Name: inducing and characterizing vesicular steatosis in differentiated heparg cells
Uploaded: 2019-07-18T13:30:00
Description: Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Nous remercions le prof. Christian Trepo (INSERM U871, Lyon, France), qui a gentiment fourni des cellules HepaRG. Nous sommes reconnaissants à Rita Appodia pour son aide administrative. Ce travail a été soutenu par MIUR-Ministero dell'istruzione, dell'università e della ricerca (FIRB 2011-2016 RBAP10XKNC) et Sapienza University of Rome (prot. C26A13T8PS; Prot. C26A142MCH; Prot. C26A15LSXL).

1. Préparation des médias culturels et des réactifs
<ol><li>Moyen proliférant : supplément du milieu E de William avec glutaMAX, 10% sérum bovin foetal (FBS), 1% pénicilline/streptomycine, insuline de 5 g/mL et 0.5 'M d'hemisuccinate d'hydrocortisone.</li>
	<li>Moyen de différenciation : supplément du milieu E de William avec GlutaMAX, 10% FBS, 1% pénicilline/streptomycine, insuline de 5 g/mL, 50 'M d'hémicine hydrocortisone et 2% d'hemisuccinate d'hydrocortisone et 2% de DMSO.</li>
	<li>Milieu de congélati...

<ol>
	<li>Starley, B. Q., Calcagno, C. J., Harrison, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonalcoholic+fatty+liver+disease+and+hepatocellular+carcinoma:+a+weighty+connection.">Nonalcoholic fatty liver disease and hepatocellular carcinoma: a weighty connection.</a> Hepatology. 51 (5), 1820-1832 (2010).</li><li>Byrne, C. D., Targher, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NAFLD:+a+multisystem+disease.">NAFLD: a multisystem disease.</a> Journal of Hepatology. 62 (1), 47-64 (2015).</li><li>Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., Tiribelli, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+and+mechanisms+of+progression+of+non-+alcoholic+steatohepatitis.">Molecular basis and mechanisms of progression of non- alcoholic steatohepatitis.</a> Trends in Molecular Medicine. 14, 72-81 (2008).</li><li>Chalasani, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diagnosis+and+management+of+nonalcoholic+fatty+liver+disease:+Practice+guidance+from+the+American+Association+for+the+Study+of+Liver+Diseases.">The diagnosis and management of nonalcoholic fatty liver disease: Practice guidance from the American Association for the Study of Liver Diseases.</a> Hepatology. 67 (1), 328-357 (2018).</li><li>Banini, B. A., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+and+future+pharmacologic+treatment+of+nonalcoholic+steatohepatitis.">Current and future pharmacologic treatment of nonalcoholic steatohepatitis.</a> Current Opinion in Gastroenterology. 33 (3), 134-141 (2017).</li><li>Takahashi, Y., Sugimoto, K., Inui, H., Fukusato, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+pharmacological+therapies+for+nonalcoholic+fatty+liver+disease/nonalcoholic+steatohepatitis.">Current pharmacological therapies for nonalcoholic fatty liver disease/nonalcoholic steatohepatitis.</a> World Journal of Gastroenterology. 21 (13), 3777-3785 (2015).</li><li>Younossi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+burden+of+NAFLD+and+NASH:+trends,+predictions,+risk+factors+and+prevention.">Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention.</a> Nature Reviews Gastroenterology &amp; Hepatology. 15 (1), 11-20 (2018).</li><li>Santhekadur, P. K., Kumar, D. P., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preclinical+models+of+non-alcoholic+fatty+liver+disease.">Preclinical models of non-alcoholic fatty liver disease.</a> Journal of Hepatology. 68 (2), 230-237 (2018).</li><li>Nagarajan, P., Mahesh Kumar, M. J., Venkatesan, R., Majundar, S. S., Juyal, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+mouse+models+for+the+study+of+nonalcoholic+fatty+liver+disease.">Genetically modified mouse models for the study of nonalcoholic fatty liver disease.</a> World Journal of. Gastroenterology. 18 (11), 1141-1153 (2012).</li><li>Oseini, A. M., Cole, B. K., Issa, D., Feaver, R. E., Sanyal, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+scientific+discovery:+the+need+for+preclinical+models+of+nonalcoholic+steatohepatitis.">Translating scientific discovery: the need for preclinical models of nonalcoholic steatohepatitis.</a> Hepatology International. 12 (1), 6-16 (2018).</li><li>Ramboer, E., Vanhaecke, T., Rogiers, V., Vinken, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+human+hepatic+cell+lines+for+in+vitro+testing+and+research+purposes.">Immortalized human hepatic cell lines for in vitro testing and research purposes.</a> Methods in Molecular Biology. 1250, 53-76 (2015).</li><li>G&#243;mez-Lech&#243;n, M. J., Donato, M. T., Castell, J. V., Jover, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatocytes+in+primary+culture:+the+choice+to+investigate+drug+metabolism+in+man.">Human hepatocytes in primary culture: the choice to investigate drug metabolism in man.</a> Current Drug Metabolism. 5 (5), 443-462 (2004).</li><li>Marion, M. J., Hantz, O., Durantel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+HepaRG+cell+line:+biological+properties+and+relevance+as+a+tool+for+cell+biology,+drug+metabolism,+and+virology+studies.">The HepaRG cell line: biological properties and relevance as a tool for cell biology, drug metabolism, and virology studies.</a> Methods in Molecular Biology. 640, 261-272 (2010).</li><li>Gripon, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+a+human+hepatoma+cell+line+by+hepatitis+B+virus.">Infection of a human hepatoma cell line by hepatitis B virus.</a> Proceedings of the National Academy of Sciences. 99 (24), 15655-15660 (2002).</li><li>Anth&#233;rieu, S., Rogue, A., Fromenty, B., Guillouzo, A., Robin, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+vesicular+steatosis+by+amiodarone+and+tetracycline+is+associated+with+up-regulation+of+lipogenic+genes+in+HepaRG+cells.">Induction of vesicular steatosis by amiodarone and tetracycline is associated with up-regulation of lipogenic genes in HepaRG cells.</a> Hepatology. 53 (6), 1895-1905 (2011).</li><li>Rouge, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PPAR+agonists+reduce+steatosis+in+oleic+acid-overloaded+HepaRG+cells.">PPAR agonists reduce steatosis in oleic acid-overloaded HepaRG cells.</a> Toxicology and Applied Pharmacology. 276 (1), 73-81 (2014).</li><li>Belloni, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+a+phospho-STAT3-miRNAs+pathway+improves+vesicular+hepatic+steatosis+in+an+in+vitro+and+in+vivo+model.">Targeting a phospho-STAT3-miRNAs pathway improves vesicular hepatic steatosis in an in vitro and in vivo model.</a> Scientific Reports. 8, 13638 (2018).</li><li>Nunn, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+histone+deacetylase+inhibiting+drug+Entinostat+induces+lipid+accumulation+in+differentiated+HepaRG+cells.">The histone deacetylase inhibiting drug Entinostat induces lipid accumulation in differentiated HepaRG cells.</a> Scientific Reports. 6, 28025 (2016).</li><li>Donato, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytometric+analysis+for+drug-induced+steatosis+in+HepG2+cells.">Cytometric analysis for drug-induced steatosis in HepG2 cells.</a> Chemico-Biological Interactions. 181 (3), 417-423 (2009).</li><li>Hellerer, T., Ax&#228;ng, C., Brackmann, C., Hillertz, P., Pilon, M., Enejder, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+lipid+storage+in+Caenorhabditis+elegans+using+coherent+anti-Stokes+Raman+scattering+(CARS)+microscopy.">Monitoring of lipid storage in Caenorhabditis elegans using coherent anti-Stokes Raman scattering (CARS) microscopy.</a> Proceedings of the National Academy of Sciences. 104 (37), 14658-14663 (2007).</li><li>Le, T. T., Ziemba, A., Urasaki, Y., Brotman, S., Pizzorno, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+evaluation+of+hepatic+microvesicular+steatosis+with+multimodal+coherent+anti-Stokes+Raman+scattering+microscopy.">Label-free evaluation of hepatic microvesicular steatosis with multimodal coherent anti-Stokes Raman scattering microscopy.</a> PLoS One. 7 (11), 51092 (2012).</li><li>Guillouzo, A., Corlu, A., Aninat, C., Glaise, D., Morel, F., Guguen-Guillouzo, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+hepatoma+HepaRG+cells:+a+highly+differentiated+model+for+studies+of+liver+metabolism+and+toxicity+of+xenobiotics.">The human hepatoma HepaRG cells: a highly differentiated model for studies of liver metabolism and toxicity of xenobiotics.</a> Chemico-Biological Interactions. 168 (1), 66-73 (2007).</li><li>Nelson, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+hepatic+HepaRG+cells+maintain+an+organotypic+phenotype+with+high+intrinsic+CYP450+Activity/metabolism+and+significantly+outperform+standard+HepG2/C3A+cells+for+pharmaceutical+and+therapeutic+applications.">Human hepatic HepaRG cells maintain an organotypic phenotype with high intrinsic CYP450 Activity/metabolism and significantly outperform standard HepG2/C3A cells for pharmaceutical and therapeutic applications.</a> Basic &amp; Clinical Pharmacology &amp; Toxicology. 120 (1), 30-37 (2017).</li><li>Gerets, H. H. J., Tilmant, K., Gerin, B., Chanteux, H., Depelchin, B. O., Dhalluin, S., Atienzar, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+primary+human+hepatocytes,+HepG2+cells,+and+HepaRG+cells+at+the+mRNA+level+and+CYP+activity+in+response+to+inducers+and+their+predictivity+for+the+detection+of+human+hepatotoxins.">Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins.</a> Cell Biology and Toxicology. 28 (2), 69-87 (2012).</li><li>Pusl, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+sensitize+hepatocytes+to+bile+acid-induced+apoptosis.">Free fatty acids sensitize hepatocytes to bile acid-induced apoptosis.</a> Biochemical and Biophysical Research Communications. 371 (3), 441-445 (2008).</li><li>Gentile, C. L., Pagliassotti, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+fatty+acids+in+the+development+and+progression+of+nonalcoholic+fatty+liver+disease.">The role of fatty acids in the development and progression of nonalcoholic fatty liver disease.</a> The Journal of Nutritional Biochemistry. 19 (9), 567-576 (2008).</li><li>Mei, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+roles+of+unsaturated+and+saturated+fatty+acids+on+autophagy+and+apoptosis+in+hepatocytes.">Differential roles of unsaturated and saturated fatty acids on autophagy and apoptosis in hepatocytes.</a> Journal of Pharmacological Experimental Therapy. 339, 487-498 (2011).</li><li>Malhi, H., Bronk, S. F., Werneburg, N. W., Gores, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free+fatty+acids+induce+JNK-dependent+hepatocyte+lipoapoptosis.">Free fatty acids induce JNK-dependent hepatocyte lipoapoptosis.</a> Journal of Biological Chemistry. 281, 12093-12101 (2006).</li><li>Moravcov&#225;, A., &#268;ervinkov&#225;, Z., Ku&#269;era, O., Mezera, V., Rychtrmoc, D., Lotkov&#225;, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+oleic+and+palmitic+acid+on+induction+of+steatosis+and+cytotoxicity+on+rat+hepatocytes+in+primary+culture.">The effect of oleic and palmitic acid on induction of steatosis and cytotoxicity on rat hepatocytes in primary culture.</a> Physiological Research. 64, 627-636 (2015).</li><li>Ohsaki, Y., Shinohara, Y., Suzuki, M., Fujimoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pitfall+in+using+BODIPY+dyes+to+label+lipid+droplets+for+fluorescence+microscopy.">A pitfall in using BODIPY dyes to label lipid droplets for fluorescence microscopy.</a> Histochemistry and Cell Biology. 133 (4), 477-480 (2010).</li><li>Rinia, H. A., Burger, K. N., Bonn, M., M&#252;ller, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+label-free+imaging+of+lipid+composition+and+packing+of+individual+cellular+lipid+droplets+using+multiplex+CARS+microscopy.">Quantitative label-free imaging of lipid composition and packing of individual cellular lipid droplets using multiplex CARS microscopy.</a> Biophysical Journal. 95 (10), 4908-4914 (2008).</li><li>Waschatko, G., Billecke, N., Schwendy, S., Jaurich, H., Bonn, M., Vilgis, T. A., Parekh, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+in+situ+imaging+of+oil+body+dynamics+and+chemistry+in+germination.">Label-free in situ imaging of oil body dynamics and chemistry in germination.</a> Journal of The Royal Society Interface. 13 (123), (2016).</li><li>J&#252;ngst, C., Winterhalder, M. J., Zumbusch, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+long+term+lipid+droplet+tracking+with+CARS+microscopy.">Fast and long term lipid droplet tracking with CARS microscopy.</a> Journal of Biophotonics. 4 (6), 435-441 (2011).</li><li>Welte, M. A., Gould, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplet+functions+beyond+energy+storage.">Lipid droplet functions beyond energy storage.</a> Biochimica et Biophysica Acta - Molecular and Cell Biology of Lipids. 1862 (10), 1260-1272 (2017).</li><li>Cohen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+as+organelles.">Lipid droplets as organelles.</a> International Review of Cell and Molecular Biology. 337, 83-110 (2018).</li><li>Farese, R. V., Walther, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid+droplets+finally+get+a+little+R-E-S-P-E-C-T.">Lipid droplets finally get a little R-E-S-P-E-C-T.</a> Cell. 139 (5), 855-860 (2009).</li></ol>

Ce protocole décrit comment différencier les cellules HepaRG et comment induire la stéatose vésiculaire par traitement à l'avoine de sodium (Figure 1A). En effet, par rapport à d'autres lignées cellulaires du carcinome hépatocellulaire humain (HCC), la lignée cellulaire HepaRG présente des caractéristiques d'hépatocytes humains adultes, représentant une alternative précieuse aux hépatocytes humains primaires cultivés ex vivo13,</s...

La stéatose hépatique est définie comme une accumulation de graisse intrahépatique, dans des gouttelettes lipidiques contenant des triglycérides, d'au moins 5 % du poids du foie. Le stockage hépatique prolongé de lipide est un processus potentiellement réversible, cependant, il peut mener au dysfonctionnement métabolique de foie, à l'inflammation et aux formes avancées de la maladie hépatique non alcoolique (NAFLD), la cause prédominante de la maladie chronique de foie dans beaucoup de parties de le monde1,2. NAFLD est une maladie multifactorielle qui peut évoluer vers la stéatohépatite non alcoolique plus agressive (NASH), qui à son tour peut progresser vers la cirrhose et, dans un petit pourcentage de patients, au carcinome hépatocellulaire (HCC)1,3. Aucun traitement approuvé n'est actuellement disponible comme traitement spécifique pour NAFLD et la combinaison des modifications de régime et de mode de vie reste le pilier de la gestion de NAFLD et de NASH4,5,6.
Les mécanismes moléculaires menant au développement de la stéatose hépatique dans la pathogénie de NAFLD restent à élucider7. Dans ce contexte, des modèles murins ont été développés pour étudier la progression de la maladie de stéatose humaine. Une myriade de modèles différents existe, et chacun a ses avantages et ses inconvénients, y compris les modèles génétiques, nutritionnels et induits chimiquement combinant des approches différentes. Les souris génétiquement modifiées (transgéniques ou knock-out) développent spontanément une maladie du foie. Cependant, il convient de noter que ces mutations sont très rares chez l'homme et la suppression ou la surexpression d'un seul gène (par exemple, ob / ob souris) ne peut pas imiter l'étiologie de la maladie humaine multifactorielle au niveau moléculaire8,9. De même, la maladie acquise par les souris après manipulation diététique ou pharmacologique ne peutpas imiter les effets des régimes humains liés au développement de NAFLD dans l'homme 8. Les modèles animaux ont toutefois facilité l'évolution de la compréhension de la NAFLD et cette approche est actuellement la stratégie la plus utilisée dans la recherche en laboratoire. Néanmoins, la réplication chez l'homme des résultats obtenus dans les modèles animaux a échoué à plusieurs reprises, provoquant une mauvaise traduction dans la clinique10.
Par conséquent, les modèles in vitro de NAFLD peuvent jouer un rôle fondamental en élucidant les mécanismes moléculaires de la progression de NAFLD, et ils représentent un outil valable pour examiner un grand nombre de composés. Les cultures cellulaires primaires, les lignées cellulaires immortalisées et les biopsies hépatiques ont été largement utilisées à des fins de recherche11. Les hépatocytes humains primaires ressemblent étroitement aux conditions cliniques humaines, mais il y a un nombre limité de donneurs, et les cultures primaires de cellules montrent la reproductibilité pauvre due à la variabilité des cellules. Ces observations, ainsi que des questions éthiques et logistiques, ont entraîné l'utilisation d'hépatocytes primaires humains étant limité12. Ainsi, les lignées cellulaires hépatiques représentent une alternative pratique, ayant plusieurs avantages essentiels sur la culture primaire, que les lignées cellulaires hépatiques se développent régulièrement, ont une durée de vie presque illimitée, et ont un phénotype stable. En outre, les lignées cellulaires sont facilement accessibles et les conditions de culture des lignées cellulaires hépatiques sont plus simples que celles des hépatocytes primaires et sont normalisées entre les différents laboratoires.
Ici, nous décrivons en détail un modèle cellulaire in vitro de stéatose vésiculaire de foie, représenté par les cellules hepaRG différenciées hépatiques traitées avec l'oleat de sodium d'acide gras. La ligne cellulaire de HepaRG a été établie à partir d'un patient féminin affecté par l'infection d'hépatite C et d'une tumeur bien différenciée de foie de catégorie I d'Edmondson14. La lignée cellulaire HepaRG est une lignée cellulaire bipotente humaine capable de se différencier lors de l'exposition au sulfoxure de diméthyle (DMSO) de 2 % vers deux phénotypes cellulaires différents : les cellules biliaires et hépatocytes. Les cellules HepaRG différenciées (dHepaRG) partagent certaines caractéristiques et propriétés avec les hépatocytes adultes et possèdent la capacité d'exprimer de façon stable des gènes spécifiques au foie tels que l'albumine, l'aldolaseB, le Cytochrome P450 2E1 (CYP2E1) et cytochrome P450 3A4 (CYP3A4)13 (étape 3). Le traitement des cellules dHepaRG avec l'oleat de sodium de sel de sel d'acide gras (250 M) pendant 5 jours mènent à la génération des gouttelettes cytoplasmiques de lipide, imitant les effets du foie gras14,15,17,18 ( étape 4). L'accumulation de gouttelettes lipidiques peut être facilement détectée par la coloration Oil Red O (étape 5), un colorant liposoluble lysochrome qui tache les triglycérides neutres et les lipides rouge-orange. Pour quantifier efficacement les lipides dans le dHepaRG gras, nous illustrons ici l'analyse cytofluorimétrique après coloration avec 4,4-difluoro-1,3,5,5,7-tétramethyl-4-bora-3a,4a-diaza-s-indacene (Bodipy 505/515) (étape 6), une sonde fluorescente lipophile qui localise aux corps lipidiques intracellulaires et a été utilisé pour étiqueter les gouttelettes lipidiques19. En outre, ici nous montrons comment évaluer la stéatose par réaction quantitative en chaîne de polymérase (qPCR) (étape 7) déréglementation d'expression de gène de plusieurs gènes métaboliques dans les cellules dHepaRG. Pour caractériser et quantifier davantage l'accumulation de gouttelettes lipidiques après le traitement à l'avoine de sodium, nous avons effectué une microscopie cohérente de diffusion anti-Stokes Raman (CARS) (étape 8), une technique innovante qui permet la visualisation et la quantification de gouttelettes lipidiques sans étiquetage20,21.

<table border="0" cellpadding="0" cellspacing="0" style="width:799px;" width="797">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Hyclone HyClone Fetal Clone II&#160;</td>
			<td style="width:240px;">GE Healthcare</td>
			<td style="width:143px;">SH30066</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">William&#8217;s E medium with GlutaMAX&#160;</td>
			<td style="width:240px;">Thermofisher</td>
			<td>32551087</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Penicillin/streptomycin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>P4333</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Insulin&#160;</td>
			<td style="width:240px;">SIGMA</td>
			<td>I9278</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">hydrocortisone hemisuccinate</td>
			<td style="width:240px;">SIGMA</td>
			<td>H2270</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">DMSO, dimethyl sulfoxide</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">D2438&#160;&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Sodium Oleate</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O7501&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Methanol</td>
			<td style="width:240px;">SIGMA</td>
			<td>179337</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Isopropanol</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">278475</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BODIPY 505/515</td>
			<td>Thermofisher</td>
			<td>D3921</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">PBS</td>
			<td style="width:240px;">Thermofisher</td>
			<td>14190-250</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Formaldehyde solution</td>
			<td style="width:240px;">SIGMA</td>
			<td>252549</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">RNAse free DNAseI</td>
			<td style="width:240px;">Promega</td>
			<td>M198A&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glass-bottomed dishes</td>
			<td style="width:240px;">Willco Wells</td>
			<td style="width:143px;">GWST-5040</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">Oil Red solution</td>
			<td style="width:240px;">SIGMA</td>
			<td style="width:143px;">O625</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:239px;">CellTiter 96 AQueous One Solution</td>
			<td style="width:240px;">Promega&#160;</td>
			<td style="width:143px;">G3582</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">q-PCR oligo name</td>
			<td>Sequence</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ACACB FOR</td>
			<td>CAAGCCGATCACCAAGAGTAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">ACACB REV</td>
			<td>CCCTGAGTTATCAGAGGCTGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin FOR</td>
			<td style="width:240px;">GCACTCTTCCAGCCTTCCT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:239px;">b-actin REV</td>
			<td style="width:240px;">AGGTCTTTGCGGATGTCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN FOR</td>
			<td>TGCTTGAATGTGCTGATGACAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALBUMIN REV</td>
			<td>AAGGCAAGTCAGCAGGCATCTCATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB FOR</td>
			<td>GCATCTGTCAGCAGAATGGA&#160;</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ALDOB REV</td>
			<td>TAGACAGCAGCCAGGACCTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB FOR</td>
			<td>CCTCCGTTTTGGTGGTAGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOB REV</td>
			<td>&#160;CCTAAAAGCTGGGAAGCTGA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 FOR</td>
			<td>CTCAGCTTCATGCAGGGTTA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">APOC3 REV</td>
			<td>GGTGCTCCAGTAGTCTTTCAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A FOR</td>
			<td>TCATCAAGAAATGTCGCACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CPT1A REV</td>
			<td>GCCTCGTATGTGAGGCAAAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 FOR</td>
			<td>TTGAAGCCTCTCGTTGACCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP2E1 REV</td>
			<td>CGTGGTGGGATACAGCCAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 FOR</td>
			<td>CTTCATCCAATGGACTGCATAAAT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CYP3A4 REV</td>
			<td>TCCCAAGTATAACACTCTACACAGACAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH FOR</td>
			<td>TGACAACTTTGGTATCGTGGAAGG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GAPDH REV</td>
			<td>AGGGATGATGTTCTGGAGAGCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM FOR</td>
			<td>TCTTTGGGTTTGCGGAATGTT</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">GPAM REV</td>
			<td>ATGCACATCTCGCTCTTGAATAA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 FOR</td>
			<td>CCTGAACCTTCCAAAGATGGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">IL6 REV</td>
			<td>ACCTCAAACTCCAAAAGACCAGTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 FOR</td>
			<td>ACAGACAGGAAACCCAAGCCAC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PDK4 REV</td>
			<td>TGGAGGTGAGAAGGAACATACACG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 FOR</td>
			<td>TTGCAGTTGCCAATACCTATGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN2 REV</td>
			<td>CCAGTCACAGTAGTCGTCACA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 FOR</td>
			<td>AATGAGTTGGAGGGGCTGGGGGACATC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PLIN4 REV</td>
			<td>GGTCACCTAAACGAACGAAGTAGC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD FOR</td>
			<td>TCTAGCTCCTATACCACCACCA</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SCD REV</td>
			<td>TCGTCTCCAACTTATCTCCTCC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 FOR</td>
			<td>TGCTCATCAACCGCAACGAG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SLC2A1 REV</td>
			<td>CCGACTCTCTTCCTTCATCTCCTG</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S FOR</td>
			<td>CGCCGCTAGAGGTGAAATTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">18S REV</td>
			<td>TTGGCAAATGCTTTCGCTC</td>
			<td style="width:143px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

inducing and characterizing vesicular steatosis in differentiated heparg cells

La stéatose hépatique représente un dysfonctionnement métabolique qui résulte d'une accumulation de gouttelettes lipidiques contenant des triglycérides dans les hépatocytes. L'accumulation excessive de graisse mène à la maladie de foie gras non-alcoolique (NAFLD), qui est potentiellement réversible et peut évoluer en stéatohépatite non-alcoolique (NASH) et par la suite cirrhose et carcinome hépatocellulaire (HCC). Les mécanismes moléculaires liant l'accumulation de lipide dans les hépatocytes avec la progression à NASH, les dommages irréversibles de foie, la fibrose, la cirrhose, et même HCC restent toujours peu clairs. À cette fin, plusieurs modèles in vitro et in vivo ont été développés pour élucider les processus pathologiques qui causent nAFLD. Dans la présente étude, nous décrivons un modèle cellulaire pour l'induction de la stéatose vésiculaire du foie qui se compose de cellules hepaRG hepatic humaines différenciées DMSO traitées avec l'oleat de sodium de sel d'acide gras. En effet, les cellules HepaRG traitées à l'oleat de sodium accumulent des gouttelettes lipidiques dans le cytoplasme et présentent des caractéristiques typiques de la stéatose. Ce modèle humain in vitro représente une alternative précieuse aux modèles de souris in vivo ainsi qu'aux hépatocytes humains primaires. Nous présentons également une comparaison de plusieurs méthodes pour la quantification et l'évaluation de l'accumulation de graisse dans les cellules de HepaRG, y compris la coloration rouge d'huile o, la mesure cytofluorimétrique de Bodipy, l'analyse métabolique d'expression de gène par qPCR, et l'anti-Stokes cohérent Microscopie de diffusion raman (CARS). L'imagerie CARS combine la spécificité chimique de la spectroscopie Raman, une technique d'analyse chimique bien connue dans les applications de la science des matériaux, avec les avantages de microscopies optiques non linéaires à haute vitesse et à haute résolution pour permettre quantification de l'accumulation de lipides et de la dynamique des gouttelettes lipidiques. La mise en place d'un modèle in vitro efficace pour l'induction de la stéatose vésiculaire, ainsi qu'une méthode précise pour la quantification et la caractérisation de l'accumulation de lipides, pourrait conduire au développement d'un diagnostic précoce de NAFLD via le l'identification des marqueurs moléculaires et à la génération de nouvelles stratégies de traitement.

Ce protocole décrit une méthode efficace pour induire et caractériser la stéatose vésiculaire dans les cellules HepaRG différenciées d'IllSO par le traitement de l'oleatde de sodium (figure 1A).
Différenciation des cellules HepaRG. Pour induire efficacement la différenciation, les cellules proliférantes doivent être ensemencées à faible densité (2,5 x 104 cellules/cm2) dans le milieu de proli...

Watch this Scientific Journal Video about Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells at JoVE.com

Inducing and Characterizing Vesicular Steatosis in Differentiated HepaRG Cells

Dans cette étude, nous décrivons un protocole détaillé pour induire la stéatose vésiculaire de foie dans les cellules différenciées d'HépaRG avec l'oleat sodium de sel d'acide gras et employons des méthodes pour la détection et la quantification de l'accumulation de lipide, y compris les anti-Stokes cohérents Microscopie de diffusion raman (CARS), analyse cytofluorimétrique, coloration rouge huile O et qPCR.

Induire et caractériser la stéatose vésiculaire dans des cellules HepaRG différenciées

Hepatic steatosis represents a metabolic dysfunction that results from an accumulation of triglyceride-containing lipid droplets in hepatocytes. Excessive ...

Ce protocole décrit comment induire la stéatose vésiculaire de foie dans les cellules différenciées d’HepaRG et les méthodes pour la détection et la quantification de l’accumulation de lipide. Ce modèle de cellules humaines in vitro représente une alternative précieuse aux modèles de souris in vivo et aux hépatocytes humains primaires. Décongeler un lot de cellules HepaRG cryopréservées à faible passage d’azote en les immergeant dans un bain de 37 degrés Celsius jusqu’à ce qu’elles soient décongelées.Transférer rapidement les cellules dans un tube de 15 millilitres contenant 10 millilitres de milieu proliférant. Après avoir centrifugé pendant cinq minutes, jeter le supernatant et resuspendre les cellules en cinq millilitres de milieu proliférant. Comptez les cellules et diluez pour plaquer 250 000 cellules par centimètre carré.Plaquez les cellules sur des plats de culture cellulaire de 100 millimètres et renouvelez le milieu tous les deux ou trois jours. Les cellules prolifèrent avec un temps de doublement d’environ 24 heures. Une fois que les cellules HepaRG atteignent 80% de confluence, détachez-les par une incubation de trois à cinq minutes avec une solution trypsine de 0,05%.Recueillir les cellules en proliférant moyen et centrifugeuse pendant cinq minutes comme avant. Jetez le supernatant et resuspendez les cellules avec cinq millilitres de milieu proliférant. Encore une fois, comptez les cellules et diluez afin de plaquer 250 000 cellules par centimètre carré.À ce stade, amplifier les cellules en répétant ces étapes pour atteindre un nombre approprié de cellules pour commencer des expériences. Pour cryopréserver les cellules HepaRG, détachez les cellules 24 heures après le placage à travers une incubation de trois à cinq minutes avec une solution trypsine de 0,05%. Recueillir les cellules en proliférant moyen et centrifugeuse pendant cinq minutes comme avant.Jeter le supernatant, resuspendre les cellules en un millilitre par lot de milieu de congélation, et cryopréserver les lots dans de l’azote liquide. Le jour zéro, les cellules hépaRG de graines à 250.000 cellules par centimètre carré dans des plats traités par culture avec un volume approprié de milieu de prolifération. Deux plats doivent être plaqués pour chaque analyse, un pour les cellules de contrôle et un pour les cellules traitées à l’oléate.Le deuxième jour et le quatrième jour, changer le milieu avec un volume approprié de milieu de prolifération et laisser les cellules se développer jusqu’à ce qu’elles atteignent la confluence. Le septième jour, les cellules doivent être 100% confluentes. Lavez les cellules une fois avec 1X PBS.Ensuite, retirez le 1X PBS et ajoutez un volume approprié de support de différenciation. Les jours huit, neuf, 12, 15 et 18, lavez les cellules une fois avec 1X PBS avant d’ajouter un volume approprié de milieu de différenciation. Le jour 21, observez les cellules HepaRG au microscope et assurez-vous que les cellules sont des cultures différenciées confluentes.En tant que contrôle, récoltez un plat de contrôle pour effectuer l’analyse de l’expression génétique des gènes marqueurs de différenciation. Au jour 21, les cellules HepaRG différenciées peuvent être cryopréservées dans de l’azote liquide. Le jour 21, diluer l’oléate de sodium avec un volume approprié de milieu de différenciation complète à une concentration finale de 250 micromolaires.Ajouter 99% de méthanol à un rapport de un à 400 dans un autre aliquot de milieu de différenciation pour faire le traitement de contrôle du véhicule. Lavez les cellules une fois avec 1X PBS et ajoutez le véhicule ou le milieu d’oléate de sodium. Le jour 23 et le jour 25, changez le milieu avec le volume approprié de milieu fraîchement préparé.Le jour 26, observez les cellules par microscopie optique. Les gouttelettes lipidiques s’accumulent dans les cellules traitées à l’oléate de sodium et sont facilement visibles sous forme de gouttelettes translucides dans le cytoplasme. Pour effectuer la coloration oil red o, lavez d’abord les cellules une fois avec 1X PBS et retirez complètement le 1X PBS.Ajouter 4% de paraformaldéhyde et incuber pendant 15 minutes à température ambiante. Retirer le paraformaldéhyde et laver les cellules deux fois avec 1X PBS. Après avoir enlevé le PBS, incuber les cellules avec 60% d’isopropanol pendant cinq minutes à température ambiante.Retirer l’isopropanol et laisser sécher complètement les cellules à température ambiante. Maintenant, ajoutez la solution de travail Oil Red O aux cellules et incubez à température ambiante pendant 30 minutes. Le volume de solution de travail requis pour chaque échantillon correspond au volume de supports utilisés pour la culture des cellules.Retirer la solution Oil Red O et ajouter immédiatement de l’eau double distillée. Après avoir lavé les cellules quatre fois avec de l’eau double-distillée, acquérir des images sous le microscope pour analyse. Pour ésiguer le colorant Oil Red O, retirer toute l’eau et laisser sécher.Ensuite, ajouter un millilitre de 100% isopropanol et incuber pendant 10 minutes avec des secousses douces à température ambiante. Pipette l’isopropanol avec de l’huile eluted Red O colorant de haut en bas à plusieurs reprises, en veillant à ce que tout l’huile rouge O est dans la solution. Transférer la solution dans une cuvette.Mesurez la densité optique à 500 nanomètres par spectrophotométrie et utilisez 100% isopropanol comme blanc. Lavez les cellules une fois avec 1X PBS. Puis, incuber avec 100 nanomolaires de Bodipy dilués en 1X PBS dans l’obscurité pendant 40 minutes à 37 degrés Celsius.Un contrôle non taché doit être inclus dans les mesures de cytométrie du débit. Retirez la solution de coloration et lavez les cellules une fois avec 1X PBS. Ensuite, lavez les cellules à nouveau et retirez complètement le PBS.Ajouter 4% de paraformaldéhyde et incuber pendant 15 minutes à température ambiante. Retirer le paraformaldéhyde et laver les échantillons trois fois pendant cinq minutes dans PBS. Les cellules peuvent être conservées en 1X PBS à quatre degrés Celsius ou photographiées immédiatement.Pour le rangement, envelopper de Parafilm et couvrir de papier d’aluminium pour empêcher les cellules de sécher. Pour vérifier l’induction efficace de la stéatose, les cellules hépaRG traitées à l’oléate et de contrôle ont été tachées de colorant Oil Red O. Après coloration, les gouttelettes lipidiques sont facilement visibles sous forme de gouttelettes rouges.La coloration peut être quantifiée par mesure spectrophotométrique du colorant Oil R O élit avec de l’isopropanol. L’absorption de l’huile élitée Rouge O des cellules est directement proportionnelle à l’accumulation de gouttelettes lipidiques cytoplasmiques. La concentration d’oléate de sodium et le temps d’exposition ont été déterminés par l’essai colorimétrique de viabilité de cellules de MTT.Le produit Formosan est quantifié par son absorption à 490 nanomètres et est directement proportionnel au nombre de cellules vivantes en culture. Le traitement d’oléate de sodium a été comparé au traitement de palmitate de sodium. Le médicament apoptotique doxorubicine a été utilisé comme un contrôle.Pour quantifier l’augmentation de la teneur en lipides cellulaires après le traitement de l’oléate de sodium, la coloration avec le colorant Bodipy a été utilisée pour étiqueter les gouttelettes lipidiques. À l’aide de l’analyse cytofluorométrique, il est possible de quantifier la teneur en triglycérides par intensité fluorescente moyenne corporelle, qui est plus élevée dans les cellules traitées aux oléate que dans les cellules de contrôle. Ceci indique l’accumulation efficace de graisse après traitement d’oléate.En effet, des images de cellules tachées de bodipy montrent des gouttelettes fluorescentes vert vif de lipide dans les cellules oléate-traitées qui ne sont pas visibles dans les cellules de contrôle. Pour caractériser davantage l’accumulation de gouttelettes lipidiques après le traitement de l’oléate de sodium, la microscopie CARS peut être effectuée comme décrit dans le protocole textuel qui permet la quantification des gouttelettes lipidiques sans étiquetage. Ce modèle basé sur les cellules peut accroître la connaissance des mécanismes moléculaires impliqués dans la stéatose hépatique non oncotique et pourrait conduire à la mise au point de nouveaux marqueurs pour le diagnostic précoce et de nouvelles stratégies de traitement.

Research

JoVE Journal

Medicine

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Différenciation isolement, caractérisation et comparative de l&#39;homme dentaires cellules souches de pulpe Dérivé de dents permanentes à l&#39;aide de deux méthodes différentes

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Recherche

Médecine

Inducing Myointimal Hyperplasia Versus Atherosclerosis in Mice: An Introduction of Two Valid Models

Induisant myointimale hyperplasie Versus athérosclérose chez la souris: An Introduction de deux modèles valides

Various in vivo laboratory rodent models for the induction of artery stenosis have been established to mimic diseases that include arterial plaque ...

Minimal Invasive Surgical Procedure of Inducing Myocardial Infarction in Mice

Minimal intervention chirurgicale invasive d&#39;induire un infarctus du myocarde chez des souris

Myocardial infarction still remains the main cause of death in western countries, despite considerable progress in the stent development area in the last ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Etudier le cancer du pancréas Stem Cell Caractéristiques pour le développement de nouvelles stratégies de traitement

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucoma-inducing Procedure in an In Vivo Rat Model and Whole-mount Retina Preparation

Glaucomes induisant une procédure dans un<em&gt; In Vivo</em&gt; Modèle de rat et Whole-mount Retina Préparation

Glaucoma is a disease of the central nervous system affecting retinal ganglion cells (RGCs). RGC axons making up the optic nerve carry visual input to the ...

Inducing Ischemia-reperfusion Injury in the Mouse Ear Skin for Intravital Multiphoton Imaging of Immune Responses

Induire ischémie-reperfusion chez la souris Ear Skin pour Intravitale multiphotonique Imaging des réponses immunitaires

Ischemia-reperfusion injury (IRI) occurs when there is transient hypoxia due to the obstruction of blood flow (ischemia) followed by a subsequent ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskoline induite par Gonflement dans Intestinal organites: Un<em&gt; In vitro</em&gt; Essai pour évaluer la réponse des médicaments dans les patients atteints de fibrose kystique

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Analyse optimisée des<em&gt; In Vivo</em&gt; et<em&gt; In vitro</em&gt; Stéatose hépatique

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

Induire une lésion pulmonaire aigue chez la souris par instillation directe du lipopolysaccharide intratrachéal

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. ...

A Revised Method for Inducing Secondary Lymphedema in the Hindlimb of Mice

Une méthode révisée pour induire le lymphœdème secondaire dans le Hindlimb des souris

Animal models are of paramount importance in the research of lymphedema in order to understand the pathophysiology of the disease but also to explore ...