Research. 64, 627-636 (2015).</li><li>Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pitfall+in+using+BODIPY+dyes+to+label+lipid+droplets+for+fluorescence+microscopy.">A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy.</a> Histochemistry and Cell Biology. 133 (4), 477-480 (2010).</li><li>Rinia, H. A., Burger, K. N., Bonn, M., M&#252;ller, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+label-free+imaging+of+lipid+composition+and+packing+of+individual+cellular+lipid+droplets+using+multiplex+CARS+microscopy.">Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy.</a> Biophysical Journal. 95 (10), 4908-4914 (2008).</li><li>Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+in+situ+imaging+of+oil+body+dynamics+and+chemistry+in+germination.">Label-free in situ imaging of oil body dynamics and chemistry in germination.</a> Journal of The Royal Society Interface. 13 (123), (2016).</li><li>J&#252;ngst, C., Winterhalder, M. J., Zumbusch, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+long+term+lipid+droplet+tracking+with+CARS+microscopy.">Fast and long term lipid droplet tracking with CARS microscopy.</a> Journal of Biophotonics. 4 (6), 435-441 (2011).</li><li>Welte, M. A., Gould, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplet+functions+beyond+energy+storage.">Lipid droplet functions beyond energy storage.</a> Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862 (10), 1260-1272 (2017).</li><li>Cohen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+as+organelles.">Lipid droplets as organelles.</a> International Review of Cell and Molecular Biology. 337, 83-110 (2018).</li><li>Farese, R. V., Walther, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+finally+get+a+little+R-E-S-P-E-C-T.">Lipid droplets finally get a little R-E-S-P-E-C-T.</a> Cell. 139 (5), 855-860 (2009).</li></ol>

Dit protocol beschrijft hoe u de Heparylcellen onderscheidt en hoe u vesiculaire steatose door natriumoleaat behandeling induceert (Figuur 1A). Sterker nog, in vergelijking met andere humane hepatocellulaire carcinoom (HCC) cellijnen vertoont de heparg cellijn kenmerken van volwassen humane hepatocyten, die een waardevol alternatief vertegenwoordigen voor ex vivo gecultiveerde primaire humane hepatocyten13,14 ,...

Hepatische steatose wordt gedefinieerd als Intrahepatische vet accumulatie, binnen triglyceride-bevattende lipide druppeltjes, van ten minste 5% van de lever gewicht. Langdurige hepatische lipide-opslag is een potentieel omkeerbaar proces, echter, het kan leiden tot lever metabole dysfunctie, ontsteking en geavanceerde vormen van niet-alcoholische vette leverziekte (NAFLD), de overheersende oorzaak van chronische leverziekte in vele delen van de wereld1,2. Nafld is een multifactoriële ziekte die kan evolueren naar de agressievere niet-alcoholische Steatohepatitis (Nash), die op zijn beurt kan vorderen naar cirrose en, bij een klein percentage van de patiënten, tot hepatocellulair carcinoom (HCC)1,3. Er is momenteel geen goedgekeurde therapie beschikbaar als een specifieke behandeling voor nafld en de combinatie van dieet-en leefstijl modificaties blijft de pijler van nafld en Nash Management4,5,6.
De moleculaire mechanismen die leiden tot de ontwikkeling van hepatische steatose in de pathogenese van NAFLD moeten nog steeds worden opgehelderd7. In deze context zijn Muismodellen ontwikkeld om de progressie van de ziekte van de menselijke steatose te bestuderen. Een groot aantal verschillende modellen bestaat, en elk heeft zijn voor-en nadelen, met inbegrip van genetische, nutritionele en chemisch geïnduceerde modellen combineren verschillende benaderingen. Genetisch gemodificeerde (transgene of knock-out) muizen ontwikkelen spontaan leverziekte. Opgemerkt moet echter worden dat deze mutaties zeer zeldzaam zijn bij mensen en dat het verwijderen of overexpressie van een enkel gen (bijv. ob/ob-muis) de etiologie van de multifactoriële menselijke ziekte niet nabootsen op moleculair niveau8,9. Evenzo, de ziekte verworven door muizen na dieet of farmacologische manipulatie kan niet nabootsen van de effecten van menselijke diëten in verband met de ontwikkeling van NAFLD in man8. Diermodellen hebben echter de ontwikkelingen in het begrip van NAFLD vergemakkelijkt en deze aanpak is momenteel de meest gebruikte strategie in laboratoriumonderzoek. Niettemin, de replicatie bij mensen van resultaten verkregen in diermodellen herhaaldelijk is mislukt, waardoor slechte vertaling in de kliniek10.
Daarom kunnen in vitro modellen van NAFLD een fundamentele rol spelen in het verhelderend maken van de moleculaire mechanismen van NAFLD progressie, en ze vertegenwoordigen een waardevol hulpmiddel om een groot aantal verbindingen te schermen. Primaire celculturen, vereeuwigd cellijnen en lever biopsieën zijn uitgebreid gebruikt voor onderzoeksdoeleinden11. Primaire menselijke hepatocyten nauw lijken op menselijke klinische voorwaarden, maar er is een beperkt aantal donoren, en primaire celculturen vertonen slechte reproduceerbaarheid als gevolg van de variabiliteit van de cellen. Deze observaties, samen met ethische en logistieke kwesties, hebben geresulteerd in het gebruik van menselijke primaire hepatocyten wordt beperkt12. Dus, hepatische cellijnen vertegenwoordigen een handig alternatief, met een aantal essentiële voordelen ten opzichte van de primaire cultuur, als hepatische cellijnen groeien gestaag, hebben een bijna onbeperkte levensduur, en hebben een stabiel fenotype. Bovendien, cellijnen zijn gemakkelijk toegankelijk en de cultuur voorwaarden van hepatische cellijnen zijn eenvoudiger dan die van primaire hepatocyten en zijn gestandaardiseerd tussen verschillende laboratoria.
Hier beschrijven we in detail een in vitro cel-gebaseerd model van lever vesiculaire steatose, vertegenwoordigd door hepatische gedifferentieerde HepaRG cellen behandeld met het vetzuur natriumoleaat. De HepaRG cellijn werd opgericht van een vrouwelijke patiënt beïnvloed door hepatitis C infectie en een Edmondson Grade I goed gedifferentieerde lever tumor14. De HepaRG-cellijn is een humane bipotente voorlopercellen die kunnen differentiëren bij blootstelling aan 2% dimethylsulfoxide (DMSO) in de richting van twee verschillende fenotypes van de cel: biliaire-achtige en Hepatocyt-achtige. Gedifferentieerde HepaRG cellen (dHepaRG) delen sommige functies en eigenschappen met volwassen hepatocyten en bezitten de mogelijkheid om stabiel lever-specifieke genen zoals albumine, AldolaseB, cytochroom P450 2E1 (CYP2E1), en cytochroom P450 3A4 (CYP3A4)13 (stap 3). Behandeling van dheparg cellen met het vetzuur zout natriumoleaat (250 μM) voor 5 dagen leiden tot de generatie van cytoplasmatische lipide druppeltjes, nabootsen van de effecten van vette lever14,15,17,18 ( stap 4). Accumulatie van lipide druppeltjes kan gemakkelijk worden gedetecteerd door olie rood O kleuring (stap 5), een lysochroom vetoplosbare kleurstof die neutrale triglyceriden en lipiden rood-oranje vlekken. Om efficiënt kwantificeren lipiden in vette dHepaRG, hier illustreren we cytofluorimetrische analyse na kleuring met 4, 4-difluoro-1, 3, 5, 7-tetramethyl-4-Bora-3a, 4a-diaza-s-indacene (Bodipy 505/515) (stap 6), een lipofiele fluorescerende sonde die lokaliseert aan intracellulaire lipide lichamen en is gebruikt voor het labelen van lipide druppels19. Bovendien laten we hier zien hoe de steatose te evalueren door kwantitatieve polymerase kettingreactie (qPCR) (stap 7) genexpressie deregulering van verschillende metabole genen in dHepaRG cellen. Om de accumulatie van lipide druppeltjes na de behandeling met natriumoleaat verder te karakteriseren en te kwantificeren, voerden we coherente anti-Stokes Raman verstrooiing (AUTO'S) microscopie (stap 8), een innovatieve techniek die de visualisatie en kwantificering van lipide druppeltjes zonder labeling20,21.

<table border="0" cellpadding="0" cellspacing="0" style="width:799px;" width="797">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Hyclone HyClone Fetal Clone II&#160;</td>
			<td style="width:240px;">GE Healthcare</td>
			<td style="width:143px;">SH30066</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">William&#8217;s E medium with GlutaMAX&#160;</td>
			<td style="width:240px;">Thermofisher</td>
			<td>32551087</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/streptomycin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>P4333</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Insulin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>I9278</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">hydrocortisone hemisuccinate</td>
			<td style="width:240px;">SIGMA</td>
			<td>H2270</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">DMSO, dimethyl sulfoxide</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">D2438&#160;&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Sodium Oleate</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O7501&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Methanol</td>
			<td style="width:240px;">SIGMA</td>
			<td>179337</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Isopropanol</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">278475</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BODIPY 505/515</td>
			<td>Thermofisher</td>
			<td>D3921</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">PBS</td>
			<td style="width:240px;">Thermofisher</td>
			<td>14190-250</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution</td>
			<td style="width:240px;">SIGMA</td>
			<td>252549</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">RNAse free DNAseI</td>
			<td style="width:240px;">Promega</td>
			<td>M198A&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glass-bottomed dishes</td>
			<td style="width:240px;">Willco Wells</td>
			<td style="width:143px;">GWST-5040</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Oil Red solution</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O625</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">CellTiter 96 AQueous One Solution</td>
			<td style="width:240px;">Promega&#160;</td>
			<td style="width:143px;">G3582</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">q-PCR oligo name</td>
			<td>Sequence</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ACACB FOR</td>
			<td>CAAGCCGATCACCAAGAGTAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">ACACB REV</td>
			<td>CCCTGAGTTATCAGAGGCTGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin FOR</td>
			<td style="width:240px;">GCACTCTTCCAGCCTTCCT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin REV</td>
			<td style="width:240px;">AGGTCTTTGCGGATGTCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN FOR</td>
			<td>TGCTTGAATGTGCTGATGACAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN REV</td>
			<td>AAGGCAAGTCAGCAGGCATCTCATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB FOR</td>
			<td>GCATCTGTCAGCAGAATGGA&#160;</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB REV</td>
			<td>TAGACAGCAGCCAGGACCTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB FOR</td>
			<td>CCTCCGTTTTGGTGGTAGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB REV</td>
			<td>&#160;CCTAAAAGCTGGGAAGCTGA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 FOR</td>
			<td>CTCAGCTTCATGCAGGGTTA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 REV</td>
			<td>GGTGCTCCAGTAGTCTTTCAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A FOR</td>
			<td>TCATCAAGAAATGTCGCACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A REV</td>
			<td>GCCTCGTATGTGAGGCAAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 FOR</td>
			<td>TTGAAGCCTCTCGTTGACCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 REV</td>
			<td>CGTGGTGGGATACAGCCAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 FOR</td>
			<td>CTTCATCCAATGGACTGCATAAAT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 REV</td>
			<td>TCCCAAGTATAACACTCTACACAGACAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH FOR</td>
			<td>TGACAACTTTGGTATCGTGGAAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH REV</td>
			<td>AGGGATGATGTTCTGGAGAGCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM FOR</td>
			<td>TCTTTGGGTTTGCGGAATGTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM REV</td>
			<td>ATGCACATCTCGCTCTTGAATAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 FOR</td>
			<td>CCTGAACCTTCCAAAGATGGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 REV</td>
			<td>ACCTCAAACTCCAAAAGACCAGTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 FOR</td>
			<td>ACAGACAGGAAACCCAAGCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 REV</td>
			<td>TGGAGGTGAGAAGGAACATACACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 FOR</td>
			<td>TTGCAGTTGCCAATACCTATGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 REV</td>
			<td>CCAGTCACAGTAGTCGTCACA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 FOR</td>
			<td>AATGAGTTGGAGGGGCTGGGGGACATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 REV</td>
			<td>GGTCACCTAAACGAACGAAGTAGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD FOR</td>
			<td>TCTAGCTCCTATACCACCACCA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD REV</td>
			<td>TCGTCTCCAACTTATCTCCTCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 FOR</td>
			<td>TGCTCATCAACCGCAACGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 REV</td>
			<td>CCGACTCTCTTCCTTCATCTCCTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S FOR</td>
			<td>CGCCGCTAGAGGTGAAATTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S REV</td>
			<td>TTGGCAAATGCTTTCGCTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

inducing and characterizing vesicular steatosis in differentiated heparg cells

Hepatische steatose vertegenwoordigt een metabole dysfunctie die voortvloeit uit een accumulatie van triglyceride-bevattende lipide druppeltjes in hepatocyten. Overmatige vetophoping leidt tot niet-alcoholische vette leverziekte (NAFLD), die mogelijk omkeerbaar is en kan evolueren naar niet-alcoholische Steatohepatitis (NASH) en uiteindelijk cirrose en hepatocellulair carcinoom (HCC). De moleculaire mechanismen die de accumulatie van lipiden in hepatocyten koppelen aan de progressie naar NASH, onomkeerbare leverbeschadiging, fibrose, cirrose en zelfs HCC blijven onduidelijk. Hiervoor zijn verschillende in vitro en in vivo modellen ontwikkeld om de pathologische processen te verheldigen die NAFLD veroorzaken. In de huidige studie beschrijven we een cellulair model voor de inductie van vesiculaire steatose van de lever die bestaat uit DMSO-gedifferentieerde humane hepatische HepaRG cellen behandeld met het vetzuur zout natriumoleaat. Inderdaad, natriumoleaat-behandelde HepaRG cellen accumuleren lipide druppeltjes in het cytoplasma en vertonen typische kenmerken van steatose. Dit in vitro menselijk model vertegenwoordigt een waardevol alternatief voor in vivo muizen modellen en de primaire menselijke hepatocyten. We presenteren ook een vergelijking van verschillende methoden voor de kwantificering en evaluatie van vetophoping in HepaRG cellen, waaronder olie rode O-kleuring, cytofluorimetrische Bodipy-meting, metabolische genexpressie analyse door qPCR en coherente anti-Stokes Raman verstrooiing (AUTO'S) microscopie. CARS imaging combineert de chemische specificiteit van Raman-spectroscopie, een chemische analysetechniek die bekend staat in de toepassingen van materiaalwetenschappen, met de voordelen van hoge-snelheid, hoge-resolutie niet-lineaire optische microscopie om nauwkeurige kwantificering van lipide accumulatie en lipide druppel dynamiek. De invoering van een efficiënt in vitro model voor de inductie van vesiculaire steatose, naast een nauwkeurige methode voor de kwantificering en karakterisering van lipide accumulatie, kan leiden tot de ontwikkeling van vroege fase diagnose van NAFLD via de identificatie van moleculaire markers en het genereren van nieuwe behandelstrategieën.

Dit protocol beschrijft een efficiënte methode voor het induceren en karakteriseren van vesiculaire steatose in DMSO-gedifferentieerde HepaRG cellen door natriumoleaat behandeling (Figuur 1A).
Differentiatie van HepaRG cellen. Om differentiatie efficiënt te induceren, moeten prolifererende cellen worden gescheiden bij een lage dichtheid (2,5 x 104 cellen/cm2) in het proliferatie medium. Bij een lage dich...

Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells

In deze studie beschrijven we een gedetailleerd protocol voor het induceren van lever vesiculaire steatose in gedifferentieerde HepaRG cellen met het vetzuur zout natriumoleaat en gebruiken we methoden voor de detectie en kwantificering van lipide accumulatie, inclusief coherente anti-Stokes Raman verstrooiing (AUTO'S) microscopie, cytofluorimetrische analyse, olie rood O kleuring, en qPCR.

Het induceren en karakteriseren van vesiculaire steatose in gedifferentieerde HepaRG cellen

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive ...

Dit protocol beschrijft hoe lever vesiculaire steatose te induceren in gedifferentieerde HepaRG cellen en methoden voor detectie en kwantificering van lipide accumulatie. Dit in vitro menselijke celmodel is een waardevol alternatief voor in vivo muizenmodellen en voor primaire menselijke hepatocyten. Ontdooi een stikstof cryopreserved low-passage batch van HepaRG cellen door ze onder te dompelen in een 37 graden Celsius bad tot ontdooid.Breng de cellen snel over naar een buis van 15 milliliter met 10 milliliter vermenigvuldigend medium. Na vijf minuten centrifugeren, gooi je de supernatant weg en roep je de cellen opnieuw op in vijf milliliter vermenigvuldigend medium. Tel de cellen en verdun om 250.000 cellen per vierkante centimeter te plaatsen.Plaats de cellen op 100-millimeter celkweekschotels en vernieuw het medium om de twee of drie dagen. Cellen vermenigvuldigen zich met een verdubbelingstijd van ongeveer 24 uur. Zodra de HepaRG cellen bereiken 80%confluency, los ze via een drie-tot vijf minuten incubatie met 0,05% trypsin oplossing.Verzamel de cellen in vermenigvuldigend medium en centrifuge gedurende vijf minuten als voorheen. Gooi de supernatant weg en verhoog de cellen met vijf milliliter vermenigvuldigend medium. Tel nogmaals de cellen en verdun om 250.000 cellen per vierkante centimeter te plaatsen.Versterk in dit stadium de cellen door deze stappen te herhalen om een passend aantal cellen te bereiken om experimenten te starten. Om HepaRG-cellen te cryopreserveen, maak je de cellen 24 uur na het beplating los via een incubatie van drie tot vijf minuten met 0,05% trypsineoplossing. Verzamel de cellen in vermenigvuldigend medium en centrifuge gedurende vijf minuten als voorheen.Gooi de supernatant, resuspend de cellen in een milliliter per partij van het vriesmedium, en cryopreserve de partijen in vloeibare stikstof. Op dag nul, zaad HepaRG cellen op 250,000 cellen per vierkante centimeter in cultuur behandelde gerechten met een passend volume van proliferatie medium. Twee gerechten moeten worden verguld voor elke test, een voor controlecellen en een voor oleaat behandelde cellen.Op dag twee en dag vier, verander het medium met een passend volume van proliferatie medium en laat de cellen groeien totdat ze samenvloeiing te bereiken. Op dag zeven moeten de cellen 100% samenvloeiend zijn. Was de cellen één keer met 1X PBS.Verwijder vervolgens de 1X PBS en voeg een geschikt differentiatiemedium toe. Op dag acht, negen, 12, 15 en 18 was je de cellen één keer met 1X PBS voordat je een passend volume differentiatiemedium toevoegt. Observeer op dag 21 HepaRG-cellen onder een microscoop en zorg ervoor dat de cellen gedifferentieerde culturen zijn.Als een controle, oogst een controle schotel om genexpressie analyse van differentiatie marker genen uit te voeren. Op dag 21 kunnen gedifferentieerde HepaRG-cellen cryopreserved in vloeibare stikstof. Verdun op dag 21 natriumolelaat met een passend volume van volledig differentiatiemedium tot een uiteindelijke concentratie van 250 micromolar.Voeg 99% methanol bij een verhouding van een tot 400 in een andere aliquot van differentiatie medium om het voertuig controle behandeling te maken. Was de cellen eenmaal met 1X PBS en voeg voertuig of natriumoleate medium toe. Verander op dag 23 en dag 25 het medium met het juiste volume vers bereid medium.Observeer de cellen op dag 26 door optische microscopie. Lipidedruppels accumuleren in de met natriumoleaat behandelde cellen en zijn gemakkelijk zichtbaar als doorschijnende druppels in het cytoplasma. Om Oil Red O kleuring uit te voeren, eerst wassen de cellen een keer met 1X PBS en verwijder de 1X PBS volledig.Voeg 4% paraformaldehyde toe en incubeer gedurende 15 minuten bij kamertemperatuur. Verwijder de paraformaldehyde en was de cellen twee maal met 1X PBS. Na het verwijderen van de PBS, incubeer de cellen met 60% isopropanol gedurende vijf minuten bij kamertemperatuur.Verwijder het isopropanol en laat de cellen volledig drogen bij kamertemperatuur. Voeg nu oil red o werkoplossing aan de cellen en incubeer bij kamertemperatuur gedurende 30 minuten. Het volume van de werkoplossing die voor elk monster nodig is, komt overeen met het volume van de media die worden gebruikt voor het kweken van de cellen.Verwijder de Oil Red O-oplossing en voeg onmiddellijk dubbel gedestilleerd water toe. Na het wassen van de cellen vier keer met dubbel gedestilleerd water, verwerven beelden onder de microscoop voor analyse. Om de Olie Rode O kleurstof elute, verwijder al het water en laat drogen.Voeg vervolgens een milliliter van 100% isopropanol toe en incubbate gedurende 10 minuten met zacht schudden bij kamertemperatuur. Pipette de isopropanol met eluted Oil Red O kleurstof op en neer meerdere malen, ervoor te zorgen dat alle olie Red O is in de oplossing. Breng de oplossing over naar een cuvette.Meet de optische dichtheid op 500 nanometer door spectrofotometrie en gebruik 100% isopropanol als blanco. Was de cellen één keer met 1X PBS. Dan, incubeer met 100 nanomolar van Bodipy verdund in 1X PBS in het donker gedurende 40 minuten bij 37 graden Celsius.Een niet-bevlekte controle moet worden opgenomen in de stroom cytometrie metingen. Verwijder de kleuroplossing en was de cellen eenmaal met 1X PBS. Was vervolgens de cellen opnieuw en verwijder de PBS volledig.Voeg 4% paraformaldehyde toe en incubeer gedurende 15 minuten bij kamertemperatuur. Verwijder de paraformaldehyde en was de monsters drie keer gedurende vijf minuten in PBS. Cellen kunnen worden bewaard in 1X PBS op vier graden Celsius of onmiddellijk afgebeeld.Voor opslag, wikkel met Parafilm en bedek met aluminiumfolie om te voorkomen dat de cellen drogen. Om te controleren of efficiënte inductie van steatose, oleate-behandelde en controle HepaRG cellen werden gekleurd met Oil Red O kleurstof. Na het bevlekken zijn lipidedruppels goed zichtbaar als rode druppeltjes.Kleuring kan worden gekwantificeerd door spectrofotometrische meting van Olie R O kleurstof geëuterd met isopropanol. Absorptie van eluted Oil Red O uit de cellen is direct evenredig met cytoplasmische lipide druppel accumulatie. Natriumoleaatconcentratie en blootstellingstijd werden bepaald door MTT colorimetrische cel levensvatbaarheidstest.Het Formosan product wordt gekwantificeerd door zijn absorptie op 490 nanometer en is direct evenredig met het aantal levende cellen in de cultuur. Natriumoleaat behandeling werd vergeleken met natrium palmitaten behandeling. De apoptotische drug doxorubicine werd gebruikt als een controle.Om de toename van cellulaire lipidegehalte na natriumolelaatbehandeling te kwantificeren, werd kleuring met Bodipy-kleurstof gebruikt om lipidedruppels te labelen. Met behulp van cytofluorometrische analyse is het mogelijk om het triglyceridegehalte te kwantificeren met Bodipy gemiddelde fluorescerende intensiteit, die hoger is in met oleate behandelde cellen in vergelijking met controlecellen. Dit duidt op een efficiënte vetophoping na de behandeling met oleaat.Inderdaad, beelden van Bodipy-gekleurde cellen tonen felgroene fluorescerende lipide druppels in oleaat behandelde cellen die niet zichtbaar zijn in de controlecellen. Om de accumulatie van lipidedruppels na natriumoleatebehandeling verder te karakteriseren, kan CARS-microscopie worden uitgevoerd zoals beschreven in het tekstprotocol, waardoor lipidedruppels kwantificering mogelijk maken zonder etikettering. Dit op cellen gebaseerde model kan de kennis van de moleculaire mechanismen die betrokken zijn bij niet-oncotische leververvetting vergroten en kan leiden tot de ontwikkeling van nieuwe markers voor vroegtijdige diagnose en nieuwe behandelingsstrategieën.

Research

JoVE Journal

Medicine

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Isolatie, karakterisering en vergelijkende differentiatie van humane Dental Pulp stamcellen uit permanente tanden met behulp van twee verschillende methoden

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

Inducerende Myointimal Hyperplasie Versus atherosclerose in Muizen: Een inleiding van twee geldige Models

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

Minimal Invasive Surgical Procedure of Inducing Myocardial Infarction in Mice

Minimaal invasieve chirurgische procedure voor het induceren van Myocardinfarct in Muizen

Myocardial infarction still remains the main cause of death in western countries, despite considerable progress in the stent development area in the last ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Studeren alvleesklier- Stamcel Kenmerken voor het ontwikkelen van nieuwe behandelingsstrategieën

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoom-inducerende Procedure in een<em&gt; In Vivo</em&gt; Rat Model en Whole-mount Retina Voorbereiding

Glaucoma is a disease of the central nervous system affecting retinal ganglion cells (RGCs). RGC axons making up the optic nerve carry visual input to the ...

Inducing Ischemia-reperfusion Injury in the Mouse Ear Skin for Intravital Multiphoton Imaging of Immune Responses

Induceren van ischemie-reperfusie schade in de Mouse Ear Skin voor intravitale Multiphoton Imaging van immuunresponsen

Ischemia-reperfusion injury (IRI) occurs when there is transient hypoxia due to the obstruction of blood flow (ischemia) followed by a subsequent ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskoline-geïnduceerde zwelling in Intestinal Organoids: An<em&gt; In Vitro</em&gt; Assay voor het beoordelen van de Drug Response in patiënten met cystische fibrose

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Geoptimaliseerd Analyse van<em&gt; In Vivo</em&gt; en<em&gt; In Vitro</em&gt; Leversteatose

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

Inducerende acute Long blessure bij muizen door directe Intratracheal lipopolysaccharide instillatie

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. ...

A Revised Method for Inducing Secondary Lymphedema in the Hindlimb of Mice

Een herziene methode voor het induceren van secundair lymfoedeem in het achterlijf van muizen

Animal models are of paramount importance in the research of lymphedema in order to understand the pathophysiology of the disease but also to explore ...